The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025522	Bordetella avium strain JBBA chromosome, complete genome	3837904	1392437	1482823	3837904	terminase,tail,integrase,tRNA,portal,protease,head,capsid	Pseudomonas_phage(13.51%)	98	1407538:1407554	1488303:1488319
AZY52192.1|1392437_1395299_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	3.3e-70
AZY54244.1|1395288_1396254_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AZY54245.1|1396302_1396971_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.3	5.2e-27
AZY52193.1|1397010_1398474_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AZY54246.1|1398480_1398756_-	hypothetical protein	NA	NA	NA	NA	NA
AZY52194.1|1399096_1400305_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
AZY52195.1|1400301_1402554_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	5.9e-107
AZY52196.1|1402909_1404832_-	ABC transporter	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
AZY52197.1|1404828_1405719_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AZY52198.1|1405725_1406859_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AZY52199.1|1406858_1407680_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
1407538:1407554	attL	TCGGCCACGCGCAGGCG	NA	NA	NA	NA
AZY52200.1|1407703_1408912_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
AZY52201.1|1409225_1410434_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	61.6	1.8e-131
AZY52202.1|1411000_1411501_+	hypothetical protein	NA	NA	NA	NA	NA
AZY52203.1|1411525_1412023_-	SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	63.0	3.6e-57
AZY52204.1|1412022_1412301_-	hypothetical protein	NA	NA	NA	NA	NA
AZY52205.1|1412297_1412882_-	hypothetical protein	NA	NA	NA	NA	NA
AZY52206.1|1413014_1414031_-	recombinase RecT	NA	Q858E1	Salmonella_phage	47.8	2.2e-61
AZY52207.1|1414042_1414882_-	exonuclease VIII	NA	V5YTC9	Pseudomonas_phage	32.2	1.6e-38
AZY52208.1|1414901_1415087_-	hypothetical protein	NA	NA	NA	NA	NA
AZY52209.1|1415083_1415371_-	hypothetical protein	NA	NA	NA	NA	NA
AZY52210.1|1415432_1415786_-	hypothetical protein	NA	NA	NA	NA	NA
AZY52211.1|1415961_1416207_-	hypothetical protein	NA	NA	NA	NA	NA
AZY52212.1|1417029_1417494_-	hypothetical protein	NA	NA	NA	NA	NA
AZY52213.1|1418028_1418457_-	hypothetical protein	NA	NA	NA	NA	NA
AZY52214.1|1419265_1419628_-	transcriptional regulator	NA	NA	NA	NA	NA
AZY52215.1|1419700_1419922_+	hypothetical protein	NA	NA	NA	NA	NA
AZY52216.1|1420253_1420631_-	hypothetical protein	NA	NA	NA	NA	NA
AZY52217.1|1420967_1421216_-	bssS family protein	NA	NA	NA	NA	NA
AZY52218.1|1421478_1421910_+	hypothetical protein	NA	NA	NA	NA	NA
AZY52219.1|1421942_1422158_+	hypothetical protein	NA	I6NMK4	Burkholderia_virus	42.9	8.0e-06
AZY52220.1|1422154_1422973_+	hypothetical protein	NA	A0A2I7RHJ6	Vibrio_phage	47.7	3.7e-19
AZY52221.1|1422959_1423658_+	hypothetical protein	NA	NA	NA	NA	NA
AZY54247.1|1423791_1424154_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	50.0	1.0e-21
AZY52222.1|1424164_1424548_+	hypothetical protein	NA	NA	NA	NA	NA
AZY52223.1|1424544_1425135_+	hypothetical protein	NA	NA	NA	NA	NA
AZY52224.1|1425336_1425819_+	hypothetical protein	NA	NA	NA	NA	NA
AZY52225.1|1426181_1426964_+	restriction endonuclease subunit M	NA	Q5ZQW7	Pseudomonas_phage	74.6	2.2e-114
AZY52226.1|1427501_1427780_-	hypothetical protein	NA	K4NZP3	Burkholderia_phage	59.2	1.0e-08
AZY52227.1|1427766_1428033_-	BrnT family toxin	NA	NA	NA	NA	NA
AZY52228.1|1428213_1428597_+	HNH endonuclease	NA	Q8W6N0	Burkholderia_virus	55.6	7.0e-29
AZY52229.1|1428792_1429275_+|terminase	phage terminase small subunit P27 family	terminase	A4JWZ6	Burkholderia_virus	64.6	2.7e-54
AZY54248.1|1429278_1431003_+|terminase	terminase large subunit	terminase	A4JWZ7	Burkholderia_virus	80.5	7.0e-278
AZY52230.1|1431156_1432389_+|portal	phage portal protein	portal	A0A1J0GUY8	Halomonas_phage	66.8	1.2e-154
AZY52231.1|1432397_1433015_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0GUZ0	Halomonas_phage	61.8	5.1e-61
AZY52232.1|1433027_1434251_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	59.3	3.6e-135
AZY54249.1|1434288_1434609_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	36.5	3.8e-12
AZY52233.1|1434619_1434958_+|head,tail	head-tail adaptor protein	head,tail	Q3HQT3	Burkholderia_phage	39.3	9.3e-09
AZY52234.1|1434954_1435449_+	hypothetical protein	NA	NA	NA	NA	NA
AZY52235.1|1435441_1435792_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AZY52236.1|1435791_1436232_+	hypothetical protein	NA	NA	NA	NA	NA
AZY52237.1|1436303_1436951_+|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	52.1	3.9e-56
AZY52238.1|1436984_1437302_+	hypothetical protein	NA	A0A0S2SYT8	Pseudomonas_phage	48.6	5.6e-24
AZY54250.1|1437364_1437610_+	hypothetical protein	NA	NA	NA	NA	NA
AZY52239.1|1437644_1443182_+|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	34.0	8.8e-72
AZY52240.1|1443178_1444069_+	hypothetical protein	NA	NA	NA	NA	NA
AZY52241.1|1444070_1445000_+|tail	phage tail protein	tail	NA	NA	NA	NA
AZY52242.1|1445005_1445398_+	hypothetical protein	NA	NA	NA	NA	NA
AZY52243.1|1445484_1445763_+	hypothetical protein	NA	NA	NA	NA	NA
AZY54251.1|1445778_1446585_+	hypothetical protein	NA	NA	NA	NA	NA
AZY52244.1|1446589_1446805_+	hypothetical protein	NA	NA	NA	NA	NA
AZY52245.1|1446804_1447356_+	lysozyme	NA	NA	NA	NA	NA
AZY52246.1|1447399_1447924_-	hypothetical protein	NA	NA	NA	NA	NA
AZY54252.1|1448208_1448664_+	DUF2514 domain-containing protein	NA	Q3HQV1	Burkholderia_phage	56.6	1.2e-06
AZY52247.1|1448792_1449077_-	transcriptional regulator	NA	NA	NA	NA	NA
AZY52248.1|1450068_1450407_+	hypothetical protein	NA	NA	NA	NA	NA
AZY52249.1|1451166_1451487_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZY52250.1|1451483_1451783_-	DNA-binding protein	NA	NA	NA	NA	NA
AZY52251.1|1452362_1452596_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AZY52252.1|1452783_1454541_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AZY52253.1|1455007_1455196_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
AZY52254.1|1455487_1455808_+	hypothetical protein	NA	NA	NA	NA	NA
AZY52255.1|1456115_1456319_+	cold-shock protein CspA	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
AZY52256.1|1456596_1457142_+	DUF924 domain-containing protein	NA	NA	NA	NA	NA
AZY52257.1|1457397_1457604_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.1	1.1e-15
AZY52258.1|1457673_1458252_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	34.3	1.8e-23
AZY52259.1|1458431_1459742_+	trigger factor	NA	NA	NA	NA	NA
AZY52260.1|1459744_1460398_+	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	7.5e-55
AZY52261.1|1460501_1461800_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.2	1.8e-129
AZY52262.1|1461974_1464407_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.0	2.5e-220
AZY52263.1|1464642_1466139_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	28.5	4.1e-16
AZY52264.1|1466246_1467491_+	benzoate transporter	NA	NA	NA	NA	NA
AZY54253.1|1467650_1468772_-	MFS transporter	NA	NA	NA	NA	NA
AZY52265.1|1469289_1469931_-	LexA repressor	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	3.2e-10
AZY52266.1|1470231_1471434_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AZY54254.1|1471509_1473540_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AZY52267.1|1473789_1474281_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AZY52268.1|1474470_1475004_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AZY52269.1|1475025_1476237_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
AZY52270.1|1476273_1476678_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	1.8e-51
AZY52271.1|1476679_1477003_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	52.3	1.2e-24
AZY52272.1|1477006_1477513_+	co-chaperone protein HscB	NA	NA	NA	NA	NA
AZY52273.1|1477545_1479408_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.8	1.3e-99
AZY52274.1|1479416_1479758_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AZY52275.1|1479757_1479952_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AZY52276.1|1480066_1480963_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AZY52277.1|1481007_1481295_-	hypothetical protein	NA	NA	NA	NA	NA
AZY52278.1|1481308_1482823_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.6	2.2e-81
1488303:1488319	attR	CGCCTGCGCGTGGCCGA	NA	NA	NA	NA
>prophage 2
CP025522	Bordetella avium strain JBBA chromosome, complete genome	3837904	2031611	2042645	3837904	tRNA	uncultured_Mediterranean_phage(25.0%)	12	NA	NA
AZY52663.1|2031611_2033042_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.4	1.4e-29
AZY52664.1|2033154_2033703_-	hypothetical protein	NA	NA	NA	NA	NA
AZY52665.1|2033806_2034586_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AZY52666.1|2034582_2035434_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A292GJG6	Xanthomonas_phage	40.3	9.2e-13
AZY54308.1|2035451_2036141_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.7	8.5e-33
AZY52667.1|2036230_2036989_-	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	6.2e-69
AZY52668.1|2037158_2037797_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZY52669.1|2037949_2038987_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	52.9	9.0e-95
AZY52670.1|2039085_2040378_+	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	36.3	5.8e-67
AZY52671.1|2040531_2041545_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AZY52672.1|2041656_2042040_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	27.6	1.5e-10
AZY54309.1|2042042_2042645_-	thymidylate synthase	NA	A0A1X9I5T8	Streptococcus_phage	48.6	7.4e-17
>prophage 3
CP025522	Bordetella avium strain JBBA chromosome, complete genome	3837904	2194260	2203782	3837904	integrase	Bordetella_phage(60.0%)	12	2191981:2191995	2203092:2203106
2191981:2191995	attL	ATGAAATCGACGCCG	NA	NA	NA	NA
AZY52798.1|2194260_2195343_-|integrase	integrase	integrase	A4PE72	Ralstonia_virus	38.9	3.4e-60
AZY52799.1|2195565_2195751_-	conjugal transfer protein TraR	NA	A0A2D0W9R7	Bordetella_phage	55.6	1.7e-12
AZY52800.1|2195753_2196239_-	hypothetical protein	NA	NA	NA	NA	NA
AZY54323.1|2196235_2197576_-	hypothetical protein	NA	Q774Z8	Bordetella_phage	68.2	2.0e-171
AZY52801.1|2197665_2198139_-	SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	59.5	6.2e-51
AZY52802.1|2198168_2198540_-	hypothetical protein	NA	Q775A2	Bordetella_phage	56.1	7.5e-28
AZY52803.1|2198630_2200799_-	DNA polymerase I	NA	Q775A3	Bordetella_phage	68.3	2.9e-281
AZY54324.1|2200795_2200996_-	hypothetical protein	NA	Q775A4	Bordetella_phage	60.4	2.2e-13
AZY52804.1|2201204_2201654_-	hypothetical protein	NA	A0A2H4J3Y5	uncultured_Caudovirales_phage	68.3	2.4e-36
AZY52805.1|2201664_2202258_-	DUF2815 domain-containing protein	NA	Q6J1N9	Burkholderia_virus	45.3	6.8e-31
AZY52806.1|2202271_2202478_-	hypothetical protein	NA	NA	NA	NA	NA
AZY52807.1|2202474_2203782_-	DUF2800 domain-containing protein	NA	Q775A7	Bordetella_phage	65.2	7.2e-150
2203092:2203106	attR	CGGCGTCGATTTCAT	NA	NA	NA	NA
>prophage 4
CP025522	Bordetella avium strain JBBA chromosome, complete genome	3837904	2206903	2241084	3837904	protease,terminase,head,tail	Bordetella_phage(58.62%)	31	NA	NA
AZY52814.1|2206903_2207296_-	hypothetical protein	NA	C7BGF7	Burkholderia_phage	47.3	1.1e-16
AZY52815.1|2207409_2207661_+	hypothetical protein	NA	A0A0R6PJ81	Moraxella_phage	43.8	2.1e-05
AZY52816.1|2207657_2208692_+	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	58.7	6.2e-104
AZY52817.1|2208688_2210962_+	replication protein	NA	B6SD24	Bacteriophage	55.6	3.5e-123
AZY52818.1|2211132_2211390_+	hypothetical protein	NA	Q775B7	Bordetella_phage	45.5	6.8e-12
AZY52819.1|2211450_2211987_+|terminase	terminase	terminase	Q775B8	Bordetella_phage	54.5	1.3e-36
AZY54325.1|2212091_2213594_+|terminase	terminase	terminase	Q775B9	Bordetella_phage	80.2	7.8e-249
AZY52820.1|2213634_2214099_+	GNAT family N-acetyltransferase	NA	Q775C0	Bordetella_phage	57.5	1.5e-41
AZY52821.1|2214095_2214560_+	hypothetical protein	NA	Q775C1	Bordetella_phage	64.3	7.7e-46
AZY52822.1|2214562_2214970_+	hypothetical protein	NA	Q775C2	Bordetella_phage	77.3	1.0e-09
AZY52823.1|2214979_2216644_+|head,tail	phage head-tail adapter protein	head,tail	T1S9Z7	Salmonella_phage	46.4	7.6e-136
AZY52824.1|2216655_2216988_+	hypothetical protein	NA	Q775C4	Bordetella_phage	77.1	1.2e-37
AZY52825.1|2217031_2217376_+	endopeptidase	NA	Q775C5	Bordetella_phage	52.2	1.5e-22
AZY52826.1|2217353_2218019_+|protease	protease	protease	Q775C6	Bordetella_phage	58.1	5.3e-40
AZY52827.1|2218031_2219045_+	hypothetical protein	NA	Q6J1R9	Burkholderia_virus	71.4	9.0e-140
AZY52828.1|2219065_2219509_+	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	43.3	2.4e-20
AZY52829.1|2219519_2219708_+	hypothetical protein	NA	NA	NA	NA	NA
AZY52830.1|2219786_2220428_+	hypothetical protein	NA	Q775D0	Bordetella_phage	60.1	7.1e-66
AZY52831.1|2220427_2222476_+	hypothetical protein	NA	Q775D1	Bordetella_phage	80.8	0.0e+00
AZY52832.1|2223253_2226226_+	hypothetical protein	NA	Q858G0	Salmonella_phage	25.0	1.4e-47
AZY52833.1|2226225_2228064_+	hypothetical protein	NA	NA	NA	NA	NA
AZY52834.1|2228056_2230510_+	hypothetical protein	NA	A0A2H4J9B2	uncultured_Caudovirales_phage	42.8	1.0e-176
AZY52835.1|2230569_2232090_+	hypothetical protein	NA	Q775D5	Bordetella_phage	46.3	5.3e-43
AZY52836.1|2232105_2233266_+	hypothetical protein	NA	G8CLA7	Synechococcus_phage	38.6	3.0e-46
AZY52837.1|2233294_2233669_+	hypothetical protein	NA	Q775D7	Bordetella_phage	87.9	6.4e-59
AZY52838.1|2233953_2234940_+	Retron-type reverse transcriptase	NA	Q775D8	Bordetella_phage	64.5	4.8e-130
AZY52839.1|2235420_2235669_+	hypothetical protein	NA	Q775E0	Bordetella_phage	74.7	5.0e-28
AZY52840.1|2235668_2236166_+	hypothetical protein	NA	Q775E1	Bordetella_phage	71.8	2.1e-65
AZY54326.1|2236228_2236792_+	hypothetical protein	NA	Q775E2	Bordetella_phage	80.1	5.1e-60
AZY52841.1|2238643_2239681_+	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	29.4	1.6e-11
AZY52842.1|2239596_2241084_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.6	2.1e-20
>prophage 5
CP025522	Bordetella avium strain JBBA chromosome, complete genome	3837904	2467420	2495054	3837904	tail,terminase,integrase,protease,head	Bordetella_phage(65.22%)	35	2460930:2460944	2497637:2497651
2460930:2460944	attL	AATCAAAAAATGCCT	NA	NA	NA	NA
AZY53019.1|2467420_2467813_-	hypothetical protein	NA	L0MXF6	Edwardsiella_phage	40.3	1.1e-05
AZY53020.1|2467818_2468931_-|tail	phage tail protein	tail	Q775D5	Bordetella_phage	67.3	1.5e-50
AZY53021.1|2469091_2472508_-	hypothetical protein	NA	M1IDU6	Pelagibacter_phage	24.1	2.8e-52
AZY53022.1|2472467_2474084_-	hypothetical protein	NA	W6MYA2	Pseudomonas_phage	28.6	3.3e-19
AZY53023.1|2474074_2474668_-	hypothetical protein	NA	Q775D2	Bordetella_phage	45.8	3.5e-19
AZY53024.1|2474679_2476725_-	hypothetical protein	NA	Q775D1	Bordetella_phage	93.7	0.0e+00
AZY53025.1|2476724_2477396_-	hypothetical protein	NA	Q775D0	Bordetella_phage	93.2	2.1e-116
AZY54347.1|2477470_2477656_-	hypothetical protein	NA	Q775C9	Bordetella_phage	79.4	6.8e-22
AZY53026.1|2477683_2478106_-	hypothetical protein	NA	Q775C8	Bordetella_phage	82.1	3.3e-56
AZY53027.1|2478124_2479120_-	hypothetical protein	NA	Q775C7	Bordetella_phage	97.6	4.5e-184
AZY53028.1|2479133_2479826_-|protease	protease	protease	Q775C6	Bordetella_phage	80.0	1.1e-83
AZY53029.1|2479782_2480130_-	endopeptidase	NA	Q775C5	Bordetella_phage	89.6	3.1e-52
AZY53030.1|2480216_2481884_-|head,tail	phage head-tail adapter protein	head,tail	T1S9Z7	Salmonella_phage	46.0	2.4e-134
AZY53031.1|2481885_2482263_-	hypothetical protein	NA	Q775C2	Bordetella_phage	85.7	3.8e-11
AZY53032.1|2482266_2482725_-	hypothetical protein	NA	Q775C1	Bordetella_phage	90.8	8.3e-69
AZY53033.1|2482721_2483186_-	GNAT family N-acetyltransferase	NA	Q775C0	Bordetella_phage	93.5	8.7e-74
AZY54348.1|2483229_2484648_-|terminase	terminase	terminase	Q775B9	Bordetella_phage	77.0	7.9e-227
AZY53034.1|2484767_2485343_-|terminase	terminase	terminase	Q775B8	Bordetella_phage	85.6	4.2e-78
AZY53035.1|2485361_2485628_-	hypothetical protein	NA	Q775B7	Bordetella_phage	84.2	1.2e-27
AZY54349.1|2485609_2485729_-	hypothetical protein	NA	NA	NA	NA	NA
AZY53036.1|2485788_2486418_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	49.4	2.8e-30
AZY53037.1|2486414_2486897_-	hypothetical protein	NA	NA	NA	NA	NA
AZY53038.1|2486893_2487862_-	hypothetical protein	NA	A0A2H4FS76	Methylophilaceae_phage	41.8	1.1e-14
AZY53039.1|2487861_2488071_-	hypothetical protein	NA	NA	NA	NA	NA
AZY53040.1|2488072_2488387_-	transcriptional regulator	NA	NA	NA	NA	NA
AZY53041.1|2488657_2488906_+	hypothetical protein	NA	NA	NA	NA	NA
AZY53042.1|2489316_2490270_+	phage repressor protein	NA	B5TK58	Pseudomonas_phage	26.1	2.2e-10
AZY53043.1|2490346_2490541_+	hypothetical protein	NA	NA	NA	NA	NA
AZY53044.1|2490722_2491331_+	hypothetical protein	NA	NA	NA	NA	NA
AZY53045.1|2491685_2492414_+	hypothetical protein	NA	NA	NA	NA	NA
AZY53046.1|2493112_2493439_+	hypothetical protein	NA	NA	NA	NA	NA
AZY53047.1|2493539_2493824_+	hypothetical protein	NA	NA	NA	NA	NA
AZY53048.1|2493820_2494306_+	HNH endonuclease	NA	NA	NA	NA	NA
AZY53049.1|2494428_2494815_-	hypothetical protein	NA	Q3LZN5	Bacteriophage	57.4	2.0e-07
AZY53050.1|2494862_2495054_-|integrase	integrase	integrase	NA	NA	NA	NA
2497637:2497651	attR	AGGCATTTTTTGATT	NA	NA	NA	NA
>prophage 6
CP025522	Bordetella avium strain JBBA chromosome, complete genome	3837904	2764786	2820755	3837904	terminase,tail,integrase,tRNA,plate,portal,head,capsid	Burkholderia_phage(27.59%)	60	2764574:2764598	2794782:2794806
2764574:2764598	attL	TTGGCGGAGACGGTGGGATTCGAAC	NA	NA	NA	NA
AZY53250.1|2764786_2765827_+	hypothetical protein	NA	Q7M293	Enterobacteria_phage	41.4	1.4e-71
AZY53251.1|2765828_2766455_+	hypothetical protein	NA	NA	NA	NA	NA
AZY53252.1|2767024_2768095_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	60.1	2.5e-116
AZY54375.1|2768094_2769843_-|terminase	terminase	terminase	A4JWQ1	Burkholderia_virus	64.9	9.5e-214
AZY53253.1|2770001_2770859_+	hypothetical protein	NA	A0A077K9W8	Ralstonia_phage	45.1	5.4e-53
AZY53254.1|2770888_2771929_+|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	56.7	1.8e-106
AZY53255.1|2771928_2772699_+|integrase	integrase	integrase	A4PE31	Ralstonia_virus	40.7	5.4e-36
AZY53256.1|2772792_2773260_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	52.2	5.4e-31
AZY54376.1|2773256_2773466_+|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	56.5	8.3e-16
AZY53257.1|2773470_2773833_+	hypothetical protein	NA	NA	NA	NA	NA
AZY53258.1|2773829_2774129_+	hypothetical protein	NA	NA	NA	NA	NA
AZY53259.1|2774121_2774928_+	peptidoglycan-binding protein	NA	E5E3R7	Burkholderia_phage	57.1	8.3e-72
AZY53260.1|2775189_2775462_+	hypothetical protein	NA	E5E3W0	Burkholderia_phage	52.9	3.4e-17
AZY53261.1|2775445_2775949_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	39.4	1.5e-23
AZY53262.1|2775941_2776406_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	51.7	8.0e-35
AZY53263.1|2776467_2777094_+|plate	phage baseplate assembly protein V	plate	A4PE41	Ralstonia_virus	48.7	5.1e-45
AZY53264.1|2777105_2777447_+|plate	baseplate assembly protein	plate	K4PAX6	Burkholderia_phage	49.1	2.5e-17
AZY53265.1|2777448_2778366_+|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	54.4	2.8e-76
AZY53266.1|2778349_2778988_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	57.0	8.4e-51
AZY53267.1|2779691_2779913_-	hypothetical protein	NA	NA	NA	NA	NA
AZY53268.1|2780365_2780548_+	hypothetical protein	NA	NA	NA	NA	NA
AZY53269.1|2780671_2781853_+|tail	phage tail protein	tail	Q9ZXK4	Pseudomonas_virus	66.4	2.1e-148
AZY53270.1|2781909_2782425_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	57.9	1.4e-51
AZY53271.1|2782449_2782818_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	46.2	6.6e-16
AZY53272.1|2782826_2782943_+|tail	GpE family phage tail protein	tail	E5FFG6	Burkholderia_phage	78.8	3.0e-07
AZY53273.1|2782946_2785685_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	43.0	1.1e-171
AZY53274.1|2785697_2786153_+	oxidoreductase	NA	Q9ZXJ9	Pseudomonas_virus	50.4	1.2e-32
AZY53275.1|2786152_2787256_+	late control protein	NA	K4PAY4	Burkholderia_phage	48.8	4.9e-83
AZY53276.1|2787683_2788082_-	hypothetical protein	NA	E5E3P4	Burkholderia_phage	56.6	9.6e-13
AZY54377.1|2788414_2788687_+	transcriptional regulator	NA	NA	NA	NA	NA
AZY53277.1|2788676_2789078_+	hypothetical protein	NA	NA	NA	NA	NA
AZY53278.1|2789159_2789393_+	hypothetical protein	NA	NA	NA	NA	NA
AZY53279.1|2789928_2792742_+	hypothetical protein	NA	K4NXL6	Burkholderia_phage	48.7	4.3e-248
AZY53280.1|2793324_2794767_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	36.0	1.9e-63
AZY53281.1|2794951_2796211_-	aspartate kinase	NA	NA	NA	NA	NA
2794782:2794806	attR	TTGGCGGAGACGGTGGGATTCGAAC	NA	NA	NA	NA
AZY53282.1|2796303_2797329_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AZY53283.1|2797347_2798313_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AZY53284.1|2798349_2798994_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
AZY53285.1|2799007_2800459_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	33.3	1.0e-35
AZY53286.1|2800661_2801348_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AZY54378.1|2801479_2801986_+	cyclophilin	NA	NA	NA	NA	NA
AZY53287.1|2801978_2802749_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AZY53288.1|2802855_2803704_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AZY53289.1|2803731_2805318_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	42.9	3.8e-36
AZY54379.1|2805478_2806258_-	inositol monophosphatase	NA	NA	NA	NA	NA
AZY53290.1|2806403_2807207_+	RNA methyltransferase	NA	NA	NA	NA	NA
AZY53291.1|2807295_2807706_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
AZY53292.1|2807710_2808556_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZY53293.1|2808552_2809545_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
AZY53294.1|2809720_2810476_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZY53295.1|2810486_2811320_-	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
AZY54380.1|2811375_2812467_-	DUF1513 domain-containing protein	NA	NA	NA	NA	NA
AZY53296.1|2812456_2813515_-	aminopeptidase	NA	NA	NA	NA	NA
AZY53297.1|2813511_2815005_-	thiol oxidoreductase	NA	NA	NA	NA	NA
AZY53298.1|2815001_2816294_-	peptidase	NA	NA	NA	NA	NA
AZY53299.1|2816606_2817608_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZY53300.1|2817611_2818388_+	ABC transporter permease	NA	NA	NA	NA	NA
AZY53301.1|2818384_2819206_+	nitrate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	1.5e-28
AZY53302.1|2819202_2819379_+	DUF4089 domain-containing protein	NA	NA	NA	NA	NA
AZY53303.1|2819375_2820755_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A	tRNA	NA	NA	NA	NA
