The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034787	Escherichia coli strain ECCNB20-2 chromosome, complete genome	4795280	1052482	1062942	4795280		Escherichia_phage(57.14%)	9	NA	NA
AZW03444.1|1052482_1053475_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AZW03445.1|1053568_1054933_-	GntP family transporter	NA	NA	NA	NA	NA
AZW03446.1|1055021_1055798_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AZW03447.1|1055802_1056441_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AZW03448.1|1056437_1057700_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
AZW03449.1|1057696_1058605_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.9e-118
AZW03450.1|1058800_1059568_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AZW03451.1|1059618_1060275_-	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.3	5.6e-50
AZW03452.1|1060380_1062942_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
>prophage 2
CP034787	Escherichia coli strain ECCNB20-2 chromosome, complete genome	4795280	1098024	1205611	4795280	integrase,transposase,tail,tRNA,plate,lysis	Salmonella_phage(55.32%)	111	1142170:1142218	1161789:1161837
AZW03489.1|1098024_1100655_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
AZW03490.1|1100889_1101075_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AZW03491.1|1102532_1103099_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AZW03492.1|1103095_1103524_+	DedA family protein	NA	NA	NA	NA	NA
AZW03493.1|1103596_1105153_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AZW03494.1|1105302_1105818_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AZW03495.1|1105881_1107420_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
AZW03496.1|1107436_1108609_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
AZW03497.1|1108735_1109266_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
AZW03498.1|1109356_1109692_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
AZW03499.1|1109681_1110419_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZW03500.1|1110542_1111727_-	MFS transporter	NA	NA	NA	NA	NA
AZW03501.1|1111792_1111987_+	hypothetical protein	NA	NA	NA	NA	NA
AZW03502.1|1112018_1113011_-	proline/glycine betaine ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
AZW03503.1|1113068_1114133_-	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
AZW03504.1|1114125_1115328_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
AZW03505.1|1115681_1116641_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
AZW03506.1|1116650_1118795_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
AZW03507.1|1118767_1119178_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
AZW03508.1|1119174_1119420_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
AZW03509.1|1119667_1119997_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
AZW03510.1|1120148_1120493_+	DUF2002 family protein	NA	NA	NA	NA	NA
AZW03511.1|1120529_1120979_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
AZW03512.1|1121647_1122052_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
AZW03513.1|1122098_1122623_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
AZW03514.1|1122632_1122932_-	transcriptional regulator	NA	NA	NA	NA	NA
AZW03515.1|1123114_1123273_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
AZW03516.1|1123356_1123806_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
AZW03517.1|1123806_1124469_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
AZW03518.1|1124489_1125890_-	GABA permease	NA	NA	NA	NA	NA
AZW03519.1|1126127_1127408_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
AZW03520.1|1127421_1128870_-	NADP-dependent succinate-semialdehyde dehydrogenase I	NA	NA	NA	NA	NA
AZW03521.1|1128892_1130161_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
AZW03522.1|1130180_1131158_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
AZW06704.1|1131493_1132498_-	alpha amylase	NA	NA	NA	NA	NA
AZW03523.1|1132539_1133391_-	alpha-mannosidase	NA	NA	NA	NA	NA
AZW03524.1|1133409_1133742_-	hypothetical protein	NA	NA	NA	NA	NA
AZW03525.1|1134891_1136054_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AZW03526.1|1137159_1138056_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AZW03527.1|1138052_1138949_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
AZW03528.1|1138938_1140495_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.0	3.2e-19
AZW03529.1|1140777_1142007_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	86.6	4.6e-207
1142170:1142218	attL	TATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AZW03530.1|1142303_1143365_-	hypothetical protein	NA	NA	NA	NA	NA
AZW03531.1|1143370_1144387_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	93.7	2.0e-187
AZW03532.1|1144390_1145020_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.5	2.3e-61
AZW03533.1|1145143_1145386_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
AZW03534.1|1145418_1145928_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	3.3e-82
AZW03535.1|1145935_1146232_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.3	2.2e-22
AZW03536.1|1146349_1146691_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	96.5	1.9e-54
AZW03537.1|1146758_1146992_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
AZW03538.1|1146991_1147219_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
AZW06705.1|1147903_1148227_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	81.9	1.6e-34
AZW06706.1|1148156_1148360_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	82.0	5.2e-23
AZW03539.1|1148322_1148754_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	9.0e-65
AZW03540.1|1148746_1149193_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.0	7.6e-59
AZW03541.1|1149225_1150176_-	hypothetical protein	NA	A0A1S6KZY1	Salmonella_phage	35.1	2.7e-21
AZW03542.1|1150263_1150842_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	82.3	7.7e-88
AZW03543.1|1150838_1151198_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	77.3	2.7e-46
AZW03544.1|1151184_1152093_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	88.1	6.2e-140
AZW03545.1|1152085_1152691_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	87.6	2.8e-104
AZW03546.1|1152687_1154019_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	58.8	5.7e-102
AZW03547.1|1154015_1154426_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	55.3	3.6e-15
AZW03548.1|1154557_1155730_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.3	1.4e-208
AZW03549.1|1155739_1156255_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.8	1.8e-91
AZW03550.1|1156309_1156612_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	97.0	1.4e-43
AZW03551.1|1156626_1156746_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	5.7e-14
AZW03552.1|1156738_1159813_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	79.3	0.0e+00
AZW03553.1|1159809_1160295_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	94.4	1.7e-72
AZW03554.1|1160291_1161392_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.1	4.0e-186
AZW03555.1|1161460_1161676_+	late control protein B	NA	Q53ZE7	Salmonella_virus	72.2	9.4e-23
AZW03556.1|1162369_1162852_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1161789:1161837	attR	TATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AZW03557.1|1162983_1163460_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AZW03558.1|1163449_1163740_+	RnfH family protein	NA	NA	NA	NA	NA
AZW03559.1|1163801_1164143_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AZW03560.1|1164291_1165953_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AZW03561.1|1166038_1166917_-	NAD(+) kinase	NA	NA	NA	NA	NA
AZW03562.1|1166848_1167043_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AZW03563.1|1167039_1167633_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AZW03564.1|1167687_1168929_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AZW06707.1|1168994_1169786_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AZW03565.1|1169952_1171314_+	signal recognition particle protein	NA	NA	NA	NA	NA
AZW03566.1|1171450_1171699_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AZW06708.1|1171717_1172266_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AZW03567.1|1172296_1173064_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AZW03568.1|1173105_1173453_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZW03569.1|1173528_1174011_-	OmpA family protein	NA	NA	NA	NA	NA
AZW03570.1|1174026_1175253_-	diguanylate cyclase	NA	NA	NA	NA	NA
AZW03571.1|1175242_1175761_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AZW03572.1|1175910_1176276_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
AZW03573.1|1176485_1177556_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
AZW03574.1|1177566_1178688_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AZW03575.1|1178730_1179891_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AZW06709.1|1179989_1180037_-	Phe operon leader peptide	NA	NA	NA	NA	NA
AZW03576.1|1180140_1180482_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AZW03577.1|1180752_1181490_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AZW03578.1|1181624_1182605_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AZW03579.1|1182601_1183333_+	polyphenol oxidase	NA	NA	NA	NA	NA
AZW03580.1|1183462_1186036_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
AZW03581.1|1191891_1193190_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
AZW03582.1|1193186_1193510_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
AZW06710.1|1193555_1194911_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AZW03583.1|1195024_1197685_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AZW03584.1|1197716_1198415_-	DTW domain-containing protein YfiP	NA	NA	NA	NA	NA
AZW03585.1|1198483_1198903_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AZW03586.1|1199109_1200147_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AZW03587.1|1200194_1200884_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
AZW03588.1|1201188_1201572_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
AZW03589.1|1201627_1202215_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
AZW03590.1|1202317_1203199_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZW03591.1|1203407_1204742_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AZW03592.1|1204873_1205611_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
CP034787	Escherichia coli strain ECCNB20-2 chromosome, complete genome	4795280	1683800	1693241	4795280		Enterobacteria_phage(85.71%)	10	NA	NA
AZW04004.1|1683800_1684727_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AZW04005.1|1684731_1685463_+	ABC transporter permease	NA	NA	NA	NA	NA
AZW04006.1|1685443_1685551_-	protein YohO	NA	NA	NA	NA	NA
AZW04007.1|1685610_1686342_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AZW04008.1|1686563_1688249_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AZW04009.1|1688245_1688965_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AZW04010.1|1689011_1689482_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AZW04011.1|1689521_1689983_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AZW04012.1|1690107_1692108_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
AZW04013.1|1692104_1693241_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.1e-161
>prophage 4
CP034787	Escherichia coli strain ECCNB20-2 chromosome, complete genome	4795280	2535037	2543268	4795280	tRNA	Escherichia_phage(62.5%)	9	NA	NA
AZW04729.1|2535037_2535847_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AZW04730.1|2535903_2536098_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AZW04731.1|2536090_2536300_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AZW04732.1|2536378_2536594_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AZW04733.1|2536595_2537831_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
AZW04734.1|2537882_2538818_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AZW04735.1|2538946_2540320_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.9e-52
AZW04736.1|2540797_2541781_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AZW04737.1|2542035_2543268_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	5.2e-17
>prophage 5
CP034787	Escherichia coli strain ECCNB20-2 chromosome, complete genome	4795280	2968469	3050923	4795280	protease,transposase,tRNA	Escherichia_phage(19.23%)	59	NA	NA
AZW05123.1|2968469_2969234_-|protease	metalloprotease	protease	NA	NA	NA	NA
AZW05124.1|2969402_2970686_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZW05125.1|2970756_2971845_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	5.4e-82
AZW05126.1|2972043_2972736_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AZW05127.1|2972865_2974626_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AZW05128.1|2975031_2975889_+	formate transporter FocA	NA	NA	NA	NA	NA
AZW05129.1|2975943_2978226_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AZW05130.1|2978417_2979158_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
AZW05131.1|2979239_2979830_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
AZW05132.1|2979929_2980838_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZW05133.1|2980838_2982269_-	amino acid permease	NA	NA	NA	NA	NA
AZW05134.1|2982478_2983627_-	MFS transporter	NA	NA	NA	NA	NA
AZW05135.1|2983940_2984567_+	hydrolase	NA	NA	NA	NA	NA
AZW05136.1|2984601_2985465_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AZW05137.1|2985466_2986084_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AZW05138.1|2986094_2988539_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AZW05139.1|2988777_2990070_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AZW05140.1|2990160_2991504_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AZW06778.1|2991514_2992126_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
AZW05141.1|2992280_2996309_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AZW05142.1|2996443_2996938_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
AZW05143.1|2997482_2998448_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AZW05144.1|2998570_3000337_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AZW05145.1|3000337_3002059_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
AZW05146.1|3002100_3002805_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZW05147.1|3003089_3003308_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZW05148.1|3003797_3004640_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AZW06779.1|3004724_3004922_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AZW05149.1|3005143_3005521_-	toxin	NA	NA	NA	NA	NA
AZW05150.1|3005610_3005979_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AZW05151.1|3006028_3006679_-	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	31.6	8.0e-25
AZW05152.1|3006691_3006913_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	5.5e-10
AZW05153.1|3006981_3007458_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AZW05154.1|3007472_3007958_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	1.5e-12
AZW05155.1|3008048_3008867_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.3	8.0e-46
AZW05156.1|3009193_3012040_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
AZW05157.1|3012412_3013285_-	GTPase family protein	NA	NA	NA	NA	NA
AZW05158.1|3013548_3015105_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	6.5e-105
AZW05159.1|3015101_3016337_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AZW05160.1|3016458_3019575_+	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
AZW05161.1|3019643_3020624_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
AZW05162.1|3020932_3022030_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	1.8e-157
AZW06780.1|3023971_3024769_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	99.6	1.5e-145
AZW05163.1|3025456_3026670_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	2.5e-168
AZW05164.1|3029122_3029473_-|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.4e-39
AZW05165.1|3030723_3032082_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
AZW05166.1|3032460_3032652_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
AZW05167.1|3034074_3034461_+	hypothetical protein	NA	NA	NA	NA	NA
AZW05168.1|3034469_3034661_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AZW05169.1|3034738_3037678_+	DUF4145 domain-containing protein	NA	U5J9B0	Bacillus_phage	25.5	7.1e-12
AZW05170.1|3037674_3039099_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AZW05171.1|3039330_3040254_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	2.1e-175
AZW05172.1|3040470_3040587_+	AMP nucleosidase	NA	NA	NA	NA	NA
AZW05173.1|3040788_3041382_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AZW05174.1|3042589_3044413_-	hypothetical protein	NA	NA	NA	NA	NA
AZW05175.1|3044513_3044762_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AZW05176.1|3044777_3046343_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AZW05177.1|3046566_3047775_-	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	34.2	4.9e-44
AZW05178.1|3048646_3050923_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	2.5e-166
>prophage 6
CP034787	Escherichia coli strain ECCNB20-2 chromosome, complete genome	4795280	3083263	3102085	4795280	integrase,tail	Salmonella_phage(73.68%)	23	3086028:3086041	3102961:3102974
AZW05209.1|3083263_3083521_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
AZW05210.1|3083550_3083928_-	hypothetical protein	NA	NA	NA	NA	NA
AZW05211.1|3084197_3085883_+	transporter	NA	NA	NA	NA	NA
3086028:3086041	attL	ATGGGTTTTTTGTT	NA	NA	NA	NA
AZW06782.1|3086118_3086337_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	67.6	1.7e-19
AZW05212.1|3086427_3087528_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	87.2	3.4e-177
AZW05213.1|3087524_3088010_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
AZW05214.1|3088006_3089881_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	61.5	1.9e-188
AZW05215.1|3089890_3090715_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	89.4	1.4e-143
AZW05216.1|3091439_3093113_-	hypothetical protein	NA	NA	NA	NA	NA
AZW05217.1|3093436_3093670_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.8e-35
AZW05218.1|3093681_3093870_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AZW05219.1|3094022_3096437_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.0	0.0e+00
AZW05220.1|3096433_3097291_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	1.4e-157
AZW05221.1|3097287_3097515_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AZW05222.1|3097514_3097748_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
AZW05223.1|3097815_3098157_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AZW05224.1|3098274_3098571_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
AZW05225.1|3098578_3099088_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
AZW05226.1|3099120_3099342_-	regulator	NA	NA	NA	NA	NA
AZW05227.1|3099467_3100037_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
AZW05228.1|3100052_3100244_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
AZW05229.1|3100432_3101452_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	1.4e-103
AZW05230.1|3101617_3102085_+	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	36.8	1.9e-20
3102961:3102974	attR	ATGGGTTTTTTGTT	NA	NA	NA	NA
>prophage 7
CP034787	Escherichia coli strain ECCNB20-2 chromosome, complete genome	4795280	3383153	3416442	4795280	capsid,integrase,transposase,tail,protease	Enterobacteria_phage(30.0%)	27	3404856:3404902	3416456:3416502
AZW05470.1|3383153_3384266_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AZW05471.1|3384342_3384495_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
AZW05472.1|3384592_3385962_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	2.2e-112
AZW05473.1|3386229_3387348_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AZW05474.1|3387413_3387662_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
AZW05475.1|3387726_3388095_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AZW05476.1|3388188_3388842_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AZW05477.1|3388949_3390197_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AZW05478.1|3390264_3391641_-	aromatic amino acid transporter AroP	NA	NA	NA	NA	NA
AZW05479.1|3391742_3394886_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.0	6.4e-59
AZW05480.1|3394897_3396121_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
AZW05481.1|3396136_3396469_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
AZW05482.1|3396626_3398000_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
AZW05483.1|3398156_3398840_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
AZW05484.1|3398829_3400278_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
AZW05485.1|3401014_3402916_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.9	3.5e-28
AZW05486.1|3402943_3403405_+	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
3404856:3404902	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
AZW05487.1|3405325_3406279_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
AZW05488.1|3406528_3407278_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZW05489.1|3408138_3408807_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZW05490.1|3408751_3408889_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AZW05491.1|3408861_3409446_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	5.0e-103
AZW05492.1|3412356_3412590_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
AZW05493.1|3412647_3413058_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AZW05494.1|3413736_3414225_-	GIY-YIG nuclease family protein	NA	K7P7S3	Enterobacteria_phage	99.4	1.6e-86
AZW05495.1|3414416_3415169_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	92.9	3.0e-92
AZW05496.1|3415278_3416442_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
3416456:3416502	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 8
CP034787	Escherichia coli strain ECCNB20-2 chromosome, complete genome	4795280	3734406	3801181	4795280	protease,transposase,plate,tRNA	Clostridioides_phage(11.11%)	58	NA	NA
AZW05773.1|3734406_3734904_-|transposase	transposase	transposase	NA	NA	NA	NA
AZW05774.1|3735079_3735853_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
AZW05775.1|3736038_3736299_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
AZW05776.1|3736301_3736580_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
AZW05777.1|3736735_3737476_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
AZW05778.1|3737446_3738214_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AZW05779.1|3738419_3738998_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AZW05780.1|3739237_3741682_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZW05781.1|3741724_3742198_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
AZW05782.1|3742351_3743122_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
AZW05783.1|3743162_3744299_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AZW05784.1|3744902_3745121_-	hypothetical protein	NA	NA	NA	NA	NA
AZW05785.1|3749720_3750221_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AZW05786.1|3750255_3750480_+	hypothetical protein	NA	NA	NA	NA	NA
AZW05787.1|3750530_3752006_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AZW05788.1|3752012_3752426_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AZW05789.1|3752429_3754280_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AZW05790.1|3754243_3755326_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AZW05791.1|3755350_3756631_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AZW05792.1|3757461_3757944_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AZW05793.1|3757987_3758902_+	hypothetical protein	NA	NA	NA	NA	NA
AZW05794.1|3758911_3759391_+	hypothetical protein	NA	NA	NA	NA	NA
AZW05795.1|3759527_3760313_-	aminopeptidase	NA	NA	NA	NA	NA
AZW05796.1|3760848_3761580_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
AZW05797.1|3761644_3762112_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AZW05798.1|3762108_3762831_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZW05799.1|3762864_3763620_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AZW05800.1|3763691_3765050_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AZW05801.1|3765097_3765721_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZW05802.1|3765724_3766525_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AZW05803.1|3766765_3767680_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZW05804.1|3767676_3768480_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	1.4e-39
AZW05805.1|3774323_3774896_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AZW05806.1|3775083_3776115_+	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
AZW05807.1|3776107_3776761_+	methionine ABC transporter	NA	NA	NA	NA	NA
AZW05808.1|3776800_3777616_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
AZW05809.1|3777733_3778138_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AZW05810.1|3778134_3778842_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AZW05811.1|3778952_3780671_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AZW05812.1|3780723_3781548_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
AZW05813.1|3781747_3782458_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
AZW05814.1|3782471_3782894_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AZW05815.1|3782890_3783436_-	YaeQ family protein	NA	NA	NA	NA	NA
AZW05816.1|3783601_3783802_+	YaeP family protein	NA	NA	NA	NA	NA
AZW05817.1|3783788_3784049_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
AZW05818.1|3784097_3785396_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AZW05819.1|3785460_3785850_-	VOC family protein	NA	NA	NA	NA	NA
AZW05820.1|3785906_3788048_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
AZW05821.1|3788146_3789106_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AZW05822.1|3789118_3792601_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
AZW05823.1|3792637_3793234_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
AZW05824.1|3793230_3794379_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AZW05825.1|3794378_3795167_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZW05826.1|3795170_3795626_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
AZW05827.1|3795730_3796756_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZW05828.1|3796759_3797245_-	molecular chaperone Skp	NA	NA	NA	NA	NA
AZW05829.1|3797366_3799799_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AZW05830.1|3799828_3801181_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 9
CP034787	Escherichia coli strain ECCNB20-2 chromosome, complete genome	4795280	4467191	4560089	4795280	capsid,integrase,head,tail,tRNA,portal,plate,protease,lysis,holin,terminase	Escherichia_phage(39.13%)	98	4523826:4523872	4557301:4557347
AZW06381.1|4467191_4468292_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AZW06382.1|4468331_4468691_-	YijD family membrane protein	NA	NA	NA	NA	NA
AZW06830.1|4468690_4469341_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
AZW06383.1|4469671_4471072_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AZW06384.1|4471054_4471972_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
AZW06385.1|4472238_4473612_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AZW06386.1|4473672_4474449_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AZW06387.1|4474456_4475461_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AZW06388.1|4475614_4476766_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
AZW06389.1|4477117_4479769_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AZW06390.1|4479950_4481684_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
AZW06391.1|4481898_4482750_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZW06392.1|4482736_4483078_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
AZW06393.1|4483079_4483958_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
AZW06394.1|4483923_4486221_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
AZW06395.1|4486271_4486592_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
AZW06396.1|4486606_4487686_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
AZW06397.1|4487994_4490496_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
AZW06398.1|4490507_4491170_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
AZW06399.1|4491180_4492284_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
AZW06400.1|4492558_4493176_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
AZW06401.1|4493202_4494108_-	DMT family transporter	NA	NA	NA	NA	NA
AZW06402.1|4494200_4496381_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
AZW06403.1|4496709_4497600_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AZW06404.1|4497948_4500381_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
AZW06405.1|4500383_4501544_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AZW06406.1|4501820_4502138_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
AZW06407.1|4502321_4502930_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
AZW06408.1|4502990_4503203_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
AZW06409.1|4503405_4505604_+	primosomal protein N'	NA	NA	NA	NA	NA
AZW06410.1|4505759_4506785_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
AZW06411.1|4506876_4507836_+	cell division protein FtsN	NA	NA	NA	NA	NA
AZW06412.1|4507928_4508459_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
AZW06413.1|4508468_4509800_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
AZW06414.1|4509866_4510793_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AZW06415.1|4510885_4511371_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AZW06416.1|4511455_4511701_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
AZW06417.1|4512125_4512971_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
AZW06418.1|4512993_4514502_+	glycerol kinase	NA	NA	NA	NA	NA
AZW06419.1|4514636_4515647_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
AZW06420.1|4515743_4516490_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AZW06421.1|4516494_4516923_-	universal stress protein UspD	NA	NA	NA	NA	NA
AZW06422.1|4516949_4517249_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
AZW06423.1|4517460_4517901_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AZW06424.1|4518001_4518601_+	DUF1454 family protein	NA	NA	NA	NA	NA
AZW06425.1|4518708_4519476_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
AZW06426.1|4519530_4520286_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
AZW06427.1|4520392_4521382_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZW06428.1|4521701_4522664_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AZW06429.1|4522844_4523747_-	cation-efflux pump FieF	NA	NA	NA	NA	NA
4523826:4523872	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AZW06430.1|4523983_4524238_-	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AZW06431.1|4524283_4525447_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	7.0e-205
AZW06432.1|4525446_4525926_-|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	2.5e-84
AZW06433.1|4525940_4528388_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.8	0.0e+00
AZW06831.1|4528380_4528500_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AZW06434.1|4528532_4528808_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AZW06435.1|4528864_4529383_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AZW06436.1|4529395_4530586_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	2.4e-224
AZW06437.1|4530845_4531538_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	99.1	5.6e-125
AZW06438.1|4532029_4532209_+	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
AZW06439.1|4532261_4532540_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06440.1|4532760_4533288_-|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	96.0	3.1e-91
AZW06441.1|4533291_4535301_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	97.6	0.0e+00
AZW06442.1|4535311_4535842_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	99.4	2.3e-102
AZW06443.1|4535834_4536743_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
AZW06444.1|4536747_4537095_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AZW06445.1|4537091_4537727_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	6.5e-112
AZW06446.1|4537793_4538246_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
AZW06447.1|4538238_4538706_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	97.4	1.6e-80
AZW06448.1|4538668_4538842_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AZW06449.1|4538795_4539239_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	97.2	1.7e-66
AZW06450.1|4539226_4539652_-	protein lysA	NA	U5N096	Enterobacteria_phage	98.6	1.7e-60
AZW06451.1|4539666_4540164_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AZW06452.1|4540163_4540445_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
AZW06453.1|4540448_4540652_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
AZW06454.1|4540651_4541161_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AZW06455.1|4541260_4542004_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	97.6	1.3e-127
AZW06456.1|4542007_4543081_-|capsid	phage major capsid protein, P2 family	capsid	Q94MD1	Enterobacteria_phage	99.2	2.8e-200
AZW06457.1|4543139_4543994_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	6.2e-134
AZW06458.1|4544167_4545940_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
AZW06459.1|4545939_4546974_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.4	2.1e-200
AZW06460.1|4547266_4548184_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06461.1|4548186_4548471_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06462.1|4548937_4549885_-	TIR domain-containing protein	NA	K7PLZ9	Enterobacterial_phage	38.0	4.9e-31
AZW06463.1|4550124_4550682_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06464.1|4550702_4551086_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06465.1|4551406_4553686_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.4	0.0e+00
AZW06466.1|4553675_4553951_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	98.9	3.3e-44
AZW06467.1|4553947_4554172_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
AZW06468.1|4554174_4554474_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
AZW06469.1|4554473_4554698_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AZW06470.1|4554761_4555262_-	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AZW06471.1|4555431_4555704_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
AZW06472.1|4555840_4556134_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
AZW06473.1|4556203_4557184_+|integrase	integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
AZW06832.1|4557370_4557871_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4557301:4557347	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AZW06474.1|4558020_4558719_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	9.0e-06
AZW06475.1|4558715_4560089_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
CP034789	Escherichia coli strain ECCNB20-2 plasmid pTB422, complete sequence	159108	18899	79216	159108	transposase,integrase	Escherichia_phage(27.27%)	50	43091:43109	48636:48654
AZW07107.1|18899_19664_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AZW07211.1|19635_20013_-	hypothetical protein	NA	Q6JIG6	Burkholderia_virus	38.4	2.0e-07
AZW07108.1|20095_20314_-	hypothetical protein	NA	NA	NA	NA	NA
AZW07109.1|20421_21114_+	hypothetical protein	NA	B1B6L9	Salmonella_phage	39.1	1.3e-25
AZW07110.1|21216_21573_-	hypothetical protein	NA	NA	NA	NA	NA
AZW07111.1|21518_22103_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZW07112.1|22102_23341_-	MFS transporter	NA	NA	NA	NA	NA
AZW07113.1|23337_24243_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AZW07114.1|24835_25540_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZW07115.1|26184_27195_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	53.9	6.7e-87
AZW07116.1|27935_29102_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
AZW07117.1|29101_30073_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	89.7	4.2e-155
AZW07118.1|31253_32462_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	81.8	1.7e-190
AZW07119.1|32778_34050_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	1.0e-153
AZW07120.1|34049_34475_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
AZW07121.1|34627_34879_+	hypothetical protein	NA	NA	NA	NA	NA
AZW07122.1|35173_35386_-	hypothetical protein	NA	NA	NA	NA	NA
AZW07123.1|35352_36514_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.5e-167
AZW07212.1|39381_39696_+	hypothetical protein	NA	NA	NA	NA	NA
AZW07124.1|40053_40977_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	1.8e-171
AZW07125.1|41116_41503_-	hypothetical protein	NA	NA	NA	NA	NA
AZW07126.1|42128_43052_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	99.7	1.4e-176
43091:43109	attL	GATTTATTCAACAAAGCCC	NA	NA	NA	NA
AZW07127.1|44014_45043_-|integrase	integrase	integrase	Q5XLQ5	Enterobacteria_phage	42.4	2.2e-61
AZW07128.1|46451_47156_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZW07129.1|47951_48182_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AZW07130.1|48178_48595_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AZW07131.1|49477_49849_-	hypothetical protein	NA	NA	NA	NA	NA
48636:48654	attR	GGGCTTTGTTGAATAAATC	NA	NA	NA	NA
AZW07213.1|50157_51666_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.7	8.1e-44
AZW07132.1|52207_53284_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZW07133.1|56169_56379_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	89.5	8.9e-10
AZW07134.1|56417_56804_+	bleomycin binding protein	NA	NA	NA	NA	NA
AZW07135.1|57123_57516_-	NimC/NimA family protein	NA	NA	NA	NA	NA
AZW07136.1|57850_58555_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZW07137.1|60071_63224_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
AZW07138.1|63293_63773_-	transcriptional regulator	NA	NA	NA	NA	NA
AZW07139.1|63874_64579_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZW07140.1|64569_64761_+	hypothetical protein	NA	NA	NA	NA	NA
AZW07141.1|65220_66036_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AZW07142.1|66140_66899_+	APH(3'') family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
AZW07143.1|66898_67735_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AZW07144.1|68121_68316_+	hypothetical protein	NA	NA	NA	NA	NA
AZW07145.1|68357_69008_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZW07146.1|69113_70313_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AZW07147.1|72994_73855_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AZW07214.1|74036_74399_+	mercury transporter MerC	NA	NA	NA	NA	NA
AZW07148.1|74450_76145_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AZW07149.1|76162_76525_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AZW07150.1|76521_76758_+	mercury resistance protein	NA	NA	NA	NA	NA
AZW07151.1|76754_77462_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AZW07152.1|77500_79216_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP034789	Escherichia coli strain ECCNB20-2 plasmid pTB422, complete sequence	159108	93913	102031	159108	plate	Escherichia_phage(71.43%)	7	NA	NA
AZW07217.1|93913_94294_+	hypothetical protein	NA	A0A077SK46	Escherichia_phage	97.6	1.3e-67
AZW07165.1|94462_95659_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AZW07166.1|95675_96677_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AZW07167.1|96902_98609_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.6	0.0e+00
AZW07168.1|100077_100893_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.5	5.4e-111
AZW07169.1|100928_101510_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	96.9	1.8e-100
AZW07170.1|101521_102031_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	99.4	6.6e-91
>prophage 3
CP034789	Escherichia coli strain ECCNB20-2 plasmid pTB422, complete sequence	159108	137095	159062	159108	transposase	Escherichia_phage(76.19%)	23	NA	NA
AZW07188.1|137095_137737_-	maturation control protein	NA	Q71TG2	Escherichia_phage	100.0	5.2e-117
AZW07219.1|137926_138157_-	recombination enhancement function domain protein	NA	Q71TG3	Escherichia_phage	94.5	1.4e-35
AZW07189.1|139511_139823_-	lysogeny establishment protein	NA	Q71TG4	Escherichia_phage	100.0	1.6e-47
AZW07190.1|139873_140905_-	recombinase	NA	Q71TG5	Escherichia_phage	100.0	9.9e-195
AZW07191.1|140912_141134_-	creatininase	NA	Q38403	Escherichia_phage	98.6	2.9e-35
AZW07192.1|142383_142479_+	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AZW07193.1|142444_142654_+	c1 repressor inactivator	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
AZW07194.1|142764_143616_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
AZW07195.1|143970_144894_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
AZW07196.1|145017_146061_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.6	8.2e-205
AZW07197.1|146088_146268_-	PdcA protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
AZW07198.1|146272_146653_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
AZW07199.1|146652_146874_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AZW07200.1|147056_148613_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	4.9e-105
AZW07201.1|148609_149878_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AZW07202.1|149999_153116_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.7	3.7e-27
AZW07203.1|153382_153889_-	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	98.8	2.7e-92
AZW07204.1|153961_155059_-	hypothetical protein	NA	Q71TI8	Escherichia_phage	97.5	4.9e-200
AZW07205.1|154995_155223_-	hypothetical protein	NA	A0A077SL55	Escherichia_phage	100.0	6.2e-17
AZW07206.1|155224_155443_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AZW07207.1|155524_155716_-	hypothetical protein	NA	Q71TJ0	Escherichia_phage	98.3	2.5e-27
AZW07208.1|156751_157486_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZW07209.1|157788_159062_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	6.8e-169
>prophage 1
CP034790	Escherichia coli strain ECCNB20-2 plasmid pTB423, complete sequence	91762	0	91565	91762	holin,portal,lysis,capsid,plate,tRNA,head,tail,terminase,integrase	Escherichia_phage(88.76%)	100	41599:41615	62613:62629
AZW07221.1|906_1662_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
AZW07222.1|2050_2872_+	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	99.3	1.3e-157
AZW07223.1|7061_7436_+	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	99.2	1.6e-65
AZW07224.1|7432_8863_+|plate	baseplate protein	plate	A0A222YWB2	Escherichia_phage	99.4	2.0e-270
AZW07225.1|8873_9719_+|tail	phage tail protein	tail	A0A222YWB7	Escherichia_phage	99.6	2.2e-160
AZW07306.1|10110_10260_+|tail	phage tail protein	tail	A0A222YXS1	Escherichia_phage	95.9	5.1e-20
AZW07307.1|10289_13613_+|tail	phage tail protein	tail	A0A077SK37	Escherichia_phage	57.1	0.0e+00
AZW07226.1|13615_14149_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	86.4	4.1e-83
AZW07227.1|14177_14705_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	95.4	6.8e-91
AZW07308.1|14706_15669_-|tail	phage tail protein	tail	A0A0C4UQV0	Shigella_phage	92.2	1.3e-175
AZW07228.1|16946_17507_-	recombinase family protein	NA	A0A222YWP5	Escherichia_phage	98.4	6.1e-98
AZW07229.1|17613_17940_+|holin	holin	holin	A0A222YZ46	Escherichia_phage	100.0	3.3e-51
AZW07230.1|17939_18386_+|lysis	lysis protein	lysis	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
AZW07231.1|18375_18996_+	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	99.5	1.1e-79
AZW07232.1|18988_20914_+|head	head protein	head	A0A222YWA3	Escherichia_phage	97.1	7.1e-311
AZW07233.1|20913_21282_+	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	84.7	8.0e-38
AZW07234.1|24407_24701_+	hypothetical protein	NA	NA	NA	NA	NA
AZW07235.1|24735_24999_-	transcriptional regulator	NA	NA	NA	NA	NA
AZW07236.1|25011_25314_-	hypothetical protein	NA	NA	NA	NA	NA
AZW07237.1|25947_27180_+|portal	phage portal protein	portal	A0A222YXQ7	Escherichia_phage	100.0	9.6e-237
AZW07238.1|27193_28192_+|head	head processing protein	head	A0A222YWA7	Escherichia_phage	99.4	1.2e-181
AZW07239.1|28392_29355_+	lytic replication protein	NA	A0A222YXV1	Escherichia_phage	97.8	1.4e-174
AZW07240.1|29768_29993_+	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	100.0	8.8e-40
AZW07241.1|29992_30700_+	DNA-binding protein	NA	A0A222YXY0	Escherichia_phage	91.5	5.7e-117
AZW07309.1|30699_30897_+	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	96.9	3.8e-31
AZW07242.1|30929_31415_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	100.0	3.3e-92
AZW07243.1|31565_38405_+	helicase SNF2	NA	A0A222YYH3	Escherichia_phage	93.9	0.0e+00
AZW07244.1|38441_38876_+	olxA	NA	A0A222YZ35	Escherichia_phage	93.8	1.6e-74
AZW07245.1|38878_39139_+	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	90.7	5.4e-41
AZW07310.1|39472_39769_+	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	100.0	5.4e-53
AZW07246.1|39783_39984_+	hypothetical protein	NA	A0A222YWF9	Escherichia_phage	78.8	2.1e-24
AZW07311.1|39998_40280_+	hypothetical protein	NA	A0A222YW96	Escherichia_phage	82.8	1.8e-34
AZW07312.1|40395_41604_+	hypothetical protein	NA	A0A222YW83	Escherichia_phage	93.8	7.0e-216
41599:41615	attL	AAATAATATGTTAGAAA	NA	NA	NA	NA
AZW07313.1|44875_45067_+	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.2e-30
AZW07314.1|45273_45459_+	hypothetical protein	NA	Q5QBF3	Escherichia_phage	82.0	1.5e-21
AZW07247.1|45567_45960_+	late promoter activating protein	NA	NA	NA	NA	NA
AZW07315.1|46340_47321_+	DNA pacase A subunit	NA	NA	NA	NA	NA
AZW07248.1|47320_48829_+|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	56.6	1.2e-161
AZW07249.1|48900_49938_-	phage repressor protein	NA	NA	NA	NA	NA
AZW07250.1|50323_51352_+|integrase	integrase	integrase	Q5QBN6	Enterobacteria_phage	41.6	8.7e-58
AZW07316.1|51461_51770_+	hypothetical protein	NA	Q5QBE7	Escherichia_phage	100.0	1.4e-51
AZW07251.1|51766_52243_+	hypothetical protein	NA	NA	NA	NA	NA
AZW07252.1|52239_52734_+	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	99.4	2.2e-91
AZW07253.1|52748_53426_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	73.3	2.1e-92
AZW07254.1|53432_54200_+	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	97.2	4.7e-133
AZW07255.1|54189_55284_+	hypothetical protein	NA	Q71T61	Escherichia_phage	32.7	2.3e-40
AZW07256.1|55329_55719_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	95.3	1.1e-66
AZW07257.1|55842_56094_-	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	98.8	7.1e-38
AZW07317.1|56096_56297_-	hypothetical protein	NA	NA	NA	NA	NA
AZW07258.1|56408_57167_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	72.5	4.4e-115
AZW07259.1|57163_57373_-	hypothetical protein	NA	NA	NA	NA	NA
AZW07260.1|57628_57922_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	1.8e-45
AZW07261.1|57934_58339_-	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	61.2	1.3e-25
AZW07262.1|58331_58613_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	93.5	4.6e-46
AZW07263.1|58605_59433_-	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	61.3	5.9e-81
AZW07264.1|59429_59639_-	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
AZW07265.1|59640_59829_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
AZW07266.1|60174_60669_-	ead/Ea22-like family protein	NA	K7P881	Enterobacteria_phage	51.1	4.4e-23
AZW07267.1|60665_61283_-	ead/Ea22-like family protein	NA	A0A222YY85	Escherichia_phage	79.7	2.6e-25
AZW07268.1|61269_61569_-	hypothetical protein	NA	A0A222YY12	Escherichia_phage	99.0	3.9e-51
AZW07269.1|61582_62578_-	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	95.8	1.4e-190
AZW07270.1|62682_63366_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	86.6	1.2e-116
62613:62629	attR	AAATAATATGTTAGAAA	NA	NA	NA	NA
AZW07271.1|63362_63590_-	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	95.8	5.6e-34
AZW07272.1|63586_63862_-	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	98.9	1.6e-43
AZW07273.1|63858_64575_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	95.1	3.0e-41
AZW07274.1|64571_64934_-	carboxylate--amine ligase	NA	A0A222YZB4	Escherichia_phage	87.4	2.9e-40
AZW07318.1|64923_65208_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	91.5	2.0e-41
AZW07275.1|65237_65861_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	77.3	1.5e-81
AZW07276.1|66134_66713_+	recombinase	NA	A0A222YXV2	Escherichia_phage	88.0	1.5e-67
AZW07319.1|67269_67497_-	hypothetical protein	NA	NA	NA	NA	NA
AZW07277.1|67682_68291_-	hypothetical protein	NA	NA	NA	NA	NA
AZW07278.1|68574_69228_+	maturation control protein	NA	A0A222YZ79	Escherichia_phage	98.2	7.1e-114
AZW07279.1|69556_69886_+|plate	baseplate protein	plate	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
AZW07280.1|69878_71075_+|tail	phage tail protein	tail	A0A222YXT1	Escherichia_phage	97.2	3.5e-199
AZW07281.1|71109_71469_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	98.3	3.5e-62
AZW07282.1|71472_71775_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	1.3e-17
AZW07283.1|71920_72712_+|tail	phage tail protein	tail	A0A222YXU3	Escherichia_phage	95.4	3.6e-144
AZW07284.1|72708_73476_+|plate	baseplate	plate	A0A222YWF4	Escherichia_phage	93.3	3.1e-132
AZW07285.1|73479_74460_+|tail	tail length tape measure protein	tail	A0A222YXZ0	Escherichia_phage	96.3	2.7e-181
AZW07286.1|74456_75110_+|plate	baseplate protein	plate	A0A222YWF1	Escherichia_phage	85.7	6.5e-99
AZW07287.1|75169_76075_+	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	95.0	4.2e-157
AZW07288.1|76058_76739_+	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	100.0	5.8e-135
AZW07289.1|76731_77637_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A222YYM0	Escherichia_phage	98.7	1.0e-171
AZW07290.1|77685_79347_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
AZW07291.1|79615_79900_-	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	76.8	1.2e-30
AZW07292.1|79892_80534_-	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	93.4	1.8e-109
AZW07293.1|80812_81151_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	93.8	2.7e-48
AZW07294.1|81163_82120_-	recombinase	NA	A0A222YXF2	Escherichia_phage	99.4	1.4e-179
AZW07295.1|82397_82682_+	alanine racemase	NA	A0A222YXW1	Escherichia_phage	81.9	8.9e-37
AZW07296.1|82681_83485_+	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	84.3	8.5e-101
AZW07297.1|83555_84014_+	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	99.3	9.2e-68
AZW07298.1|84167_84626_-	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	98.7	2.3e-87
AZW07320.1|84643_85036_-	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	96.9	9.6e-66
AZW07299.1|85194_86892_+|capsid	capsid protein	capsid	A0A222YWC7	Escherichia_phage	97.5	0.0e+00
AZW07300.1|87038_87317_+	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	98.9	6.9e-42
AZW07301.1|87384_89043_+|tail	phage tail protein	tail	A0A222YWC8	Escherichia_phage	99.8	2.1e-311
AZW07302.1|89086_89821_+	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	99.6	1.0e-124
AZW07303.1|89888_90461_+	hypothetical protein	NA	A0A222YY02	Escherichia_phage	99.5	1.8e-100
AZW07304.1|90469_90961_+|plate	baseplate protein	plate	A0A222YWE4	Escherichia_phage	99.4	1.3e-88
AZW07305.1|91013_91565_+	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	97.8	2.5e-96
>prophage 1
CP034788	Escherichia coli strain ECCNB20-2 plasmid pTBMCR421, complete sequence	254365	18824	129362	254365	transposase,integrase	Escherichia_phage(36.36%)	114	61854:61913	78264:79083
AZW06869.1|18824_20193_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
AZW06870.1|20292_20451_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
AZW06871.1|20529_21642_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AZW06872.1|22219_22423_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06873.1|22468_22819_-	hypothetical protein	NA	NA	NA	NA	NA
AZW07085.1|22878_23478_-	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	42.6	1.7e-08
AZW06874.1|23577_24522_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06875.1|25623_26808_+	DNA-binding protein	NA	NA	NA	NA	NA
AZW06876.1|26873_27155_+	hypothetical protein	NA	NA	NA	NA	NA
AZW07086.1|27411_27618_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06877.1|27738_28035_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06878.1|28079_28517_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06879.1|28584_29121_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06880.1|29285_29654_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06881.1|30086_30389_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06882.1|30745_31030_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06883.1|31095_31449_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06884.1|31735_32467_-	NERD domain-containing protein	NA	NA	NA	NA	NA
AZW06885.1|32468_33650_-	S49 family peptidase	NA	B8QTU8	Erwinia_phage	29.2	3.4e-13
AZW06886.1|33660_34323_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
AZW06887.1|34309_35419_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06888.1|35418_37503_-	hypothetical protein	NA	NA	NA	NA	NA
AZW07087.1|37502_40649_-	helicase	NA	NA	NA	NA	NA
AZW06889.1|40658_41396_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06890.1|41392_41878_-	plasmid transfer protein	NA	NA	NA	NA	NA
AZW06891.1|42636_43437_+	trhR	NA	NA	NA	NA	NA
AZW06892.1|43438_43951_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06893.1|44544_45591_+	thioredoxin family protein	NA	NA	NA	NA	NA
AZW06894.1|45580_46996_+	conjugal transfer protein	NA	NA	NA	NA	NA
AZW06895.1|47004_50958_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AZW06896.1|51138_52428_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	32.9	5.5e-09
AZW06897.1|52535_52781_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06898.1|52832_54041_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AZW06899.1|54522_55062_-	lytic transglycosylase	NA	NA	NA	NA	NA
AZW06900.1|55209_55959_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AZW06901.1|55983_56376_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06902.1|56409_56832_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06903.1|56891_57503_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06904.1|57609_58419_+	DsbA family protein	NA	NA	NA	NA	NA
AZW06905.1|58464_59724_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.3	2.6e-96
AZW06906.1|59707_60142_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
AZW06907.1|60335_60953_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06908.1|61102_61459_+	hypothetical protein	NA	NA	NA	NA	NA
61854:61913	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AZW06909.1|61916_62621_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZW06910.1|62810_63626_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AZW06911.1|63776_64481_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZW06912.1|64711_65575_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
AZW06913.1|65612_65858_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06914.1|66326_67118_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
AZW06915.1|67972_68236_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06916.1|68297_68630_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
AZW06917.1|68799_69591_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AZW06918.1|69683_70943_-	CmlA family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	31.7	6.3e-26
AZW06919.1|71204_71996_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AZW06920.1|72053_72662_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AZW06921.1|72757_73600_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
AZW06922.1|73766_74780_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZW07088.1|74982_75333_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AZW06923.1|75458_76019_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AZW06924.1|77555_78260_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZW06925.1|78442_78748_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZW06926.1|78758_79964_-	chromate efflux transporter	NA	NA	NA	NA	NA
78264:79083	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCTATTGAACTGTCAGGAGCTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACAATCCAGTTAGGGTATAGCTCAACCTGACATAGAAGCAAAAACTCAACCACCTTCTACCAACTCTCCGAACAGCTCCTTGACCTTTGTTTTCGCATCAGCAAGTGCAGTTCTGCCTTGTTCAGTGATGTCATAAACACGCCGTTCACGTCGCCCGGTGCGTTCGTGGCGTGAGGTCAGATAGCCTTTTTTTTCCAGGCCGTGCAGCATCGGGTACACGGTGCCAGCGCTCATCTCGTAGCCGTGTCGGCGTAGCTCTTCGATGATCCCCAGCCCAAAGACAGGTTCCTCGGCTGCATGGTGAAGGATGTGCAGGCGGATCAAACCGCCGTAGAGGTCTTTGTCAGTCATTTTTTGTGCCTCACAGAGCGACGCTCAACAGCCACCCAGCTGCACCGCTACCGAGGACAACCAGCCACGGCGGGAGCTTCCAGAACATAAGTGCGACAAGGGCAACTAATGCCAAGCCGAAGTCTTGCGGCTGAAAGATGGCGCTAGTCCATACAGGCTGATACAGCGCGGCCAGCAGCAAGCCGACTACAGCGGCATTGATCCCGGCCAGCGCAGCTTGGATGCCTGTATTGCGGCGCAAACGCTCCCAAAATGGCATTGATCCGACGACCAGCAAGAACGAGGGCGCGAAGATAGCCAGCAGACACACAATGCCGCCGATCCAGCCCGACGGG	NA	NA	NA	NA
AZW07089.1|81179_81266_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
AZW06927.1|81281_83201_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	100.0	0.0e+00
AZW06928.1|83276_83882_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	7.0e-116
AZW06929.1|84656_85322_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06930.1|85379_85760_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06931.1|86402_87221_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AZW06932.1|87217_88423_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AZW06933.1|88486_88690_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06934.1|88702_90022_-	DUF1173 family protein	NA	NA	NA	NA	NA
AZW06935.1|90272_91700_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
AZW07090.1|91914_92430_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
AZW06936.1|92432_93329_+	hypothetical protein	NA	NA	NA	NA	NA
AZW07091.1|93550_93784_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06937.1|93829_94084_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06938.1|94121_94409_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06939.1|94445_94676_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06940.1|95012_95474_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06941.1|95503_95911_+	hypothetical protein	NA	NA	NA	NA	NA
AZW07092.1|95961_96279_-	hypothetical protein	NA	NA	NA	NA	NA
AZW07093.1|96655_97006_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06942.1|98695_99400_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZW06943.1|99405_100152_+	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
AZW06944.1|100151_100670_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06945.1|100674_101091_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
AZW06946.1|101702_102578_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
AZW06947.1|102880_103585_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZW06948.1|103698_104475_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
AZW06949.1|104495_104717_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06950.1|104703_105729_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
AZW06951.1|106150_106903_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
AZW06952.1|108713_109199_+	phenol hydroxylase	NA	NA	NA	NA	NA
AZW06953.1|109395_110486_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AZW06954.1|110575_111391_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AZW06955.1|111477_111780_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AZW06956.1|111673_111925_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06957.1|111955_113449_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZW06958.1|113560_113866_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZW06959.1|113893_115108_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AZW06960.1|115324_116209_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AZW06961.1|117133_117838_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
AZW07094.1|117922_118324_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06962.1|119873_120578_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZW07095.1|120607_121312_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
AZW06963.1|121979_123416_-	glutathione synthase	NA	NA	NA	NA	NA
AZW06964.1|123503_123692_-	hypothetical protein	NA	NA	NA	NA	NA
AZW06965.1|123682_124387_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZW06966.1|124508_125414_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AZW06967.1|125410_126649_+	MFS transporter	NA	NA	NA	NA	NA
AZW06968.1|126648_127233_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZW06969.1|127178_127535_+	hypothetical protein	NA	NA	NA	NA	NA
AZW06970.1|127725_128490_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AZW06971.1|128657_129362_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
