The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029758	Clostridium sp. AWRP chromosome, complete genome	4579114	897358	906174	4579114		Synechococcus_phage(50.0%)	9	NA	NA
AZV55830.1|897358_898795_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.7	5.5e-50
AZV55831.1|898988_899180_-	hydrolase	NA	NA	NA	NA	NA
AZV55832.1|899326_899959_-	hydrolase	NA	NA	NA	NA	NA
AZV55833.1|900368_900848_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AZV55834.1|900849_901557_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.1	5.4e-43
AZV55835.1|901597_903043_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.1	1.7e-54
AZV55836.1|903056_904052_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	43.7	2.4e-65
AZV55837.1|904039_904654_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.9	1.7e-24
AZV55838.1|904674_906174_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.1	1.1e-66
>prophage 2
CP029758	Clostridium sp. AWRP chromosome, complete genome	4579114	1154445	1174253	4579114	transposase	Clostridium_phage(33.33%)	31	NA	NA
AZV56043.1|1154445_1154925_+	transcriptional regulator	NA	A0A2K9V3J3	Faecalibacterium_phage	42.3	6.5e-24
AZV56044.1|1154942_1155152_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56045.1|1155245_1155443_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56046.1|1155439_1155709_-	CRISPR-associated protein Cas2	NA	A0A2H4JCX4	uncultured_Caudovirales_phage	41.9	4.2e-12
AZV56047.1|1155915_1156341_+	hypothetical protein	NA	NA	NA	NA	NA
AZV59031.1|1156348_1156486_+	sporulation protein Spo0E	NA	NA	NA	NA	NA
AZV56048.1|1156486_1156741_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56049.1|1156866_1158852_+	recombinase RecF	NA	A0A1L2K2K3	Aeribacillus_phage	37.6	1.2e-95
AZV56050.1|1158878_1159832_+	recombinase RecT	NA	A0A1L2JY28	Aeribacillus_phage	42.6	2.1e-61
AZV56051.1|1159831_1160557_+	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	51.1	8.9e-65
AZV56052.1|1160630_1161461_+	hypothetical protein	NA	A0A1L2JY26	Aeribacillus_phage	73.4	1.5e-31
AZV59032.1|1161432_1162260_+	DNA replication protein	NA	D2XQ17	Bacillus_virus	33.5	3.8e-27
AZV56053.1|1162294_1162717_+	hypothetical protein	NA	NA	NA	NA	NA
AZV59033.1|1162744_1163230_+	hypothetical protein	NA	I2E8Y1	Clostridium_phage	51.9	7.3e-07
AZV56054.1|1163329_1163746_+	hypothetical protein	NA	A0A0A7RTV9	Clostridium_phage	59.1	4.0e-38
AZV56055.1|1163738_1164380_+	hypothetical protein	NA	A0A0A7RW43	Clostridium_phage	61.7	3.4e-68
AZV56056.1|1164563_1164971_+	hypothetical protein	NA	NA	NA	NA	NA
AZV59034.1|1165079_1165478_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56057.1|1165632_1166004_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56058.1|1166048_1166807_+	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	30.8	1.7e-18
AZV56059.1|1166784_1167090_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56060.1|1167093_1167519_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56061.1|1167787_1167970_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56062.1|1168195_1168723_+	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	31.1	1.6e-15
AZV56063.1|1168805_1168988_+	toxin-antitoxin system, toxin component, HicA family protein	NA	A0A0C5AC70	Paenibacillus_phage	58.9	1.7e-12
AZV56064.1|1169045_1169441_+	pilus assembly protein HicB	NA	A0A0A7S1E5	Clostridium_phage	55.0	2.2e-33
AZV56065.1|1170099_1170300_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56066.1|1170517_1171609_+	hypothetical protein	NA	A0A1P8BL30	Lactococcus_phage	58.3	3.1e-13
AZV56067.1|1171673_1172147_+|transposase	transposase	transposase	A0A0A7RTH0	Clostridium_phage	77.9	8.6e-61
AZV56068.1|1172189_1172399_+	hypothetical protein	NA	A0A2H4YGU5	Raoultella_phage	73.0	7.8e-06
AZV56069.1|1172444_1174253_+	hypothetical protein	NA	A0A0S2SXL6	Bacillus_phage	46.1	2.3e-53
>prophage 3
CP029758	Clostridium sp. AWRP chromosome, complete genome	4579114	1230638	1239337	4579114	tRNA,transposase	uncultured_Mediterranean_phage(42.86%)	9	NA	NA
AZV56125.1|1230638_1231517_+	site-specific tyrosine recombinase XerD	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	25.8	1.4e-11
AZV56126.1|1231655_1232867_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	33.0	9.7e-32
AZV56127.1|1233027_1234194_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A219YCT8	Aeromonas_phage	36.0	4.6e-23
AZV56128.1|1234194_1234950_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	28.2	1.5e-11
AZV56129.1|1234939_1235515_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.0	2.4e-20
AZV56130.1|1235682_1236924_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.5	2.7e-45
AZV56131.1|1237056_1237494_-	sporulation protein YtfJ	NA	NA	NA	NA	NA
AZV56132.1|1237574_1238078_-	hypothetical protein	NA	NA	NA	NA	NA
AZV56133.1|1238233_1239337_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	29.3	1.5e-07
>prophage 4
CP029758	Clostridium sp. AWRP chromosome, complete genome	4579114	1982461	2039562	4579114	terminase,plate,integrase,transposase,head,protease,tail,portal,capsid	Clostridium_phage(46.88%)	60	1990976:1991035	2023131:2024659
AZV56770.1|1982461_1982938_-	transcriptional regulator	NA	A0A0A8WFJ2	Clostridium_phage	40.9	1.1e-18
AZV56771.1|1983091_1983310_+	transcriptional regulator	NA	NA	NA	NA	NA
AZV56772.1|1983751_1984246_+	transcriptional regulator	NA	A0A2K9V3J3	Faecalibacterium_phage	46.8	5.5e-26
AZV56773.1|1984306_1984519_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56774.1|1984536_1984968_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56775.1|1984960_1985125_+	sporulation protein Spo0E	NA	NA	NA	NA	NA
AZV59064.1|1985580_1986306_+	hypothetical protein	NA	A0A1W6JNM1	Staphylococcus_phage	65.0	4.2e-22
AZV56776.1|1986343_1987108_+	ParA family protein	NA	Q8JL10	Natrialba_phage	33.3	4.5e-19
AZV56777.1|1987097_1988117_+	chromosome partitioning protein ParB	NA	H7BVD1	unidentified_phage	32.5	9.7e-17
AZV56778.1|1988149_1988389_+	hypothetical protein	NA	A0A1L2BY81	Clostridium_phage	55.8	1.1e-16
AZV56779.1|1988593_1989283_+	hypothetical protein	NA	A0A172JHR5	Bacillus_phage	35.9	6.3e-28
AZV56780.1|1989445_1990162_+	flavodoxin family protein	NA	NA	NA	NA	NA
1990976:1991035	attL	GGGAATGGGTATGGATTTGTGTAAAAACCAAATCTATACCCATTATTTTTGTATAATGGA	NA	NA	NA	NA
AZV56781.1|1991083_1992316_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	54.0	1.6e-53
AZV56782.1|1992655_1992997_-	hypothetical protein	NA	NA	NA	NA	NA
AZV56783.1|1992999_1993215_-	transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	68.7	4.2e-15
AZV56784.1|1993794_1994073_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56785.1|1994435_1994864_+	hypothetical protein	NA	Q0SPJ6	Clostridium_phage	36.2	2.5e-11
AZV56786.1|1995588_1995858_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56787.1|1995924_1996113_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56788.1|1996326_1996908_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56789.1|1996977_1997523_+|integrase	site-specific integrase	integrase	Q8SBK8	Clostridium_phage	52.0	6.1e-42
AZV56790.1|1997712_1998174_+	hypothetical protein	NA	Q8SBK4	Clostridium_phage	34.0	1.1e-12
AZV56791.1|1998298_1998790_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBQ3	Clostridium_phage	51.3	2.7e-33
AZV56792.1|1998789_2000598_+|terminase	terminase large subunit	terminase	W8CZ43	Bacillus_phage	41.3	9.5e-116
AZV56793.1|2000615_2001818_+|portal	phage portal protein	portal	A0A2I6PER5	Staphylococcus_phage	36.8	5.8e-69
AZV56794.1|2001795_2002602_+|protease	Clp protease	protease	A0A0A7RTN2	Clostridium_phage	55.0	1.5e-68
AZV59065.1|2002611_2003778_+|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	52.5	8.0e-100
AZV56795.1|2003842_2003953_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56796.1|2003954_2004260_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0A7RWM0	Clostridium_phage	39.1	1.1e-05
AZV59066.1|2004361_2004703_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AZV59067.1|2004744_2005149_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56797.1|2005152_2005605_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56798.1|2005622_2006726_+|tail	phage tail sheath protein	tail	A0A0A8WJL8	Clostridium_phage	30.9	9.8e-31
AZV56799.1|2006733_2007180_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56800.1|2007191_2007620_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56801.1|2007905_2011364_+	hypothetical protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	31.9	1.1e-27
AZV56802.1|2011839_2013318_+	hypothetical protein	NA	A0A1J0GW44	Streptomyces_phage	41.6	1.7e-17
AZV56803.1|2013333_2013663_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56804.1|2013686_2014142_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56805.1|2014145_2015216_+|plate	baseplate J family protein	plate	A0A0A7RUN3	Clostridium_phage	41.0	3.2e-63
AZV56806.1|2015217_2017416_+	hypothetical protein	NA	A0A0A7S1G0	Clostridium_phage	31.7	4.8e-37
AZV56807.1|2017419_2018040_+|portal	phage portal protein	portal	A0A0A7RTU9	Clostridium_phage	53.6	2.8e-59
AZV56808.1|2018055_2019150_+	hypothetical protein	NA	S6B1J7	Thermus_phage	41.9	4.4e-07
AZV56809.1|2019826_2020300_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56810.1|2020408_2021164_+	cysteine peptidase	NA	A0A2K9L1Z4	Tupanvirus	43.6	1.4e-41
AZV56811.1|2021241_2021505_+	hypothetical protein	NA	A0A0A7RTX0	Clostridium_phage	33.7	9.5e-09
AZV56812.1|2021521_2022439_+	glycosyl hydrolase	NA	A0A1U9WQS3	Geobacillus_phage	35.7	1.4e-30
AZV56813.1|2023238_2024471_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	54.0	1.6e-53
AZV56814.1|2024659_2025349_-	hypothetical protein	NA	NA	NA	NA	NA
2023131:2024659	attR	GGGAATGGGTATGGATTTGTGTAAAAACCAAATCTATACCCATTATTTTTGTATAATGGAATGGAAGATTTGGAACAATATTCTTAAATAAATTAGGAGGAGTTTCAAATGAAAGAAATTGAAGTACCAGATATCGATTATAAGGAAGAAGTTAAAAAATGCAAAACTATGGAGGACGTAGTTGGCAGAAATGGTTTGCTGCAGAGACTTTTAAAGGATGTTATACAAAATATGCTTGAGGCAGAAATGGAAGAACTGCTTGGCAGAGAAAAATATCAAAGAAGTGAGGATTCAGAAAATAAAAATTATAGAAATGGATACTCAAAGAAAAGTATTAGGAGCAGTGTTGGTGATGTAAATCTTGATATACCAAGAGATAGAAAAGCTGACTTTGAACCTAAAGTTGTAAAAAAATATGAAACTGTATGCAATGAACTGGATAAGAAAATTATAGGATTATACGCAAGAGGTATGTCTACAAGAGACATTCAGTCAGAACTGGAAGAATTATATGGCATCGATGTATCGCCAACAATGATATCAAAAATAACTGATAAAGTTATGGATTCAGCTGCACAATGGCAGAATAGGGCACTGGATGACGTGTATCCTATTGTTTATATGGATGCAATACATTTTAAGGTTAGGGAAGAAAATAAAATAGTCACAAAAGCTGCCTATATATGTATGGCCCTTGATATGAAAGGATATAAAGATATTTTGGGCATATGGATTGGTGAAGCCGAAGGAGCAAAATTCTGGCTGTCAGTTTGCAATGATTTAAGAAATAGAGGAGTAAAAGAAATACTGATTGCCTGTATGGATGGACTAAAAGGGCTTCCAGATGCAATAAAATCCGTATTTCCGGATGTTAGTATTCAAAATTGTATAATACACCAAATAAGAAATTCTATTAAGTATATAGCTTCCAAAGATAAAAAGGAATTTATGAAAGATTTAAAATGCGTATATAAAGCACCTACTGAAGATTCTGCAATTAACGGCCTGGATAATCTAAAGAAAAAATGGGATCAGAAGTATAGTATAGTAATTGAATCCTGGTATAATAACTGGGATAAGTTATCAACATATTTTAATTACTCACCGGAAATCAGGAAAATTATTTATACTACAAACGCATTAGAGGGTTTCAACCGACAGCTTAGAAAGTTTACGAAGATAAGAACAGTATTTCCAAATGATGAAGCACTTAGAAAATCTCTTTACCTAGCTACTGAGAAAGTCATGGAAAAATGGACTTCTCCATCCCAAAATTGGGGAATGACATTGGCACAATTAACTATTGTGTTTAATGATAAACTAGGCGAAGAGATACTCTAAGATTTAGCTAAAATTTTTATATTTTTTCTTATTTTATTGCATAATTAAGTATATTATACAAACAATAAGAATGTAATATTAATCAGTATTAGTATTACTCAAATATAAAAAAATATAACTGAAAATCAAAATTTCCAGTTATATAAAACTAAATCAAATCTATTTTACACAAATCCATCTATATTCTC	NA	NA	NA	NA
AZV56815.1|2026590_2026917_+	hypothetical protein	NA	A0A0A7RW14	Clostridium_phage	46.6	2.1e-13
AZV56816.1|2026935_2027298_+	hypothetical protein	NA	NA	NA	NA	NA
AZV59068.1|2027570_2028101_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56817.1|2030023_2030623_+	hypothetical protein	NA	NA	NA	NA	NA
AZV56818.1|2031196_2031700_-	hypothetical protein	NA	NA	NA	NA	NA
AZV56819.1|2032425_2034060_-	recombinase family protein	NA	A0A1L2BY67	Clostridium_phage	42.8	5.2e-113
AZV56820.1|2034625_2035348_+	hypothetical protein	NA	A0A0E3Y6D2	Fusobacterium_phage	42.4	9.5e-35
AZV56821.1|2035440_2035725_-	flavodoxin	NA	NA	NA	NA	NA
AZV56822.1|2035737_2036724_-	hypothetical protein	NA	NA	NA	NA	NA
AZV56823.1|2036867_2037734_+	EamA family transporter	NA	NA	NA	NA	NA
AZV56824.1|2038188_2039562_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 5
CP029758	Clostridium sp. AWRP chromosome, complete genome	4579114	3343192	3416694	4579114	terminase,plate,transposase,tail,portal,capsid	Clostridium_phage(44.74%)	67	NA	NA
AZV57879.1|3343192_3344758_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	22.5	8.2e-07
AZV57880.1|3344760_3345498_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	36.3	2.7e-37
AZV57881.1|3345555_3345996_-	hypothetical protein	NA	NA	NA	NA	NA
AZV57882.1|3346491_3347163_-	hypothetical protein	NA	NA	NA	NA	NA
AZV57883.1|3347272_3348610_-	hypothetical protein	NA	X5JAC0	Clostridium_phage	24.2	8.8e-18
AZV57884.1|3348613_3349339_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZV57885.1|3349543_3350266_+	esterase	NA	NA	NA	NA	NA
AZV57886.1|3350741_3351716_-	cobalamin biosynthesis protein CbiM	NA	NA	NA	NA	NA
AZV57887.1|3351929_3353267_+	putative DNA modification/repair radical SAM protein	NA	NA	NA	NA	NA
AZV57888.1|3353278_3354013_+	DNA metabolism protein	NA	NA	NA	NA	NA
AZV57889.1|3354158_3355529_+	8-oxoguanine deaminase	NA	NA	NA	NA	NA
AZV57890.1|3355716_3356724_-	aldo/keto reductase	NA	NA	NA	NA	NA
AZV57891.1|3356899_3357796_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZV57892.1|3358005_3359256_+	MFS transporter	NA	NA	NA	NA	NA
AZV57893.1|3359398_3361114_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.9	6.0e-11
AZV57894.1|3361707_3362490_+	ribose 1,5-bisphosphate isomerase	NA	NA	NA	NA	NA
AZV57895.1|3362602_3363358_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZV57896.1|3363590_3364424_+	chemotaxis protein	NA	NA	NA	NA	NA
AZV57897.1|3364565_3365732_-	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	48.1	1.2e-98
AZV57898.1|3366372_3367023_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AZV57899.1|3367134_3367809_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.4	5.4e-32
AZV57900.1|3367805_3369035_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.4	2.1e-21
AZV57901.1|3369177_3371928_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	39.8	3.5e-29
AZV57902.1|3372152_3373199_+	hypothetical protein	NA	NA	NA	NA	NA
AZV57903.1|3373414_3374323_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AZV57904.1|3374445_3374625_-	hypothetical protein	NA	NA	NA	NA	NA
AZV57905.1|3374748_3379098_-	DNA polymerase III subunit alpha	NA	A0A0A7RWA3	Clostridium_phage	41.0	4.3e-29
AZV57906.1|3379398_3380061_+	peptidase S51	NA	NA	NA	NA	NA
AZV57907.1|3380405_3380594_+	hypothetical protein	NA	NA	NA	NA	NA
AZV59116.1|3380670_3381225_-	hypothetical protein	NA	A0A2R2ZGQ4	Clostridioides_phage	35.9	1.2e-26
AZV57908.1|3381414_3381975_-	hypothetical protein	NA	D9ZNF4	Clostridium_phage	40.6	5.1e-20
AZV57909.1|3382033_3382936_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AZV57910.1|3382953_3383235_-	hypothetical protein	NA	A0A2H4J1Q4	uncultured_Caudovirales_phage	39.6	8.3e-11
AZV57911.1|3383311_3383449_-	XkdX family protein	NA	NA	NA	NA	NA
AZV57912.1|3383596_3384373_-	hypothetical protein	NA	NA	NA	NA	NA
AZV57913.1|3384375_3388440_-	hypothetical protein	NA	G3MAG1	Bacillus_virus	24.8	2.5e-55
AZV57914.1|3388443_3388737_-	hypothetical protein	NA	NA	NA	NA	NA
AZV57915.1|3388733_3389738_-	hypothetical protein	NA	A0A0N7AED0	Bacillus_phage	37.0	3.9e-18
AZV57916.1|3389749_3390820_-|plate	baseplate J protein	plate	A0A0K2SUG3	Clostridium_phage	34.6	5.7e-52
AZV57917.1|3390869_3391115_-	hypothetical protein	NA	NA	NA	NA	NA
AZV57918.1|3391185_3392481_-	hypothetical protein	NA	S6B1J7	Thermus_phage	37.5	5.2e-07
AZV57919.1|3392494_3393115_-|portal	phage portal protein	portal	A0A0A7RTU9	Clostridium_phage	54.1	1.1e-58
AZV59117.1|3394525_3395560_-	hypothetical protein	NA	A0A0A7RUN3	Clostridium_phage	42.4	1.7e-69
AZV57920.1|3395594_3396029_-	hypothetical protein	NA	A0A0A7RUS1	Clostridium_phage	46.6	7.2e-30
AZV57921.1|3396025_3396397_-	hypothetical protein	NA	NA	NA	NA	NA
AZV57922.1|3396393_3397389_-	hypothetical protein	NA	A0A0A7RWY4	Clostridium_phage	38.8	8.4e-58
AZV59118.1|3397385_3398024_-	hypothetical protein	NA	A0A0A8WJR4	Clostridium_phage	39.5	1.3e-35
AZV57923.1|3398054_3401372_-	hypothetical protein	NA	A0A1L2JY60	Aeribacillus_phage	48.0	1.7e-30
AZV57924.1|3401549_3402008_-	hypothetical protein	NA	NA	NA	NA	NA
AZV57925.1|3402035_3402488_-|portal	phage portal protein	portal	A0A0N7ACS0	Bacillus_phage	35.0	1.6e-16
AZV57926.1|3402500_3403613_-|tail	phage tail sheath protein	tail	A0A0A7S0D2	Clostridium_phage	42.7	4.2e-74
AZV57927.1|3403612_3404059_-	hypothetical protein	NA	A0A0K2SUF6	Clostridium_phage	33.3	5.0e-10
AZV57928.1|3404055_3404502_-	hypothetical protein	NA	S5MNW5	Brevibacillus_phage	39.2	7.2e-09
AZV57929.1|3404501_3404852_-	hypothetical protein	NA	NA	NA	NA	NA
AZV57930.1|3404853_3405186_-	hypothetical protein	NA	A0A090DCN6	Clostridium_phage	39.7	4.0e-12
AZV57931.1|3405222_3406242_-|capsid	capsid protein	capsid	S5MA55	Brevibacillus_phage	45.6	1.2e-75
AZV57932.1|3406254_3406581_-	hypothetical protein	NA	A0A1X9IGG8	Lactococcus_phage	39.3	4.5e-08
AZV57933.1|3406596_3407190_-	phage scaffold protein	NA	A0A0A7RW68	Clostridium_phage	45.5	1.0e-26
AZV57934.1|3407207_3408575_-|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	44.1	1.2e-107
AZV57935.1|3408588_3409851_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1L2JY46	Aeribacillus_phage	67.2	2.5e-163
AZV57936.1|3409828_3410569_-|terminase	terminase	terminase	M9Q2K7	Clostridium_phage	46.5	6.1e-37
AZV57937.1|3411498_3412266_-	MerR family transcriptional regulator	NA	M9Q1J4	Clostridium_phage	49.4	3.4e-59
AZV59119.1|3412237_3413011_-	DNA replication protein DnaD	NA	A0A0H4TKJ7	Bacillus_phage	55.8	7.1e-36
AZV57938.1|3413165_3415151_-	recombinase RecF	NA	A0A1L2K2K3	Aeribacillus_phage	34.0	2.3e-91
AZV57939.1|3415198_3415453_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZV57940.1|3415613_3416210_+	XRE family transcriptional regulator	NA	A8ATJ9	Listeria_phage	37.5	7.9e-11
AZV57941.1|3416235_3416694_+	hypothetical protein	NA	A0A0A7RVV2	Clostridium_phage	55.3	9.6e-41
>prophage 6
CP029758	Clostridium sp. AWRP chromosome, complete genome	4579114	4432084	4457856	4579114	portal	uncultured_Caudovirales_phage(26.32%)	32	NA	NA
AZV58830.1|4432084_4432978_-	hypothetical protein	NA	A0A0U4IS63	Bacillus_phage	42.9	3.1e-35
AZV58831.1|4433364_4433745_-	hypothetical protein	NA	NA	NA	NA	NA
AZV58832.1|4433734_4434055_-	hypothetical protein	NA	NA	NA	NA	NA
AZV58833.1|4434054_4434369_-	hypothetical protein	NA	NA	NA	NA	NA
AZV58834.1|4434399_4434633_-	transcription termination factor Rho	NA	NA	NA	NA	NA
AZV58835.1|4434632_4435556_-	hypothetical protein	NA	A0A1V0DZW0	Clostridioides_phage	53.9	2.6e-85
AZV58836.1|4435571_4436168_-	hypothetical protein	NA	E5DV52	Deep-sea_thermophilic_phage	37.6	4.2e-20
AZV58837.1|4436307_4436544_-	hypothetical protein	NA	NA	NA	NA	NA
AZV58838.1|4436545_4437832_-	hypothetical protein	NA	X5JAI9	Clostridium_phage	27.7	1.1e-33
AZV58839.1|4437782_4439141_-|portal	phage portal protein	portal	A0A1V0DZW8	Clostridioides_phage	42.3	1.0e-85
AZV58840.1|4439153_4440875_-	hypothetical protein	NA	A0A1V0DZW7	Clostridioides_phage	71.1	4.6e-237
AZV58841.1|4440880_4441087_-	hypothetical protein	NA	NA	NA	NA	NA
AZV58842.1|4441189_4441687_-	hypothetical protein	NA	NA	NA	NA	NA
AZV58843.1|4441697_4442483_-	hypothetical protein	NA	NA	NA	NA	NA
AZV58844.1|4442746_4443151_-	resolvase	NA	A0A2H4J863	uncultured_Caudovirales_phage	47.0	5.9e-26
AZV58845.1|4443295_4443718_-	RNA polymerase subunit sigma	NA	A0A2H4J015	uncultured_Caudovirales_phage	37.3	2.3e-12
AZV58846.1|4444161_4446747_-	DNA primase	NA	A0A2I6UGE7	Salinibacter_virus	23.3	1.5e-05
AZV58847.1|4446921_4447518_-	molybdopterin-guanine dinucleotide biosynthesis protein A	NA	A0A2H4J819	uncultured_Caudovirales_phage	39.1	3.2e-28
AZV58848.1|4447748_4448156_-	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	58.4	1.6e-31
AZV58849.1|4448168_4448789_-	metal-dependent phosphohydrolase	NA	A0A2H4J8L1	uncultured_Caudovirales_phage	41.8	4.2e-39
AZV58850.1|4448802_4449747_-	phage recombination protein Bet	NA	A0A1B1IN99	uncultured_Mediterranean_phage	47.5	2.1e-37
AZV58851.1|4449746_4451426_-	DNA repair protein	NA	A0A2H4J9G9	uncultured_Caudovirales_phage	19.8	3.1e-12
AZV58852.1|4451441_4451666_-	hypothetical protein	NA	NA	NA	NA	NA
AZV58853.1|4451717_4452218_-	hypothetical protein	NA	A0A1B1IMW7	Lactococcus_phage	33.9	7.3e-18
AZV58854.1|4452440_4452629_-	hypothetical protein	NA	NA	NA	NA	NA
AZV58855.1|4452768_4453032_-	hypothetical protein	NA	NA	NA	NA	NA
AZV58856.1|4453390_4453579_-	hypothetical protein	NA	NA	NA	NA	NA
AZV58857.1|4453836_4454070_-	DUF739 domain-containing protein	NA	NA	NA	NA	NA
AZV58858.1|4454251_4454641_+	XRE family transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	48.3	1.9e-26
AZV58859.1|4454666_4455110_+	Zn peptidase	NA	I3VYZ2	Thermoanaerobacterium_phage	59.2	1.5e-38
AZV58860.1|4455102_4456272_+	hypothetical protein	NA	A0A0A8WIE1	Clostridium_phage	26.0	2.3e-22
AZV58861.1|4456710_4457856_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	34.1	7.8e-15
