The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026095	Bacillus asahii strain OM18 chromosome, complete genome	4826182	393986	403941	4826182		Synechococcus_phage(37.5%)	9	NA	NA
AZV41093.1|393986_395279_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.5	1.3e-18
AZV41094.1|395377_396097_+	phosphoribosylaminoimidazole-succinocarboxamide synthase	NA	M4SM18	Cyanophage	43.6	2.0e-48
AZV41095.1|396089_396344_+	phosphoribosylformylglycinamidine synthase	NA	A0A0E3FKD5	Synechococcus_phage	33.3	8.0e-05
AZV41096.1|396340_397027_+	phosphoribosylformylglycinamidine synthase	NA	NA	NA	NA	NA
AZV41097.1|397010_399230_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	42.2	3.2e-166
AZV41098.1|399214_400630_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.4	4.4e-52
AZV41099.1|400787_401813_+	phosphoribosylaminoimidazole synthetase	NA	A0A0E3FC27	Synechococcus_phage	45.8	8.7e-66
AZV41100.1|401812_402379_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.0	2.6e-27
AZV41101.1|402405_403941_+	phosphoribosylaminoimidazolecarboxamide formyltransferase	NA	Q58MG4	Prochlorococcus_phage	52.6	5.6e-77
>prophage 2
CP026095	Bacillus asahii strain OM18 chromosome, complete genome	4826182	2043166	2048462	4826182	transposase	Bacillus_phage(57.14%)	10	NA	NA
AZV42716.1|2043166_2044042_+	ribonucleotide-diphosphate reductase	NA	A0A1V0CNG9	Kaumoebavirus	26.1	1.6e-07
AZV42717.1|2045034_2045148_+	hypothetical protein	NA	A0A0S2SXU2	Bacillus_phage	67.6	7.1e-06
AZV42718.1|2045304_2045460_+	hypothetical protein	NA	A0A2H4J832	uncultured_Caudovirales_phage	58.7	1.2e-08
AZV42719.1|2045456_2045642_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42720.1|2045643_2045997_+	hypothetical protein	NA	A0A2H4J819	uncultured_Caudovirales_phage	76.1	1.6e-43
AZV42721.1|2046015_2046183_+	ERCC4-type nuclease	NA	A0A0S2SXQ1	Bacillus_phage	83.0	1.9e-18
AZV42722.1|2046179_2046368_+	Protein of unknown function (DUF3940)	NA	A0A0S2SXY0	Bacillus_phage	60.4	5.7e-08
AZV42723.1|2046357_2046495_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42724.1|2046586_2046703_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV42725.1|2046884_2048462_-	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	38.3	5.9e-21
>prophage 3
CP026095	Bacillus asahii strain OM18 chromosome, complete genome	4826182	2163322	2261425	4826182	protease,tRNA,integrase,transposase	Bacillus_phage(27.27%)	110	2237661:2237676	2262037:2262052
AZV42833.1|2163322_2163931_-|protease	aTP-dependent Clp protease proteolytic subunit	protease	A0A1V0SCT2	Indivirus	30.1	8.1e-11
AZV42834.1|2164280_2164562_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42835.1|2164621_2165923_+	Lipoprotein LpqB, GerMN domain-containing protein	NA	NA	NA	NA	NA
AZV42836.1|2166230_2166854_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42837.1|2167015_2168218_-	multidrug resistance protein 2	NA	NA	NA	NA	NA
AZV42838.1|2168244_2168826_-	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
AZV42839.1|2169162_2169858_+	acyl CoA:acetate/3-ketoacid CoA transferase, alpha subunit	NA	NA	NA	NA	NA
AZV42840.1|2169857_2170529_+	acyl CoA:acetate/3-ketoacid CoA transferase, beta subunit	NA	NA	NA	NA	NA
AZV42841.1|2170759_2171662_-	hypothetical protein	NA	A0A1B0T6A8	Bacillus_phage	37.5	3.7e-44
AZV42842.1|2172288_2172849_+	thioredoxin	NA	NA	NA	NA	NA
AZV42843.1|2172858_2173290_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42844.1|2173429_2173681_+	oxidoreductase	NA	NA	NA	NA	NA
AZV42845.1|2173994_2174150_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42846.1|2174170_2174509_+	DSBA oxidoreductase	NA	NA	NA	NA	NA
AZV42847.1|2174667_2175555_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
AZV42848.1|2175934_2176678_+	FMN reductase	NA	NA	NA	NA	NA
AZV42849.1|2177502_2177829_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42850.1|2177835_2178336_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42851.1|2178643_2178958_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42852.1|2179481_2179625_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV42853.1|2179683_2180052_-|transposase	transposase	transposase	A0A0A8WI33	Clostridium_phage	43.8	3.1e-18
AZV42854.1|2180520_2181291_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42855.1|2181493_2181907_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42856.1|2181967_2183641_+	hypothetical protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.5e-30
AZV42857.1|2184100_2184223_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42858.1|2184600_2185011_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42859.1|2185105_2185426_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42860.1|2186489_2187842_-	branched-chain amino acid uptake carrier	NA	NA	NA	NA	NA
AZV42861.1|2188522_2189074_-	hypothetical protein	NA	NA	NA	NA	NA
AZV42862.1|2189189_2189303_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42863.1|2189780_2190659_+	Fe-S oxidoreductase	NA	NA	NA	NA	NA
AZV42864.1|2190969_2191182_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42865.1|2191224_2192829_+	histidine kinase	NA	NA	NA	NA	NA
AZV42866.1|2192821_2193529_+	transcriptional regulator	NA	NA	NA	NA	NA
AZV42867.1|2193760_2194729_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AZV42868.1|2194761_2195139_+	2-oxoglutarate translocator	NA	NA	NA	NA	NA
AZV42869.1|2195187_2195871_+	dimethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
AZV42870.1|2196066_2196201_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42871.1|2196327_2197317_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AZV42872.1|2197824_2199081_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42873.1|2199356_2199509_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42874.1|2199546_2199951_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZV42875.1|2200017_2200179_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZV42876.1|2200289_2200973_+	membrane protein	NA	NA	NA	NA	NA
AZV42877.1|2201159_2202032_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZV42878.1|2202155_2202500_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42879.1|2202589_2203516_+	transporter	NA	NA	NA	NA	NA
AZV42880.1|2203909_2205451_+	carbon-nitrogen hydrolase	NA	NA	NA	NA	NA
AZV42881.1|2205492_2205645_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42882.1|2206036_2206336_+|transposase	transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	71.4	7.9e-36
AZV42883.1|2206340_2207417_+|transposase	transposase	transposase	A0A0H3V0V2	Geobacillus_virus	32.3	2.8e-14
AZV42884.1|2207600_2207879_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZV42885.1|2208090_2208804_-	transcriptional regulator	NA	NA	NA	NA	NA
AZV42886.1|2209040_2209262_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42887.1|2210602_2212183_+	transmembrane protein	NA	G3MA91	Bacillus_virus	35.8	1.8e-14
AZV42888.1|2212542_2212746_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42889.1|2213267_2213384_-	Tn1546-family resolvase	NA	NA	NA	NA	NA
AZV42890.1|2213650_2214322_-	hypothetical protein	NA	NA	NA	NA	NA
AZV42891.1|2214389_2215100_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV42892.1|2215523_2215790_+|transposase	transposase, IS116/IS110/IS902 family	transposase	A0A1S7J231	Thermus_phage	32.5	1.3e-05
AZV42893.1|2216271_2217477_-	germination protein Ger(x)C	NA	NA	NA	NA	NA
AZV42894.1|2217460_2218564_-	spore gernimation protein	NA	NA	NA	NA	NA
AZV42895.1|2218590_2220159_-	spore gernimation protein	NA	NA	NA	NA	NA
AZV42896.1|2220164_2220290_-	hypothetical protein	NA	NA	NA	NA	NA
AZV42897.1|2220544_2220676_+|transposase	transposase	transposase	A0A2H4PQU1	Staphylococcus_phage	66.7	4.8e-06
AZV42898.1|2221168_2221453_+	hypothetical protein	NA	A0A2K5B2B6	Erysipelothrix_phage	46.9	6.2e-06
AZV42899.1|2221434_2221677_+|transposase	transposase, IS116/IS110/IS902 family	transposase	NA	NA	NA	NA
AZV42900.1|2221983_2222391_+|transposase	transposase, IS116/IS110/IS902 family	transposase	A0A1B1P7S0	Bacillus_phage	39.1	6.1e-15
AZV42901.1|2222635_2222791_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42902.1|2222840_2223677_-	NLPA lipoprotein	NA	NA	NA	NA	NA
AZV42903.1|2224120_2225551_+	4-hydroxyphenylacetate 3-hydroxylase	NA	NA	NA	NA	NA
AZV42904.1|2225547_2226933_+	4-hydroxyphenylacetate 3-hydroxylase	NA	NA	NA	NA	NA
AZV42905.1|2226945_2228004_+	luciferase	NA	NA	NA	NA	NA
AZV42906.1|2228015_2229068_+	alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
AZV42907.1|2229102_2229891_+	ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	3.2e-28
AZV42908.1|2229883_2230552_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AZV42909.1|2230564_2231755_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42910.1|2231766_2232237_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZV42911.1|2233408_2233954_-	S-adenosyl-L-methionine-dependent methyltransferase	NA	NA	NA	NA	NA
AZV42912.1|2233950_2234208_-	S-adenosyl-L-methionine-dependent methyltransferase	NA	NA	NA	NA	NA
AZV42913.1|2234857_2236777_+|tRNA	threonyl-tRNA synthetase	tRNA	A0A2K9L297	Tupanvirus	41.7	3.7e-142
AZV42914.1|2237004_2237376_-	hypothetical protein	NA	NA	NA	NA	NA
2237661:2237676	attL	AATAATTTAAAAAGGA	NA	NA	NA	NA
AZV42915.1|2237887_2238178_+|transposase	transposase	transposase	NA	NA	NA	NA
AZV42916.1|2238174_2239065_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	40.6	5.6e-45
AZV42917.1|2239277_2240078_-	hypothetical protein	NA	NA	NA	NA	NA
AZV42918.1|2240299_2241616_+	type IV secretory pathway VirD4 protein	NA	NA	NA	NA	NA
AZV42919.1|2241721_2242843_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42920.1|2242932_2244372_-	hypothetical protein	NA	NA	NA	NA	NA
AZV42921.1|2244532_2244655_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42922.1|2244854_2245376_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42923.1|2245569_2247024_+	putative L-2,4-diaminobutyrate decarboxylase	NA	NA	NA	NA	NA
AZV42924.1|2247877_2248141_-|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	89.7	3.7e-37
AZV42925.1|2248160_2248688_-|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	81.0	1.5e-74
AZV42926.1|2248714_2249233_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	51.1	1.2e-34
AZV42927.1|2249647_2250313_+	hypothetical protein	NA	A0A0R6PIB6	Moraxella_phage	33.8	5.5e-05
AZV42928.1|2250305_2251049_+	hypothetical protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.8	7.5e-43
AZV42929.1|2251032_2251743_+	ABC transporter	NA	NA	NA	NA	NA
AZV42930.1|2251743_2251965_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42931.1|2251987_2252152_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42932.1|2252427_2252865_+|transposase	transposase	transposase	NA	NA	NA	NA
AZV42933.1|2252857_2254441_+|transposase	transposase	transposase	NA	NA	NA	NA
AZV42934.1|2254624_2254834_+|transposase	transposase	transposase	NA	NA	NA	NA
AZV42935.1|2254986_2255379_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42936.1|2255420_2255597_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42937.1|2255737_2256388_-	hypothetical protein	NA	NA	NA	NA	NA
AZV42938.1|2256390_2257245_-	hypothetical protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	5.4e-21
AZV42939.1|2257244_2257625_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZV42940.1|2257987_2258497_+	resolvase	NA	A0A0A7NPV4	Enterobacteria_phage	47.0	6.9e-32
AZV42941.1|2258885_2259227_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42942.1|2260486_2261425_+|transposase	transposase	transposase	S5VTD3	Leptospira_phage	36.9	1.2e-45
2262037:2262052	attR	TCCTTTTTAAATTATT	NA	NA	NA	NA
>prophage 4
CP026095	Bacillus asahii strain OM18 chromosome, complete genome	4826182	2269183	2319329	4826182	bacteriocin,integrase,transposase	Escherichia_phage(27.27%)	56	2282570:2282588	2303409:2303427
AZV42955.1|2269183_2271130_+|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
AZV42956.1|2271129_2273070_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42957.1|2273092_2274673_+	NADH oxidase	NA	NA	NA	NA	NA
AZV42958.1|2275193_2275364_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42959.1|2275473_2275623_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42960.1|2275649_2276591_-	hypothetical protein	NA	NA	NA	NA	NA
AZV42961.1|2277021_2280234_+	helicase SNF	NA	E7DNC5	Pneumococcus_phage	30.8	9.1e-37
AZV42962.1|2280401_2280776_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42963.1|2280897_2282163_+	MFS transporter	NA	NA	NA	NA	NA
AZV42964.1|2282356_2282674_+	hypothetical protein	NA	NA	NA	NA	NA
2282570:2282588	attL	TGTTATTCAACAATCGGGC	NA	NA	NA	NA
AZV42965.1|2282764_2283181_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42966.1|2283320_2283536_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42967.1|2284032_2284155_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42968.1|2284534_2284792_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42969.1|2285104_2285950_-	hypothetical protein	NA	NA	NA	NA	NA
AZV42970.1|2286039_2287323_-	ATPase	NA	H2EF77	Moumouvirus	24.0	9.3e-17
AZV42971.1|2287419_2288562_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZV42972.1|2288617_2289442_-	membrane protein	NA	NA	NA	NA	NA
AZV42973.1|2289480_2290230_-	hypothetical protein	NA	NA	NA	NA	NA
AZV42974.1|2290469_2290880_+	glyoxalase	NA	NA	NA	NA	NA
AZV42975.1|2290864_2291149_-	hypothetical protein	NA	NA	NA	NA	NA
AZV42976.1|2291318_2291600_-	hypothetical protein	NA	NA	NA	NA	NA
AZV42977.1|2291737_2291890_+|transposase	transposase	transposase	NA	NA	NA	NA
AZV42978.1|2292073_2293405_-	NADH dehydrogenase	NA	NA	NA	NA	NA
AZV42979.1|2293572_2293725_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV42980.1|2293975_2295646_-	ribonuclease J	NA	NA	NA	NA	NA
AZV42981.1|2295754_2295991_-	XRE family transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	55.8	6.5e-17
AZV42982.1|2296231_2296579_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42983.1|2296713_2297217_+	tyrosine recombinase XerS	NA	Q56VN7	Pseudomonas_phage	50.0	7.1e-05
AZV42984.1|2297461_2297884_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42985.1|2298247_2298973_-	hypothetical protein	NA	NA	NA	NA	NA
AZV42986.1|2299224_2300115_-|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	40.6	5.6e-45
AZV42987.1|2300111_2300402_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV42988.1|2300798_2300921_+	hypothetical protein	NA	NA	NA	NA	NA
AZV42989.1|2300925_2302830_-	mannonate oxidoreductase	NA	F2Y0V3	Organic_Lake_phycodnavirus	28.6	1.5e-15
AZV42990.1|2302826_2302964_-	hypothetical protein	NA	NA	NA	NA	NA
AZV42991.1|2303949_2304549_+	hypothetical protein	NA	NA	NA	NA	NA
2303409:2303427	attR	GCCCGATTGTTGAATAACA	NA	NA	NA	NA
AZV42992.1|2305074_2305944_+	transporter	NA	NA	NA	NA	NA
AZV42993.1|2306500_2308933_-	hypothetical protein	NA	NA	NA	NA	NA
AZV42994.1|2309348_2309492_-	hypothetical protein	NA	NA	NA	NA	NA
AZV42995.1|2309521_2309962_-|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	44.7	5.3e-20
AZV42996.1|2310361_2310862_-	ribonuclease inhibitor Barstar	NA	NA	NA	NA	NA
AZV42997.1|2310895_2312062_-	wall-associated protein	NA	NA	NA	NA	NA
AZV42998.1|2312212_2312674_-|transposase	transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.4	3.9e-18
AZV42999.1|2312752_2312920_-|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	56.2	2.7e-09
AZV43000.1|2313260_2313857_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43001.1|2314014_2314791_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43002.1|2314790_2315639_-	bacitracin ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.2	8.0e-41
AZV43003.1|2315756_2315885_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43004.1|2316009_2316411_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43005.1|2316428_2316905_-	DNA-binding protein	NA	NA	NA	NA	NA
AZV43006.1|2317043_2317181_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZV43007.1|2317622_2317826_+	PbsX family transcriptional regulator	NA	NA	NA	NA	NA
AZV43008.1|2317832_2318267_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43009.1|2318622_2318865_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV43010.1|2318879_2319329_-|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	52.8	9.1e-36
>prophage 5
CP026095	Bacillus asahii strain OM18 chromosome, complete genome	4826182	2349547	2509279	4826182	protease,integrase,transposase	Bacillus_phage(27.03%)	167	2349475:2349534	2485000:2485014
2349475:2349534	attL	TGGTATGCTCCCCTTATAGTAGACACGTTTTAAAAAGCGCATTAATCTGTCTATTATTAA	NA	NA	NA	NA
AZV43037.1|2349547_2349838_+|transposase	transposase	transposase	NA	NA	NA	NA
2349475:2349534	attL	TGGTATGCTCCCCTTATAGTAGACACGTTTTAAAAAGCGCATTAATCTGTCTATTATTAA	NA	NA	NA	NA
AZV43038.1|2349834_2350725_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	40.6	3.3e-45
2349475:2349534	attL	TGGTATGCTCCCCTTATAGTAGACACGTTTTAAAAAGCGCATTAATCTGTCTATTATTAA	NA	NA	NA	NA
AZV43039.1|2350846_2351491_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43040.1|2351672_2352230_-	NADPH-dependent FMN reductase	NA	A0A2P0ZL77	Lactobacillus_phage	33.3	2.5e-14
AZV43041.1|2352623_2353766_+	low temperature requirement protein A	NA	NA	NA	NA	NA
AZV43042.1|2354225_2355116_-|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	40.6	3.3e-45
AZV43043.1|2355112_2355403_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV43044.1|2355804_2356920_-	hypothetical protein	NA	NA	NA	NA	NA
2355417:2355776	attR	TTAATAATAGACAGATTAATGCGCTTTTTAAAACGTGTCTACTATAAGGGGAGCATACCAATTCAAGGATAGCGCCCTTTTCTGGAATAACCTATTCAATTTCCTAATGAAACGTCCCTTTATAGAGGGACTTGTTTTTTGTTTACTTCGCAATATATGTCAAATTTGAAATTCGCATTTCTTATTAAAGAATTGAGCCTTTTTGCGGAATAATAAAAGCAACCCAGATCCGGTTGCTCTATATAACAATAAAATGATTATTTAAATAAACCCAATTCTGCGGTGCTGGCAGGTTCAATTGCCAGTACGTTACACCTAACAATTGATATTGATTGACTACATTGTATTTTTCCTGATAAC	NA	NA	NA	NA
AZV43045.1|2357110_2357263_+	hypothetical protein	NA	NA	NA	NA	NA
2355417:2355776	attR	TTAATAATAGACAGATTAATGCGCTTTTTAAAACGTGTCTACTATAAGGGGAGCATACCAATTCAAGGATAGCGCCCTTTTCTGGAATAACCTATTCAATTTCCTAATGAAACGTCCCTTTATAGAGGGACTTGTTTTTTGTTTACTTCGCAATATATGTCAAATTTGAAATTCGCATTTCTTATTAAAGAATTGAGCCTTTTTGCGGAATAATAAAAGCAACCCAGATCCGGTTGCTCTATATAACAATAAAATGATTATTTAAATAAACCCAATTCTGCGGTGCTGGCAGGTTCAATTGCCAGTACGTTACACCTAACAATTGATATTGATTGACTACATTGTATTTTTCCTGATAAC	NA	NA	NA	NA
AZV43046.1|2357350_2358148_+	hydrolase Cof	NA	NA	NA	NA	NA
2355417:2355776	attR	TTAATAATAGACAGATTAATGCGCTTTTTAAAACGTGTCTACTATAAGGGGAGCATACCAATTCAAGGATAGCGCCCTTTTCTGGAATAACCTATTCAATTTCCTAATGAAACGTCCCTTTATAGAGGGACTTGTTTTTTGTTTACTTCGCAATATATGTCAAATTTGAAATTCGCATTTCTTATTAAAGAATTGAGCCTTTTTGCGGAATAATAAAAGCAACCCAGATCCGGTTGCTCTATATAACAATAAAATGATTATTTAAATAAACCCAATTCTGCGGTGCTGGCAGGTTCAATTGCCAGTACGTTACACCTAACAATTGATATTGATTGACTACATTGTATTTTTCCTGATAAC	NA	NA	NA	NA
AZV43047.1|2358614_2359361_-	methionine aminopeptidase	NA	NA	NA	NA	NA
AZV43048.1|2359576_2361163_-	amidohydrolase	NA	NA	NA	NA	NA
AZV43049.1|2361533_2361974_-	cell wall hydrolase	NA	NA	NA	NA	NA
AZV43050.1|2362154_2362718_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AZV43051.1|2362930_2363731_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZV43052.1|2363745_2364432_+	cysteine ABC transporter permease	NA	NA	NA	NA	NA
AZV43053.1|2364445_2365192_+	arginine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.7	6.8e-36
AZV43054.1|2365321_2365459_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43055.1|2365930_2366911_+	NADP-dependent aryl-alcohol dehydrogenase	NA	NA	NA	NA	NA
AZV43056.1|2367103_2367238_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43057.1|2367305_2368061_-	GTP cyclohydrolase	NA	NA	NA	NA	NA
AZV43058.1|2368173_2368377_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43059.1|2368724_2369093_-	hypothetical protein	NA	D2KRB9	Lactobacillus_phage	39.7	6.2e-06
AZV43060.1|2369604_2370648_-	oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	24.3	7.1e-15
AZV43061.1|2370749_2371847_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43062.1|2371850_2372414_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43063.1|2372528_2372849_+	ArsR family transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	35.3	1.1e-06
AZV43064.1|2373282_2375559_+	ATPase	NA	E4ZFI9	Streptococcus_phage	49.9	1.8e-180
AZV43065.1|2375698_2375821_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43066.1|2375890_2376076_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43067.1|2376214_2377384_-	zinc permease	NA	NA	NA	NA	NA
AZV43068.1|2377399_2378413_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43069.1|2379624_2380854_-	biotin biosynthesis cytochrome P450	NA	NA	NA	NA	NA
AZV43070.1|2381748_2383551_-	iron transporter	NA	NA	NA	NA	NA
AZV43071.1|2383547_2384711_-	MFS transporter	NA	NA	NA	NA	NA
AZV43072.1|2384717_2386007_-	lysine 6-monooxygenase	NA	NA	NA	NA	NA
AZV43073.1|2385985_2386468_-	acetyltransferase	NA	NA	NA	NA	NA
AZV43074.1|2386580_2388332_-	siderophore biosynthesis protein	NA	NA	NA	NA	NA
AZV43075.1|2388309_2389743_-	2,4-diaminobutyrate decarboxylase	NA	NA	NA	NA	NA
AZV43076.1|2389833_2391195_-	diadenosine tetraphosphatase	NA	A0A1V0SKB7	Klosneuvirus	25.3	2.3e-26
AZV43077.1|2391206_2391362_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43078.1|2391713_2391848_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43079.1|2392394_2392628_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43080.1|2392762_2393149_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43081.1|2393229_2393505_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43082.1|2393689_2393821_+	small, acid-soluble spore protein L	NA	NA	NA	NA	NA
AZV43083.1|2393992_2394265_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43084.1|2394264_2394978_-	pirin	NA	NA	NA	NA	NA
AZV43085.1|2395374_2396007_-	short-chain dehydrogenase/reductase SDR	NA	A0A0G2Y8L6	Acanthamoeba_polyphaga_mimivirus	34.3	1.9e-07
AZV43086.1|2396434_2396869_+	hypothetical protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	31.2	2.0e-11
AZV43087.1|2396970_2397159_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43088.1|2397632_2398148_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	42.2	1.7e-22
AZV43089.1|2398764_2400066_-	integral membrane sensor signal transduction histidine kinase	NA	W8CYF6	Bacillus_phage	31.7	5.0e-34
AZV43090.1|2400062_2400737_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43091.1|2401248_2402091_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43092.1|2402465_2403659_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43093.1|2404194_2404593_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43094.1|2404798_2406001_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV43095.1|2406294_2406483_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43096.1|2406971_2408267_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV43097.1|2408645_2409881_+|transposase	transposase IS116/IS110/IS902 family protein	transposase	NA	NA	NA	NA
AZV43098.1|2410268_2410613_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43099.1|2411146_2412433_-|transposase	transposase	transposase	A0A0U3ULR1	Bacillus_phage	22.0	1.3e-13
AZV43100.1|2412932_2413334_-	hypothetical protein	NA	A0A1V0E003	Clostridioides_phage	50.0	5.5e-16
AZV43101.1|2413404_2413833_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43102.1|2414073_2414964_-|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	40.6	5.6e-45
AZV43103.1|2414960_2415251_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV43104.1|2415341_2415839_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	49.4	4.7e-41
AZV43105.1|2416190_2417108_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZV43106.1|2417754_2417916_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43107.1|2417912_2419511_+	recombinase	NA	A0A290FZV2	Caldibacillus_phage	28.4	7.2e-35
AZV43108.1|2419494_2420847_-	FAD-binding protein	NA	S4VRT3	Pandoravirus	40.4	2.0e-46
AZV43109.1|2421105_2421291_-	transcriptional regulator, GntR family	NA	NA	NA	NA	NA
AZV43110.1|2421421_2422216_-	Xanthine and CO dehydrogenases maturation factor, XdhC/CoxF family	NA	NA	NA	NA	NA
AZV43111.1|2422242_2423109_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43112.1|2423102_2423570_-	ferredoxin	NA	A0A0P0IVM8	Acinetobacter_phage	33.3	2.7e-14
AZV43113.1|2423566_2425627_-	aldehyde oxidase	NA	A0A0P0I429	Acinetobacter_phage	27.8	2.4e-59
AZV43114.1|2425861_2426461_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43115.1|2426865_2427264_+	pyrimidine nucleoside transporter NupC	NA	NA	NA	NA	NA
AZV43116.1|2428501_2429428_-	transcriptional regulator	NA	NA	NA	NA	NA
AZV43117.1|2429432_2430629_-	histidine kinase	NA	NA	NA	NA	NA
AZV43118.1|2431561_2432995_+	sodium:alanine symporter	NA	NA	NA	NA	NA
AZV43119.1|2433142_2434936_+|transposase	transposase, IS4 family	transposase	A0ZS58	Staphylococcus_virus	40.7	3.6e-99
AZV43120.1|2435210_2436191_-	glutaminase	NA	NA	NA	NA	NA
AZV43121.1|2436191_2436320_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43122.1|2436371_2436896_-	acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
AZV43123.1|2437209_2437446_-	XRE family transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	53.2	1.3e-14
AZV43124.1|2437811_2439110_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
AZV43125.1|2440177_2441446_-	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
AZV43126.1|2441706_2441946_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43127.1|2442126_2442696_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43128.1|2442951_2443086_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV43129.1|2443120_2443645_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43130.1|2444128_2444806_+	spore cortex-lytic enzyme	NA	A0A141HRV8	Bacillus_phage	39.8	1.7e-30
AZV43131.1|2445240_2447628_+	penicillin-binding protein	NA	NA	NA	NA	NA
AZV43132.1|2448153_2449533_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AZV43133.1|2449810_2450659_+	beta-lactamase	NA	NA	NA	NA	NA
AZV43134.1|2450766_2451219_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43135.1|2451199_2451757_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43136.1|2451812_2452937_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZV43137.1|2453120_2453261_+|transposase	transposase	transposase	NA	NA	NA	NA
AZV43138.1|2453359_2454079_-	membrane protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	4.1e-30
AZV43139.1|2454146_2454356_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AZV43140.1|2454566_2454737_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43141.1|2455533_2455722_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43142.1|2455758_2456529_-	hypothetical protein	NA	W8CYM9	Bacillus_phage	36.5	1.9e-09
AZV43143.1|2456525_2456765_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43144.1|2456962_2457088_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43145.1|2457245_2457389_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43146.1|2457533_2458409_-	transcriptional regulator	NA	NA	NA	NA	NA
AZV43147.1|2458522_2459449_+	transporter	NA	NA	NA	NA	NA
AZV43148.1|2459573_2460122_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43149.1|2460203_2460740_-	hypothetical protein	NA	A0A167R6J9	Powai_lake_megavirus	58.5	1.2e-18
AZV43150.1|2460873_2460993_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43151.1|2461045_2461165_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43152.1|2461562_2463848_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43153.1|2464073_2464520_-	hypothetical protein	NA	A0A1J0GW44	Streptomyces_phage	35.9	4.2e-09
AZV43154.1|2464683_2466819_-|protease	Clp protease ClpX	protease	H6X3M6	Enterobacteria_phage	42.8	3.8e-124
AZV43155.1|2466962_2468321_-	4-hydroxybutyrate CoA-transferase	NA	NA	NA	NA	NA
AZV43156.1|2468557_2468728_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43157.1|2468817_2469390_-|integrase	integrase	integrase	A3F636	Streptococcus_phage	46.3	6.6e-39
AZV43158.1|2469768_2470923_-	sodium:proton antiporter	NA	NA	NA	NA	NA
AZV43159.1|2471618_2473211_-	AMP-dependent synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	2.2e-36
AZV43160.1|2473604_2474816_-	peptidase S1	NA	NA	NA	NA	NA
AZV43161.1|2475269_2475887_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AZV43162.1|2475930_2476332_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43163.1|2476386_2477142_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	43.8	7.1e-57
AZV43164.1|2477248_2478697_-	glycogen synthase	NA	NA	NA	NA	NA
AZV43165.1|2478712_2479819_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AZV43166.1|2479834_2481001_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AZV43167.1|2481000_2482935_-	1,4-alpha-glucan branching protein	NA	NA	NA	NA	NA
AZV43168.1|2483200_2484214_-	glycoside hydrolase family 15	NA	NA	NA	NA	NA
AZV43169.1|2484528_2484843_-	branched-chain amino acid ABC transporter	NA	NA	NA	NA	NA
AZV43170.1|2484845_2485562_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43171.1|2485636_2486152_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43172.1|2486402_2486672_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
AZV43173.1|2486732_2486882_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AZV43174.1|2486909_2488094_-	4-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AZV43175.1|2488198_2488969_-	DNA-binding protein	NA	NA	NA	NA	NA
AZV43176.1|2488968_2489988_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43177.1|2490191_2490989_-	fibrinogen and fibronectin	NA	NA	NA	NA	NA
AZV43178.1|2491190_2491334_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43179.1|2491571_2492114_-	FMN reductase	NA	NA	NA	NA	NA
AZV43180.1|2492459_2493044_-	glutamine amidotransferase	NA	NA	NA	NA	NA
AZV43181.1|2493045_2493933_-	pyridoxal biosynthesis protein	NA	NA	NA	NA	NA
AZV43182.1|2494072_2495473_+	transcriptional regulator	NA	A0A1X9I5H2	Streptococcus_phage	23.7	1.5e-20
AZV43183.1|2495666_2495795_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AZV43184.1|2495888_2496089_-|transposase	transposase	transposase	S6AND0	Bacillus_phage	74.2	3.5e-24
AZV43185.1|2496104_2496569_-|transposase	transposase	transposase	S6AND0	Bacillus_phage	73.4	2.5e-57
AZV43186.1|2496839_2497601_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43187.1|2497756_2498182_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZV43188.1|2498760_2499285_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43189.1|2499432_2499744_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43190.1|2499882_2500263_+	murein hydrolase transporter LrgA	NA	NA	NA	NA	NA
AZV43191.1|2500259_2500949_+	murein hydrolase export regulator	NA	NA	NA	NA	NA
AZV43192.1|2501228_2501876_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43193.1|2501900_2502497_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AZV43194.1|2502547_2503618_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43195.1|2504060_2504996_+	oxidoreductase	NA	NA	NA	NA	NA
AZV43196.1|2505686_2506397_+	membrane protein	NA	NA	NA	NA	NA
AZV43197.1|2506500_2506626_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43198.1|2507179_2507674_-	methyltransferase	NA	NA	NA	NA	NA
AZV43199.1|2507843_2508038_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43200.1|2508567_2508762_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV43201.1|2508736_2508910_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV43202.1|2508916_2509033_-|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	67.6	2.3e-07
AZV43203.1|2509087_2509279_-|transposase	transposase	transposase	A0A1X9I6E7	Streptococcus_phage	49.1	1.8e-09
>prophage 6
CP026095	Bacillus asahii strain OM18 chromosome, complete genome	4826182	2523069	2532272	4826182	terminase,integrase	Bacillus_phage(60.0%)	16	2526044:2526058	2531673:2531687
AZV43221.1|2523069_2523762_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	62.4	2.7e-55
AZV43222.1|2523918_2524074_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43223.1|2524118_2524997_-	putative acetyltransferase	NA	C7U0V2	Enterobacteria_phage	30.6	1.2e-12
AZV43224.1|2525111_2525447_-	N-acetylmuramoyl-L-alanine amidase	NA	M4ZRP4	Bacillus_phage	43.5	5.4e-09
AZV43225.1|2525726_2525915_-|terminase	terminase	terminase	A0A1B1P7R3	Bacillus_phage	91.2	3.0e-25
2526044:2526058	attL	GGCAAAAAGATTAAT	NA	NA	NA	NA
AZV43226.1|2526053_2526176_-	hypothetical protein	NA	A0A0S2SXT2	Bacillus_phage	52.5	1.7e-05
AZV43227.1|2526172_2526457_-	hypothetical protein	NA	A0A0S2SXT2	Bacillus_phage	75.3	2.6e-28
AZV43228.1|2526706_2526820_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43229.1|2526966_2527155_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43230.1|2527292_2527580_-	Phage-related protein	NA	A0A0S2SXQ1	Bacillus_phage	86.6	1.2e-33
AZV43231.1|2527750_2527936_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43232.1|2527932_2528082_-	hypothetical protein	NA	A0A2H4J832	uncultured_Caudovirales_phage	59.1	4.5e-08
AZV43233.1|2528668_2528803_+|integrase	integrase	integrase	A0A0S2SXP1	Bacillus_phage	81.8	4.2e-13
AZV43234.1|2528921_2530286_-	glutamine synthetase	NA	NA	NA	NA	NA
AZV43235.1|2530658_2531210_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43236.1|2531615_2532272_-	hypothetical protein	NA	A0A292GAU5	Xanthomonas_phage	42.1	6.4e-30
2531673:2531687	attR	ATTAATCTTTTTGCC	NA	NA	NA	NA
>prophage 7
CP026095	Bacillus asahii strain OM18 chromosome, complete genome	4826182	2598104	2619049	4826182	integrase,transposase	Bacillus_phage(33.33%)	22	2596784:2596816	2601745:2601777
2596784:2596816	attL	TGATCTGACCCCTGTCAAGTAGACATAAAAAAA	NA	NA	NA	NA
AZV43309.1|2598104_2598257_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV43310.1|2598253_2598469_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV43311.1|2598536_2599136_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43312.1|2599213_2600263_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43313.1|2600557_2600848_+|transposase	transposase	transposase	NA	NA	NA	NA
AZV43314.1|2600844_2601735_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	40.6	5.6e-45
AZV43315.1|2602009_2603305_-	putative permease	NA	NA	NA	NA	NA
2601745:2601777	attR	TTTTTTTATGTCTACTTGACAGGGGTCAGATCA	NA	NA	NA	NA
AZV43316.1|2603403_2604792_-	PLP-dependent transcriptional regulator	NA	NA	NA	NA	NA
AZV43317.1|2605301_2606495_-	purine nucleoside transporter	NA	NA	NA	NA	NA
AZV43318.1|2607065_2608301_+|transposase	transposase	transposase	NA	NA	NA	NA
AZV43319.1|2609395_2609833_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43320.1|2610200_2610326_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43321.1|2610469_2610928_-	hypothetical protein	NA	M1HUK8	Acanthocystis_turfacea_Chlorella_virus	37.6	8.8e-10
AZV43322.1|2610978_2611197_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43323.1|2611515_2611665_+	alanine glycine permease	NA	NA	NA	NA	NA
AZV43324.1|2611783_2613067_+	proton glutamate symport protein	NA	NA	NA	NA	NA
AZV43325.1|2613239_2614100_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43326.1|2614298_2615672_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AZV43327.1|2615757_2615952_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43328.1|2616078_2617434_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
AZV43329.1|2617562_2617691_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43330.1|2618341_2619049_+|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	48.3	1.7e-52
>prophage 8
CP026095	Bacillus asahii strain OM18 chromosome, complete genome	4826182	2630982	2650282	4826182	integrase,transposase	Bacillus_phage(50.0%)	23	2643733:2643792	2650297:2650657
AZV43350.1|2630982_2631300_+|transposase	transposase	transposase	NA	NA	NA	NA
AZV43351.1|2631333_2631651_+|transposase	transposase	transposase	NA	NA	NA	NA
AZV43352.1|2631785_2632436_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43353.1|2632704_2633460_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43354.1|2633456_2634026_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43355.1|2634073_2634541_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AZV43356.1|2634761_2635793_-	arabinose ABC transporter permease	NA	NA	NA	NA	NA
AZV43357.1|2636078_2636765_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43358.1|2636850_2637627_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43359.1|2637964_2639050_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
AZV43360.1|2639159_2639729_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43361.1|2639939_2641061_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43362.1|2641449_2642343_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43363.1|2642521_2643046_-|transposase	transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.3	3.5e-31
2643733:2643792	attL	TGGTATGCTCCCCTTATAGTAGACACGTTTTAAAAAGCGCATTAATCTGTCTATTATTAA	NA	NA	NA	NA
AZV43364.1|2643806_2644097_+|transposase	transposase	transposase	NA	NA	NA	NA
AZV43365.1|2644093_2644984_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	40.6	2.8e-44
AZV43366.1|2645217_2646420_-	glycosyl transferase family 1	NA	Q9WEV9	Ectropis_obliqua_nucleopolyhedrovirus	27.2	3.9e-09
AZV43367.1|2646751_2647411_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43368.1|2647670_2647817_+	glycosyltransferase	NA	NA	NA	NA	NA
AZV43369.1|2647981_2648362_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43370.1|2648634_2648766_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43371.1|2649104_2649995_-|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	40.6	2.8e-44
AZV43372.1|2649991_2650282_-|transposase	transposase	transposase	NA	NA	NA	NA
2650297:2650657	attR	TTAATAATAGACAGATTAATGCGCTTTTTAAAACGTGTCTACTATAAGGGGAGCATACCAATTCCGGAAATGCGCCCTTTTCTAGAATATCTAACACAACCTACTCCTGACGATGAGTTAACTCTCTGTTAGTTCGCAGCACCCTGCTTTATTTTCAATTTCTTTTCTTGTGGAACAGACCGTTTTATAAATAATGAAACTATCCATGCGATGACTACTAGTACGAATGCAAGTAAGAACGCGCTTTTCATTCCAGCAATCATCGCCAGGATTTGTAATGTAGACTCCTGTTCCTTAATCACTGTTTTTTCCATAAAACGAGTAGAACTATTGGTCATGATTGATACAAGTAATGCTGTCC	NA	NA	NA	NA
>prophage 9
CP026095	Bacillus asahii strain OM18 chromosome, complete genome	4826182	2794270	2840390	4826182		Bacillus_phage(53.66%)	81	NA	NA
AZV43532.1|2794270_2795179_+	membrane protein	NA	M1Q1P6	Streptococcus_phage	31.1	1.2e-31
AZV43533.1|2795221_2795416_-	cold-shock protein	NA	NA	NA	NA	NA
AZV43534.1|2796101_2796308_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43535.1|2796378_2797992_-	ATP-dependent DNA helicase	NA	A0A2K9L3P7	Tupanvirus	36.6	3.4e-48
AZV43536.1|2798173_2799730_-	hypothetical protein	NA	A0A0N9RZT8	Staphylococcus_phage	31.6	1.3e-57
AZV43537.1|2799733_2800321_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43538.1|2800446_2800581_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43539.1|2800600_2801170_-	hypothetical protein	NA	A0A0K2FM39	Brevibacillus_phage	44.8	4.2e-46
AZV43540.1|2801198_2801339_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43541.1|2801371_2801485_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43542.1|2801518_2801710_-	hypothetical protein	NA	A0A143FPJ2	Bacillus_phage	56.8	1.4e-06
AZV43543.1|2801858_2802614_-	hypothetical protein	NA	G3MAC9	Bacillus_virus	28.9	1.8e-15
AZV43544.1|2802700_2803210_-	hypothetical protein	NA	A0A0H3UYW4	Geobacillus_virus	41.9	3.5e-36
AZV43545.1|2803270_2803819_-	thymidylate synthase	NA	A0A0H3V0R8	Geobacillus_virus	56.3	4.1e-46
AZV43546.1|2804049_2804175_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43547.1|2804152_2804389_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43548.1|2804360_2804645_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43549.1|2804718_2805333_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	46.9	4.1e-47
AZV43550.1|2805507_2805645_-	SPBc2 prophage-derived thioredoxin-like protein yosR	NA	A0A1P8CX24	Bacillus_phage	47.4	9.5e-05
AZV43551.1|2805641_2806028_-	hypothetical protein	NA	A0A2I6UHL5	Bacillus_phage	38.5	8.1e-17
AZV43552.1|2805978_2806314_-	hypothetical protein	NA	A0A2I7R8J4	Vibrio_phage	41.9	8.6e-15
AZV43553.1|2806354_2806762_-	Ribonucleoside-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	42.6	3.8e-25
AZV43554.1|2806829_2807405_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0E3JQ77	Bacillus_phage	43.5	4.2e-33
AZV43555.1|2807499_2807856_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43556.1|2807852_2807966_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43557.1|2808139_2808637_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A127AW21	Bacillus_phage	53.4	2.7e-41
AZV43558.1|2808638_2808848_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A0E3T6D4	Bacillus_phage	53.7	8.6e-05
AZV43559.1|2808880_2809309_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	66.7	3.0e-44
AZV43560.1|2809367_2810168_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A068CCS6	Listeria_phage	56.1	2.7e-75
AZV43561.1|2810219_2810780_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43562.1|2811100_2811229_-	DNA-cytosine methyltransferase	NA	M4I0E4	Staphylococcus_phage	76.3	2.4e-10
AZV43563.1|2811562_2811865_-	DNA methylase	NA	A0A0H3UZL7	Geobacillus_virus	81.4	6.7e-43
AZV43564.1|2811895_2812102_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43565.1|2812369_2812504_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43566.1|2812628_2812757_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43567.1|2812789_2813221_-	hypothetical protein	NA	A0A0E3D9L6	Bacillus_phage	46.5	2.4e-25
AZV43568.1|2813307_2813529_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43569.1|2813552_2813855_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43570.1|2813851_2814004_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43571.1|2814116_2814323_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43572.1|2814595_2814787_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43573.1|2814828_2815323_-	hypothetical protein	NA	A0A2R4P8H7	Staphylococcus_phage	47.0	3.7e-30
AZV43574.1|2815360_2815579_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43575.1|2815601_2816099_-	DNA methylase	NA	A0A166Y0E3	Gordonia_phage	61.0	5.3e-53
AZV43576.1|2816145_2816328_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43577.1|2816502_2816829_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43578.1|2817009_2817165_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43579.1|2817423_2818047_-	gp62 protein	NA	E5DV94	Deep-sea_thermophilic_phage	66.2	1.3e-19
AZV43580.1|2818048_2818357_-	hypothetical protein	NA	A0A218KBX6	Bacillus_phage	51.0	3.3e-21
AZV43581.1|2818415_2818778_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43582.1|2818827_2819517_-	endonuclease	NA	A0A1P8CWZ4	Bacillus_phage	36.2	1.6e-31
AZV43583.1|2819696_2823596_-	DNA polymerase	NA	A0A1P8CX14	Bacillus_phage	53.0	0.0e+00
AZV43584.1|2823656_2825363_-	hypothetical protein	NA	A0A1P8CX07	Bacillus_phage	51.7	6.5e-167
AZV43585.1|2825359_2826460_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	47.3	3.0e-96
AZV43586.1|2826474_2827611_-	HNH homing endonuclease III	NA	U5Q199	Bacillus_phage	46.9	3.1e-32
AZV43587.1|2827663_2829163_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	43.6	9.0e-112
AZV43588.1|2829224_2829698_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	44.9	1.4e-34
AZV43589.1|2829771_2830761_-	SPBc2 prophage-derived protein YorG	NA	A0A1P8CX29	Bacillus_phage	62.4	9.8e-115
AZV43590.1|2830851_2831799_-	hypothetical protein	NA	O64140	Bacillus_phage	45.0	1.0e-65
AZV43591.1|2831961_2832267_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43592.1|2832343_2832475_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43593.1|2832493_2832607_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43594.1|2832830_2833037_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43595.1|2833065_2833284_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43596.1|2833520_2833733_-	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	57.6	5.1e-05
AZV43597.1|2833766_2834078_-	hypothetical protein	NA	S5Y0I4	Bacillus_phage	39.4	5.7e-13
AZV43598.1|2834114_2834480_-	hypothetical protein	NA	A0A0H3UZJ4	Geobacillus_virus	33.1	4.4e-12
AZV43599.1|2834539_2834710_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43600.1|2834721_2834844_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43601.1|2834800_2834989_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43602.1|2834978_2835278_-	hypothetical protein	NA	A0A1U9WRA3	Streptococcus_virus	48.3	9.4e-13
AZV43603.1|2835348_2835540_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43604.1|2835569_2836187_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43605.1|2836207_2836459_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43606.1|2836488_2836848_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43607.1|2836901_2837222_-	hypothetical protein	NA	R4JEV0	Bacillus_phage	60.0	2.2e-31
AZV43608.1|2837277_2838003_-	beta-ketoadipate enol-lactone hydrolase	NA	A0A0A0RRH5	Mycobacterium_phage	28.0	2.8e-10
AZV43609.1|2838017_2838170_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43610.1|2838199_2838724_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43611.1|2838764_2839061_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43612.1|2839088_2840390_-	hypothetical protein	NA	A0A2C9CY55	Yersinia_phage	39.2	9.1e-44
>prophage 10
CP026095	Bacillus asahii strain OM18 chromosome, complete genome	4826182	2891369	2900939	4826182	protease	Bacillus_phage(57.14%)	10	NA	NA
AZV43704.1|2891369_2891921_-	metalloendopeptidase-like membrane protein	NA	R4JF21	Bacillus_phage	63.4	8.0e-42
AZV43705.1|2892128_2893223_-	cell division protein FtsZ	NA	NA	NA	NA	NA
AZV43706.1|2893222_2893504_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43707.1|2893818_2894001_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43708.1|2894079_2896689_+	hypothetical protein	NA	O64076	Bacillus_phage	53.8	1.5e-263
AZV43709.1|2896920_2897214_+	transcriptional regulator	NA	B5TA87	Burkholderia_phage	39.1	5.8e-07
AZV43710.1|2897343_2898642_+	hypothetical protein	NA	A0A141HS37	Bacillus_phage	40.6	2.2e-74
AZV43711.1|2898769_2898958_+	hypothetical protein	NA	A0A1P8CWT3	Bacillus_phage	60.7	5.9e-13
AZV43712.1|2898969_2900157_+	hypothetical protein	NA	A0A0N9SK37	Staphylococcus_phage	39.9	1.4e-72
AZV43713.1|2900330_2900939_+|protease	aTP-dependent Clp protease proteolytic subunit 1	protease	H8ZJL3	Ostreococcus_tauri_virus	31.8	3.1e-10
>prophage 11
CP026095	Bacillus asahii strain OM18 chromosome, complete genome	4826182	2903968	2911989	4826182		Bacillus_phage(37.5%)	10	NA	NA
AZV43716.1|2903968_2905426_+	hypothetical protein	NA	U5J9V5	Bacillus_phage	40.8	4.3e-95
AZV43717.1|2905462_2907022_+	hypothetical protein	NA	A0A0K2FMA5	Brevibacillus_phage	47.1	2.2e-52
AZV43718.1|2907102_2907639_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43719.1|2907683_2908685_+	hypothetical protein	NA	A0A218KCB5	Bacillus_phage	34.5	2.8e-45
AZV43720.1|2908766_2909336_+	hypothetical protein	NA	A0A0K2FLE1	Brevibacillus_phage	38.6	5.8e-19
AZV43721.1|2909352_2909778_+	hypothetical protein	NA	A0A0H3UZ42	Geobacillus_virus	41.0	1.7e-20
AZV43722.1|2909774_2910098_+	hypothetical protein	NA	A0A218KCB7	Bacillus_phage	40.6	4.7e-10
AZV43723.1|2910100_2910745_+	hypothetical protein	NA	A0A0K2FLR2	Brevibacillus_phage	28.1	3.7e-06
AZV43724.1|2910748_2911240_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43725.1|2911251_2911989_+	hypothetical protein	NA	A0A0H3V0N8	Geobacillus_virus	29.7	3.8e-15
>prophage 12
CP026095	Bacillus asahii strain OM18 chromosome, complete genome	4826182	2921211	2946972	4826182	holin	Bacillus_phage(41.67%)	19	NA	NA
AZV43737.1|2921211_2922588_+	peptidase M23	NA	A0A1D6X855	Bacillus_phage	34.6	1.1e-10
AZV43738.1|2922863_2923043_+	hypothetical protein	NA	A0A0N9S894	Staphylococcus_phage	70.0	9.6e-13
AZV43739.1|2923332_2923467_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43740.1|2923774_2930695_+	hypothetical protein	NA	A0A0S2SXN2	Bacillus_phage	45.7	4.3e-23
AZV43741.1|2930698_2931811_+	hypothetical protein	NA	U5J9C3	Bacillus_phage	46.2	2.7e-04
AZV43742.1|2931879_2932035_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43743.1|2932124_2933255_+	hypothetical protein	NA	I7CCU4	Staphylococcus_virus	34.0	1.8e-32
AZV43744.1|2933276_2936555_+	hypothetical protein	NA	U5J9M3	Bacillus_phage	45.6	2.5e-114
AZV43745.1|2936573_2936729_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43746.1|2936836_2940466_+	hypothetical protein	NA	A0A2H4PIX9	Corynebacterium_phage	28.8	6.1e-13
AZV43747.1|2940663_2942070_+	hypothetical protein	NA	S6CLR0	Klebsiella_phage	62.5	5.6e-07
AZV43748.1|2942381_2942774_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43749.1|2942805_2942985_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43750.1|2943076_2944249_+	hypothetical protein	NA	A0A0A7NNI1	Lactobacillus_phage	47.6	2.4e-88
AZV43751.1|2944284_2945091_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	71.8	5.2e-66
AZV43752.1|2945134_2945458_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43753.1|2945471_2945723_+|holin	holin	holin	A0A1Q1PW49	Staphylococcus_phage	59.0	2.1e-18
AZV43754.1|2945755_2945932_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43755.1|2946021_2946972_+	hypothetical protein	NA	A0A1W6JK50	Lactococcus_phage	44.9	3.3e-67
>prophage 13
CP026095	Bacillus asahii strain OM18 chromosome, complete genome	4826182	3011637	3093174	4826182	coat,bacteriocin,integrase,transposase	Bacillus_phage(53.85%)	100	3007201:3007216	3059178:3059219
3007201:3007216	attL	TTTATTAAAAGCATGG	NA	NA	NA	NA
AZV43819.1|3011637_3011805_+|integrase	integrase	integrase	S6C485	Thermus_phage	52.8	5.4e-10
3007201:3007216	attL	TTTATTAAAAGCATGG	NA	NA	NA	NA
AZV43820.1|3011943_3012084_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43821.1|3012140_3013259_-	UDP-diphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AZV43822.1|3013367_3014726_+	multidrug transporter MatE	NA	NA	NA	NA	NA
AZV43823.1|3014883_3015348_+|coat	spore coat protein	coat	NA	NA	NA	NA
AZV43824.1|3015403_3016159_-	hypothetical protein	NA	A0A0E3T7R5	Bacillus_phage	63.7	1.3e-39
AZV43825.1|3016568_3016955_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43826.1|3016977_3018342_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.9	5.4e-39
3017698:3017713	attR	TTTATTAAAAGCATGG	NA	NA	NA	NA
AZV43827.1|3018379_3019078_-	hypothetical protein	NA	W8CYM9	Bacillus_phage	41.0	2.4e-43
3017698:3017713	attR	TTTATTAAAAGCATGG	NA	NA	NA	NA
AZV43828.1|3019078_3020032_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43829.1|3020334_3020580_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
AZV43830.1|3020638_3021565_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
AZV43831.1|3021689_3022367_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZV43832.1|3022375_3023350_+	membrane protein	NA	NA	NA	NA	NA
AZV43833.1|3023463_3024648_-	aminotransferase	NA	NA	NA	NA	NA
AZV43834.1|3024748_3025531_+	hydrolase	NA	NA	NA	NA	NA
AZV43835.1|3025826_3027029_+	methylthioribose kinase	NA	NA	NA	NA	NA
AZV43836.1|3027294_3028191_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43837.1|3028312_3029776_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	29.9	2.8e-25
AZV43838.1|3030076_3030784_-	purine nucleoside phosphorylase DeoD-type	NA	NA	NA	NA	NA
AZV43839.1|3030999_3031560_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43840.1|3031585_3032434_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AZV43841.1|3032433_3032859_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43842.1|3032957_3033437_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43843.1|3033746_3033905_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43844.1|3034179_3034356_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43845.1|3034512_3035271_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43846.1|3035440_3035611_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43847.1|3035676_3036384_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43848.1|3036652_3036880_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43849.1|3037152_3037917_-	nitrilase	NA	NA	NA	NA	NA
AZV43850.1|3038065_3038887_-	membrane protein	NA	NA	NA	NA	NA
AZV43851.1|3038879_3039368_-	membrane protein	NA	NA	NA	NA	NA
AZV43852.1|3039592_3039913_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43853.1|3039909_3040266_+|transposase	transposase	transposase	S5VXZ8	Leptospira_phage	44.7	5.2e-18
AZV43854.1|3040319_3041897_+|transposase	transposase	transposase	S5VTD3	Leptospira_phage	34.6	2.6e-69
AZV43855.1|3042295_3042664_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43856.1|3043185_3043404_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43857.1|3043486_3044023_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43858.1|3044156_3044342_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	70.7	1.9e-16
AZV43859.1|3044707_3045022_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43860.1|3045195_3045651_-	hypothetical protein	NA	A0A0S2SXN1	Bacillus_phage	68.9	1.0e-50
AZV43861.1|3045779_3045920_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43862.1|3046272_3046659_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43863.1|3046996_3047377_-	glyoxalase family protein	NA	NA	NA	NA	NA
AZV43864.1|3047874_3049170_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV43865.1|3049485_3049776_+|transposase	transposase	transposase	NA	NA	NA	NA
AZV43866.1|3049772_3050663_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	40.6	5.6e-45
AZV43867.1|3050875_3051250_-	pyridoxal-5'-phosphate-dependent protein subunit beta	NA	NA	NA	NA	NA
AZV43868.1|3051288_3051837_-	pyridoxal-5'-phosphate-dependent protein subunit beta	NA	NA	NA	NA	NA
AZV43869.1|3052154_3052781_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AZV43870.1|3052905_3053256_+	transcriptional regulator	NA	NA	NA	NA	NA
AZV43871.1|3053747_3054245_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43872.1|3054315_3054699_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43873.1|3054791_3055577_-	methyltransferase	NA	NA	NA	NA	NA
AZV43874.1|3056089_3056659_+	RNA polymerase factor sigma-70	NA	NA	NA	NA	NA
AZV43875.1|3056655_3057672_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43876.1|3057999_3058290_+|transposase	transposase	transposase	NA	NA	NA	NA
AZV43877.1|3058286_3059177_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	40.6	5.6e-45
AZV43878.1|3059316_3059472_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43879.1|3059485_3060349_-	membrane protein	NA	NA	NA	NA	NA
AZV43880.1|3060887_3061658_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43881.1|3061609_3061981_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43882.1|3062216_3063644_+|transposase	transposase	transposase	NA	NA	NA	NA
AZV43883.1|3063677_3063797_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43884.1|3063959_3064682_-	ECF-type sigma factor negative effector	NA	NA	NA	NA	NA
AZV43885.1|3064674_3065202_-	RNA polymerase, sigma subunit, SigV	NA	NA	NA	NA	NA
AZV43886.1|3065570_3065711_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43887.1|3065875_3067549_+	ribonuclease J	NA	NA	NA	NA	NA
AZV43888.1|3067706_3067982_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43889.1|3068211_3068805_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43890.1|3069387_3070299_+	transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	33.6	6.2e-31
AZV43891.1|3070579_3071242_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
AZV43892.1|3071437_3072190_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZV43893.1|3072678_3073005_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43894.1|3073143_3073350_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43895.1|3073791_3074769_-	KipI antagonist	NA	NA	NA	NA	NA
AZV43896.1|3074765_3075509_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43897.1|3075535_3076327_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43898.1|3076397_3077630_-	membrane protein	NA	NA	NA	NA	NA
AZV43899.1|3077654_3078419_-	LamB/YcsF family protein	NA	NA	NA	NA	NA
AZV43900.1|3078718_3079105_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43901.1|3079124_3079334_-	metal ABC transporter ATPase	NA	NA	NA	NA	NA
AZV43902.1|3079383_3079563_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43903.1|3079767_3080418_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43904.1|3080616_3080769_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43905.1|3081065_3081980_-	membrane protein	NA	NA	NA	NA	NA
AZV43906.1|3082248_3083295_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43907.1|3083617_3084832_-	MFS transporter	NA	NA	NA	NA	NA
AZV43908.1|3084953_3085826_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43909.1|3085850_3085967_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43910.1|3085971_3086151_-	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
AZV43911.1|3086255_3086858_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AZV43912.1|3086854_3088804_-	quinol oxidase subunit 1	NA	NA	NA	NA	NA
AZV43913.1|3088854_3089772_-	quinol oxidase subunit 2	NA	NA	NA	NA	NA
AZV43914.1|3090135_3090291_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43915.1|3090381_3090885_+	hypothetical protein	NA	NA	NA	NA	NA
AZV43916.1|3091003_3091201_-	hypothetical protein	NA	NA	NA	NA	NA
AZV43917.1|3091225_3091534_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AZV43918.1|3091926_3093174_+|transposase	transposase	transposase	A0A0A8WI33	Clostridium_phage	33.7	3.4e-48
>prophage 14
CP026095	Bacillus asahii strain OM18 chromosome, complete genome	4826182	3447353	3486151	4826182	transposase	Staphylococcus_phage(22.22%)	39	NA	NA
AZV44294.1|3447353_3449309_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV44295.1|3449330_3449594_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44296.1|3449593_3450022_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44297.1|3450136_3450625_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44298.1|3450614_3453377_-	membrane protein	NA	NA	NA	NA	NA
AZV44299.1|3453373_3457801_-	FtsK/SpoIIIE family protein	NA	V5UPA0	Mycobacterium_phage	22.4	6.2e-44
AZV44300.1|3457873_3459196_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44301.1|3459210_3459450_-	ubiquitin	NA	NA	NA	NA	NA
AZV44302.1|3459529_3459823_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44303.1|3460190_3461183_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZV44304.1|3461387_3461945_-	elongation factor P	NA	NA	NA	NA	NA
AZV44305.1|3461970_3463032_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
AZV44306.1|3463032_3463479_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AZV44307.1|3463552_3464068_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44308.1|3464246_3465182_+	membrane protein	NA	NA	NA	NA	NA
AZV44309.1|3465274_3465655_+	hypothetical protein	NA	NA	NA	NA	NA
AZV44310.1|3465677_3466559_-	hypothetical protein	NA	A0A1X7QFZ0	Faustovirus	29.3	2.9e-17
AZV44311.1|3466834_3467692_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44312.1|3467971_3468115_+	hypothetical protein	NA	NA	NA	NA	NA
AZV44313.1|3468225_3469359_+	alcohol dehydrogenase	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	28.5	1.6e-12
AZV44314.1|3469508_3469628_+	hypothetical protein	NA	NA	NA	NA	NA
AZV44315.1|3469782_3470985_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV44316.1|3471336_3471501_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44317.1|3472185_3472974_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44318.1|3473421_3474717_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV44319.1|3474907_3475573_-	5'-nucleotidase	NA	NA	NA	NA	NA
AZV44320.1|3475927_3477151_+|transposase	transposase	transposase	NA	NA	NA	NA
AZV44321.1|3477323_3478067_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44322.1|3478188_3478677_-	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
AZV44323.1|3478863_3479085_+	peptidase S8	NA	A0A2H4PQH1	Staphylococcus_phage	49.2	2.7e-09
AZV44324.1|3479122_3480550_-	histidine kinase sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	25.6	7.0e-13
AZV44325.1|3480549_3481281_-	chemotaxis protein CheY	NA	W8CYM9	Bacillus_phage	41.2	3.4e-40
AZV44326.1|3481312_3481549_-	ABC transporter permease	NA	NA	NA	NA	NA
AZV44327.1|3481573_3482335_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44328.1|3482352_3483183_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44329.1|3483179_3483914_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.9	1.3e-34
AZV44330.1|3483999_3484125_-	lantibiotic biosynthesis protein, HFCD family	NA	NA	NA	NA	NA
AZV44331.1|3484163_3485741_-|transposase	transposase	transposase	S5VTD3	Leptospira_phage	33.9	1.7e-68
AZV44332.1|3485794_3486151_-|transposase	transposase	transposase	S5VXZ8	Leptospira_phage	44.7	4.0e-18
>prophage 15
CP026095	Bacillus asahii strain OM18 chromosome, complete genome	4826182	3627031	3664508	4826182	coat,protease,tRNA,transposase	Clostridium_phage(20.0%)	39	NA	NA
AZV44484.1|3627031_3628132_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
AZV44485.1|3628489_3629563_-	putative X-linked retinitis pigmentosa GTPase regulator-like	NA	NA	NA	NA	NA
AZV44486.1|3629761_3630010_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44487.1|3630120_3631257_-	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	28.0	1.5e-18
AZV44488.1|3631259_3632183_-	cysteine synthase	NA	C3U2M1	Lactococcus_phage	44.3	2.1e-66
AZV44489.1|3632285_3632981_-	5'-methylthioadenosine nucleosidase	NA	NA	NA	NA	NA
AZV44490.1|3632996_3633197_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZV44491.1|3633568_3634030_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV44492.1|3634085_3634304_-|transposase	transposase	transposase	A0A0A8WI33	Clostridium_phage	45.8	5.2e-05
AZV44493.1|3634405_3634561_-|transposase	transposase	transposase	NA	NA	NA	NA
AZV44494.1|3634521_3634890_-|transposase	transposase	transposase	A0A0A8WI33	Clostridium_phage	48.1	5.7e-20
AZV44495.1|3635169_3635382_+	hypothetical protein	NA	NA	NA	NA	NA
AZV44496.1|3635434_3636082_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44497.1|3636160_3637900_-	penicillin-binding protein	NA	NA	NA	NA	NA
AZV44498.1|3638062_3638176_+	hypothetical protein	NA	NA	NA	NA	NA
AZV44499.1|3638211_3638688_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
AZV44500.1|3639167_3640442_-	peptidase YrrO	NA	Q6DW11	Phage_TP	32.7	1.6e-37
AZV44501.1|3640465_3641395_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44502.1|3641381_3642044_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZV44503.1|3642285_3643413_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44504.1|3643731_3644013_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44505.1|3644024_3644450_-	Holliday junction resolvase	NA	NA	NA	NA	NA
AZV44506.1|3644449_3644719_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44507.1|3644785_3647422_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	35.5	3.9e-70
AZV44508.1|3647713_3648790_-	membrane protein	NA	NA	NA	NA	NA
AZV44509.1|3649048_3649243_-	Zn-ribbon containing protein	NA	NA	NA	NA	NA
AZV44510.1|3649253_3649706_-	photosystem reaction center subunit H	NA	NA	NA	NA	NA
AZV44511.1|3649900_3652291_-	hypothetical protein	NA	A0A1P8DII4	Virus_Rctr197k	27.2	1.7e-48
AZV44512.1|3652328_3652994_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44513.1|3653087_3654203_-	thiouridylase	NA	NA	NA	NA	NA
AZV44514.1|3654216_3655362_-	cysteine desulfurase	NA	NA	NA	NA	NA
AZV44515.1|3655483_3655903_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AZV44516.1|3656096_3657374_+	recombinase RarA	NA	A0A127AWE7	Bacillus_phage	51.9	1.6e-109
AZV44517.1|3657556_3657694_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44518.1|3657999_3659340_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	31.4	1.2e-46
AZV44519.1|3659379_3660048_+	hypothetical protein	NA	NA	NA	NA	NA
AZV44520.1|3660281_3661133_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44521.1|3661382_3662567_+	MFS transporter major facilitator superfamily protein	NA	NA	NA	NA	NA
AZV44522.1|3662651_3664508_-|protease	P4A1 serine protease	protease	A0A1B0T6A2	Bacillus_phage	35.7	7.6e-52
>prophage 16
CP026095	Bacillus asahii strain OM18 chromosome, complete genome	4826182	3997995	4035357	4826182	integrase,transposase	Bacillus_phage(50.0%)	38	4034097:4034142	4038275:4038320
AZV44839.1|3997995_3998904_+|integrase	phage integrase family domain protein	integrase	A0A1W6JQD3	Staphylococcus_phage	22.7	6.4e-12
AZV44840.1|3999000_3999117_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44841.1|3999214_3999838_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44842.1|4000042_4000210_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44843.1|4000668_4003278_-	superfamily II helicase	NA	NA	NA	NA	NA
AZV44844.1|4003567_4004170_-	DNA recombinase	NA	A0A0A8WJD4	Clostridium_phage	26.2	4.0e-10
AZV44845.1|4004650_4006234_+	hypothetical protein	NA	NA	NA	NA	NA
AZV44846.1|4006755_4007457_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44847.1|4007843_4008668_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44848.1|4009261_4009471_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44849.1|4009950_4010490_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44850.1|4010868_4010997_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44851.1|4011480_4011609_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44852.1|4012003_4012696_-	bacitracin transport permease	NA	NA	NA	NA	NA
AZV44853.1|4012688_4013612_-	bacitracin ABC transporter, ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.9	3.0e-41
AZV44854.1|4013716_4014652_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.2	5.7e-24
AZV44855.1|4014653_4015367_-	two-component response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.6e-34
AZV44856.1|4016314_4016605_+|transposase	transposase	transposase	NA	NA	NA	NA
AZV44857.1|4016601_4017492_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	40.6	5.6e-45
AZV44858.1|4017827_4018286_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44859.1|4018303_4019095_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44860.1|4019492_4019894_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44861.1|4020484_4021225_+	metal-binding protein	NA	NA	NA	NA	NA
AZV44862.1|4021523_4021982_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44864.1|4022405_4024193_-	amino acid permease	NA	NA	NA	NA	NA
AZV44863.1|4024149_4024512_+	hypothetical protein	NA	NA	NA	NA	NA
AZV44865.1|4024687_4024810_+	hypothetical protein	NA	NA	NA	NA	NA
AZV44866.1|4025073_4026687_-	hypothetical protein	NA	A0A2H4J178	uncultured_Caudovirales_phage	32.5	1.3e-23
AZV44867.1|4026903_4028238_+	V-type sodium ATP synthase subunit J	NA	NA	NA	NA	NA
AZV44868.1|4028257_4028920_+	potassium transporter Trk	NA	NA	NA	NA	NA
AZV44869.1|4029006_4029135_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44870.1|4029238_4029601_-	DSBA-like thioredoxin domain protein	NA	NA	NA	NA	NA
AZV44871.1|4029886_4030525_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AZV44872.1|4030654_4031296_-	hypothetical protein	NA	NA	NA	NA	NA
AZV44873.1|4031504_4031939_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AZV44874.1|4032404_4033691_-|transposase	transposase	transposase	A0A0U3ULR1	Bacillus_phage	22.0	1.3e-13
4034097:4034142	attL	TCTGGCAGCGTAGAGGTCAGGGGTTCGAGCCCCCTATGCTCCATAC	NA	NA	NA	NA
AZV44875.1|4034260_4034716_-|integrase	integrase	integrase	A0A1B0T6A8	Bacillus_phage	47.0	2.2e-29
AZV44876.1|4034709_4035357_-|integrase	integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	40.2	6.5e-35
4038275:4038320	attR	TCTGGCAGCGTAGAGGTCAGGGGTTCGAGCCCCCTATGCTCCATAC	NA	NA	NA	NA
>prophage 17
CP026095	Bacillus asahii strain OM18 chromosome, complete genome	4826182	4333842	4347599	4826182	protease	Bacillus_virus(33.33%)	17	NA	NA
AZV45185.1|4333842_4334058_+	DNA-binding protein	NA	A0A076G7N2	Bacillus_phage	41.8	2.5e-07
AZV45186.1|4334077_4334491_-	hypothetical protein	NA	A6XML4	Bacillus_virus	48.6	5.3e-22
AZV45187.1|4334506_4334956_-	hypothetical protein	NA	B3RH37	Bacillus_virus	57.4	3.2e-49
AZV45188.1|4335023_4336310_-	hypothetical protein	NA	B3RH36	Bacillus_virus	43.6	3.2e-94
AZV45189.1|4336593_4336824_+	hypothetical protein	NA	S5MBY6	Brevibacillus_phage	46.1	1.5e-13
AZV45190.1|4337893_4338175_+	hypothetical protein	NA	NA	NA	NA	NA
AZV45191.1|4338291_4338450_+	hypothetical protein	NA	NA	NA	NA	NA
AZV45192.1|4338454_4338970_+	hypothetical protein	NA	NA	NA	NA	NA
AZV45193.1|4339123_4339927_-	hypothetical protein	NA	A0A288WFZ2	Bacillus_phage	31.6	3.2e-15
AZV45194.1|4340104_4341070_-	hypothetical protein	NA	A0A142F1N9	Bacillus_phage	36.5	1.4e-46
AZV45195.1|4341578_4342184_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	56.8	1.3e-53
AZV45196.1|4342294_4342552_-	phosphocarrier protein Chr	NA	NA	NA	NA	NA
AZV45197.1|4342573_4343527_-	sporulation regulator WhiA	NA	Q7AWZ3	Streptococcus_phage	38.8	1.9e-51
AZV45198.1|4343704_4344670_-	hypothetical protein	NA	A1IMD5	Streptococcus_phage	42.7	4.8e-66
AZV45199.1|4344644_4345556_-	glmZ(sRNA)-inactivating NTPase	NA	A0A0R8VB27	Thermobifida_phage	25.8	2.0e-05
AZV45200.1|4345590_4345953_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AZV45201.1|4346648_4347599_-	thioredoxin reductase	NA	G3MA85	Bacillus_virus	53.6	9.8e-88
