The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034760	Klebsiella pneumoniae strain NB5306 chromosome, complete genome	5261911	445175	514553	5261911	tRNA,protease,capsid,tail,integrase,head,portal,terminase	uncultured_Caudovirales_phage(61.11%)	74	462783:462800	478778:478795
AZV12864.1|445175_446123_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AZV12865.1|446137_446647_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AZV12866.1|446775_447900_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AZV12867.1|447871_448345_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AZV12868.1|448370_448913_+	hypothetical protein	NA	NA	NA	NA	NA
AZV12869.1|448917_449490_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AZV12870.1|449493_450312_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AZV12871.1|450308_450566_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AZV12872.1|450541_451096_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AZV12873.1|456891_457113_-	hypothetical protein	NA	NA	NA	NA	NA
AZV12874.1|457406_460517_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AZV12875.1|460529_461669_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZV12876.1|462047_462698_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
462783:462800	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AZV12877.1|462973_464200_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AZV12878.1|464292_465234_+	hypothetical protein	NA	NA	NA	NA	NA
AZV12879.1|465415_465700_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AZV12880.1|465710_466490_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AZV17279.1|466613_466808_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AZV17278.1|466941_467211_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
AZV12881.1|467203_467392_+	hypothetical protein	NA	NA	NA	NA	NA
AZV12882.1|467384_467699_+	hypothetical protein	NA	NA	NA	NA	NA
AZV12883.1|467695_468064_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AZV12884.1|468060_468426_+	hypothetical protein	NA	NA	NA	NA	NA
AZV12885.1|468425_470561_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AZV12886.1|470903_471239_+	hypothetical protein	NA	NA	NA	NA	NA
AZV12887.1|471287_471800_-	hypothetical protein	NA	NA	NA	NA	NA
AZV12888.1|472063_473230_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AZV12889.1|473281_473842_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AZV12890.1|473843_475085_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AZV12891.1|475081_475417_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AZV12892.1|475413_475713_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AZV12893.1|475712_476156_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AZV12894.1|476282_476474_+|terminase	terminase	terminase	NA	NA	NA	NA
AZV12895.1|476431_476788_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AZV12896.1|476771_478433_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AZV12897.1|478435_478627_+	hypothetical protein	NA	NA	NA	NA	NA
AZV12898.1|478780_479077_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
478778:478795	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AZV12899.1|479101_480067_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AZV12900.1|480224_480452_-	hypothetical protein	NA	NA	NA	NA	NA
AZV12901.1|480424_481306_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AZV17280.1|481317_482769_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
AZV12902.1|482758_483001_-	DUF997 family protein	NA	NA	NA	NA	NA
AZV12903.1|483111_484461_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AZV12904.1|484471_484939_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AZV12905.1|484961_485414_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AZV12906.1|485637_486246_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AZV12907.1|486245_487247_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AZV12908.1|487475_487667_+	hypothetical protein	NA	NA	NA	NA	NA
AZV12909.1|487746_489687_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AZV12910.1|489992_491036_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AZV12911.1|491106_492099_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AZV12912.1|492098_492587_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AZV12913.1|492594_493176_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AZV12914.1|493178_494648_+	ribonuclease G	NA	NA	NA	NA	NA
AZV12915.1|494685_498483_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AZV12916.1|498571_500017_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AZV12917.1|500052_500982_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AZV12918.1|501113_501317_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
AZV12919.1|501324_502257_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AZV12920.1|502262_504230_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AZV12921.1|504309_504585_+	hypothetical protein	NA	NA	NA	NA	NA
AZV12922.1|504635_504902_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZV12923.1|505000_505264_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZV12924.1|505639_506110_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
AZV12925.1|506524_507463_+	malate dehydrogenase	NA	NA	NA	NA	NA
AZV12926.1|507599_508658_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AZV12927.1|508745_510113_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AZV12928.1|510286_510685_-	DUF1043 family protein	NA	NA	NA	NA	NA
AZV12929.1|510875_512003_+	cell division protein ZapE	NA	NA	NA	NA	NA
AZV12930.1|512268_512697_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AZV12931.1|512712_513105_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AZV12932.1|513214_513418_-	hypothetical protein	NA	NA	NA	NA	NA
AZV12933.1|513416_514055_+	stringent starvation protein A	NA	NA	NA	NA	NA
AZV12934.1|514058_514553_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
CP034760	Klebsiella pneumoniae strain NB5306 chromosome, complete genome	5261911	1232779	1246204	5261911		Enterobacteria_phage(50.0%)	13	NA	NA
AZV13617.1|1232779_1233895_-	hypothetical protein	NA	A0A2D1GR68	Pseudomonas_phage	39.4	8.1e-25
AZV13618.1|1233891_1235226_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
AZV13619.1|1235757_1238100_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	80.6	0.0e+00
AZV13620.1|1238114_1238435_-	hypothetical protein	NA	NA	NA	NA	NA
AZV13621.1|1238431_1238659_-	hypothetical protein	NA	NA	NA	NA	NA
AZV13622.1|1238655_1239207_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	71.3	6.1e-34
AZV13623.1|1240011_1240749_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	58.6	2.7e-69
AZV13624.1|1240745_1240991_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	2.2e-20
AZV13625.1|1241008_1241575_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	4.3e-59
AZV13626.1|1242208_1242781_-	hypothetical protein	NA	S5FXQ0	Shigella_phage	55.9	9.2e-49
AZV13627.1|1242788_1243811_-	hypothetical protein	NA	S5FNT5	Shigella_phage	45.3	8.1e-80
AZV13628.1|1243797_1245030_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	49.6	4.6e-106
AZV13629.1|1245721_1246204_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
>prophage 3
CP034760	Klebsiella pneumoniae strain NB5306 chromosome, complete genome	5261911	1361303	1429236	5261911	terminase,protease,tail,holin,transposase	Salmonella_phage(37.74%)	75	NA	NA
AZV13729.1|1361303_1362770_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AZV13730.1|1362837_1364415_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
AZV13731.1|1364606_1365857_+	DUF4102 domain-containing protein	NA	A0A1X9TCT6	Enterobacter_phage	85.3	1.8e-206
AZV13732.1|1365873_1366065_-	hypothetical protein	NA	NA	NA	NA	NA
AZV13733.1|1366061_1366655_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	1.6e-109
AZV13734.1|1366651_1367305_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	64.2	4.8e-70
AZV13735.1|1367301_1367460_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	75.0	5.6e-17
AZV13736.1|1367452_1367746_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
AZV13737.1|1367855_1368104_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
AZV13738.1|1368152_1369034_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.6	4.0e-136
AZV13739.1|1369030_1369852_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	81.3	9.5e-132
AZV13740.1|1369848_1370148_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	52.5	8.8e-19
AZV13741.1|1370512_1371094_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
AZV13742.1|1371248_1371482_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AZV13743.1|1371628_1371832_+	hypothetical protein	NA	Q858D5	Salmonella_phage	82.1	2.3e-23
AZV13744.1|1371828_1372812_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	68.9	1.6e-146
AZV17318.1|1372801_1373566_+	DNA replication domain protein	NA	G9L6A8	Escherichia_phage	90.8	1.1e-60
AZV13745.1|1373691_1374045_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	69.8	5.5e-36
AZV13746.1|1374861_1375272_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	46.1	2.5e-16
AZV13747.1|1375255_1375447_+	hypothetical protein	NA	NA	NA	NA	NA
AZV13748.1|1375443_1376088_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
AZV17319.1|1376381_1376849_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
AZV13749.1|1376848_1377142_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
AZV13750.1|1377138_1377759_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
AZV17321.1|1377758_1377962_+	hypothetical protein	NA	NA	NA	NA	NA
AZV13751.1|1377954_1378293_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
AZV17320.1|1378389_1379874_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AZV13752.1|1379873_1380125_-	hypothetical protein	NA	NA	NA	NA	NA
AZV13753.1|1380277_1380535_+	lF-82	NA	NA	NA	NA	NA
AZV13754.1|1380612_1381197_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
AZV13755.1|1381193_1382669_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.2	2.7e-278
AZV13756.1|1382665_1383451_-	hypothetical protein	NA	NA	NA	NA	NA
AZV17322.1|1383544_1383787_+	hypothetical protein	NA	NA	NA	NA	NA
AZV13757.1|1384142_1384331_+	hypothetical protein	NA	NA	NA	NA	NA
AZV13758.1|1384350_1384557_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
AZV13759.1|1384571_1386254_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
AZV13760.1|1386250_1386547_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
AZV13761.1|1386549_1387230_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	1.8e-75
AZV13762.1|1387244_1388231_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
AZV13763.1|1388284_1388722_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
AZV13764.1|1388732_1389074_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	3.1e-36
AZV13765.1|1389124_1389448_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	86.0	8.2e-47
AZV13766.1|1389447_1390053_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.5	1.4e-87
AZV13767.1|1390052_1392530_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.1	0.0e+00
AZV13768.1|1392529_1392994_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.0	1.3e-69
AZV13769.1|1392993_1393533_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	70.9	2.4e-59
AZV13770.1|1393543_1396357_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	92.6	0.0e+00
AZV13771.1|1396353_1398159_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	73.5	3.3e-238
AZV13772.1|1398162_1400637_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	87.1	0.0e+00
AZV13773.1|1400835_1401132_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	92.7	2.4e-45
AZV13774.1|1401166_1401319_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	81.6	4.3e-14
AZV13775.1|1401417_1401714_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.1	2.4e-24
AZV13776.1|1404364_1404703_+	hypothetical protein	NA	NA	NA	NA	NA
AZV13777.1|1404812_1405217_+	hypothetical protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
AZV13778.1|1405203_1405509_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
AZV13779.1|1405498_1406128_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	77.9	4.3e-92
AZV13780.1|1406124_1406607_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	78.1	1.3e-59
AZV13781.1|1406826_1408695_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
AZV13782.1|1408678_1409857_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
AZV13783.1|1410150_1411383_-	MFS transporter	NA	NA	NA	NA	NA
AZV13784.1|1411480_1412368_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZV13785.1|1412406_1412637_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	88.6	5.7e-10
AZV13786.1|1413007_1415236_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AZV13787.1|1415289_1416822_-	exopolyphosphatase	NA	NA	NA	NA	NA
AZV13788.1|1416825_1418886_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
AZV13789.1|1419066_1419708_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
AZV13790.1|1419704_1420742_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
AZV13791.1|1421005_1421899_+	beta-glucoside kinase	NA	NA	NA	NA	NA
AZV13792.1|1421908_1423342_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AZV13793.1|1423559_1424186_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AZV13794.1|1424281_1425568_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
AZV13795.1|1425666_1426368_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
AZV13796.1|1426364_1427276_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
AZV13797.1|1427403_1427763_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AZV13798.1|1427772_1429236_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
>prophage 4
CP034760	Klebsiella pneumoniae strain NB5306 chromosome, complete genome	5261911	1738108	1745013	5261911		Planktothrix_phage(33.33%)	6	NA	NA
AZV14067.1|1738108_1738972_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AZV14068.1|1738982_1739756_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AZV17333.1|1739996_1740890_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AZV14069.1|1741135_1742497_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AZV14070.1|1742815_1743538_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AZV14071.1|1743534_1745013_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 5
CP034760	Klebsiella pneumoniae strain NB5306 chromosome, complete genome	5261911	1784190	1800038	5261911		Enterobacteria_phage(33.33%)	15	NA	NA
AZV14097.1|1784190_1785597_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AZV14098.1|1785820_1786885_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.1e-106
AZV14099.1|1786911_1787781_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
AZV14100.1|1787812_1788703_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AZV14101.1|1788717_1789272_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.1e-51
AZV14102.1|1789451_1790618_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
AZV14103.1|1791654_1792659_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	8.9e-31
AZV14104.1|1792614_1792896_+	hypothetical protein	NA	NA	NA	NA	NA
AZV14105.1|1793499_1794564_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.3	1.2e-105
AZV14106.1|1794577_1795447_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
AZV14107.1|1795478_1796369_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AZV14108.1|1796383_1796938_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.1e-51
AZV14109.1|1797024_1797855_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZV14110.1|1797883_1798717_+	ABC transporter permease	NA	NA	NA	NA	NA
AZV14111.1|1798706_1800038_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	6.9e-15
>prophage 6
CP034760	Klebsiella pneumoniae strain NB5306 chromosome, complete genome	5261911	2682952	2693839	5261911		Escherichia_phage(87.5%)	9	NA	NA
AZV14925.1|2682952_2686060_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AZV14926.1|2686114_2687380_+	MFS transporter	NA	NA	NA	NA	NA
AZV14927.1|2687410_2688499_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AZV14928.1|2688585_2688846_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AZV14929.1|2689143_2690004_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AZV14930.1|2690024_2690786_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AZV14931.1|2691046_2691949_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
AZV14932.1|2691960_2693226_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
AZV14933.1|2693218_2693839_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
CP034760	Klebsiella pneumoniae strain NB5306 chromosome, complete genome	5261911	2924523	2942027	5261911	lysis	Klebsiella_phage(64.0%)	29	NA	NA
AZV15138.1|2924523_2924781_-	Rz1 lytic protein	NA	S5FXQ4	Shigella_phage	70.9	2.3e-23
AZV15139.1|2924665_2925055_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
AZV15140.1|2925051_2925582_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AZV15141.1|2925584_2925833_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AZV15142.1|2926238_2927021_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AZV15143.1|2927017_2927494_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AZV15144.1|2927490_2928453_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AZV15145.1|2928454_2930113_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
AZV15146.1|2930421_2930715_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AZV15147.1|2930689_2930911_-	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AZV15148.1|2931008_2931677_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AZV15149.1|2931847_2932162_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AZV15150.1|2932154_2932343_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AZV15151.1|2932512_2932878_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
AZV15152.1|2932870_2933125_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
AZV15153.1|2933096_2933315_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
AZV15154.1|2933311_2933737_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AZV15155.1|2933733_2933928_+	hypothetical protein	NA	NA	NA	NA	NA
AZV15156.1|2933924_2934752_+	SPFH/Band 7/PHB domain protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AZV17401.1|2934856_2935375_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AZV15157.1|2935380_2936091_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
AZV15158.1|2936080_2936305_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AZV15159.1|2936301_2936514_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
AZV15160.1|2936510_2936990_+	hypothetical protein	NA	NA	NA	NA	NA
AZV15161.1|2937168_2937411_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
AZV15162.1|2937391_2938573_-	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AZV15163.1|2938769_2939318_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
AZV15164.1|2939516_2941049_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
AZV15165.1|2941265_2942027_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
CP034760	Klebsiella pneumoniae strain NB5306 chromosome, complete genome	5261911	3357184	3453949	5261911	lysis,tRNA,protease,plate,capsid,tail,head,portal,integrase,terminase	Salmonella_phage(55.0%)	100	3412710:3412728	3454024:3454042
AZV15545.1|3357184_3358477_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AZV15546.1|3358567_3359911_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AZV15547.1|3359919_3360531_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AZV15548.1|3360653_3364907_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AZV15549.1|3365042_3365537_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
AZV15550.1|3366042_3367038_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
AZV15551.1|3367152_3368919_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AZV15552.1|3368919_3370641_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AZV15553.1|3370685_3371387_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZV15554.1|3371740_3371959_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZV15555.1|3372079_3374359_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AZV15556.1|3374389_3374707_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AZV15557.1|3375032_3375254_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AZV15558.1|3375330_3377271_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AZV15559.1|3377267_3378383_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AZV15560.1|3378529_3380188_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AZV15561.1|3380607_3381303_+	aquaporin Z	NA	NA	NA	NA	NA
AZV15562.1|3381418_3382318_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AZV15563.1|3382461_3384114_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AZV15564.1|3384124_3385093_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AZV15565.1|3385043_3385247_+	hypothetical protein	NA	NA	NA	NA	NA
AZV15566.1|3385304_3385739_-	DoxX family protein	NA	NA	NA	NA	NA
AZV15567.1|3385890_3387609_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AZV15568.1|3387647_3388649_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AZV15569.1|3388659_3390102_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZV15570.1|3390189_3391203_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZV15571.1|3391199_3392030_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AZV15572.1|3392061_3393201_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AZV15573.1|3393253_3393433_+	hypothetical protein	NA	NA	NA	NA	NA
AZV15574.1|3394078_3394594_+	lipoprotein	NA	NA	NA	NA	NA
AZV15575.1|3394820_3395549_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AZV15576.1|3395569_3396301_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZV15577.1|3396307_3397024_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AZV15578.1|3397023_3397692_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AZV15579.1|3397875_3398607_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZV15580.1|3398649_3400122_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AZV15581.1|3400118_3400835_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AZV15582.1|3400913_3402041_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AZV15583.1|3402082_3402571_-	DUF2593 family protein	NA	NA	NA	NA	NA
AZV15584.1|3402628_3403474_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AZV15585.1|3403470_3404424_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AZV17424.1|3404434_3405568_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AZV15586.1|3405731_3406844_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AZV15587.1|3407192_3407672_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AZV15588.1|3407760_3408663_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AZV15589.1|3409484_3409772_-	DUF1418 family protein	NA	NA	NA	NA	NA
AZV15590.1|3409974_3410238_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AZV15591.1|3410244_3410628_-	hypothetical protein	NA	NA	NA	NA	NA
AZV15592.1|3410894_3412580_+	transporter	NA	NA	NA	NA	NA
3412710:3412728	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
AZV15593.1|3412799_3413018_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AZV15594.1|3413109_3414210_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AZV15595.1|3414206_3414692_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AZV15596.1|3414688_3417316_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AZV15597.1|3417308_3417428_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AZV15598.1|3417442_3417742_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
AZV15599.1|3417794_3418310_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AZV15600.1|3418319_3419492_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AZV15601.1|3419630_3420707_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AZV15602.1|3420736_3420940_-	hypothetical protein	NA	NA	NA	NA	NA
AZV15603.1|3420936_3421668_-	hypothetical protein	NA	NA	NA	NA	NA
AZV15604.1|3421671_3424623_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AZV15605.1|3424624_3425224_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AZV15606.1|3425216_3426125_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AZV15607.1|3426111_3426474_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
AZV15608.1|3426470_3427043_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AZV15609.1|3427137_3427830_+	hypothetical protein	NA	NA	NA	NA	NA
AZV15610.1|3427826_3428273_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AZV15611.1|3428265_3428697_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AZV15612.1|3428792_3429221_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AZV15613.1|3429217_3429601_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AZV15614.1|3429605_3430115_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AZV15615.1|3430095_3430311_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
AZV15616.1|3430314_3430518_-|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AZV15617.1|3430517_3430982_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AZV15618.1|3431077_3431728_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AZV15619.1|3431731_3432790_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AZV15620.1|3432806_3433640_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AZV15621.1|3433782_3435549_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AZV15622.1|3435548_3436568_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.9	4.4e-171
AZV15623.1|3436629_3438372_-	hypothetical protein	NA	NA	NA	NA	NA
AZV15624.1|3438647_3439325_-	hypothetical protein	NA	NA	NA	NA	NA
AZV15625.1|3439439_3439745_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AZV17426.1|3439683_3439872_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AZV17425.1|3439972_3441457_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AZV15626.1|3441456_3441708_-	hypothetical protein	NA	NA	NA	NA	NA
AZV15627.1|3441935_3444350_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AZV15628.1|3444346_3445204_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
AZV15629.1|3445200_3445428_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AZV15630.1|3445427_3445661_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AZV15631.1|3445728_3446070_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AZV15632.1|3446033_3446234_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	95.5	1.0e-31
AZV15633.1|3446241_3446751_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AZV15634.1|3446783_3447005_-	regulator	NA	NA	NA	NA	NA
AZV17427.1|3447150_3448029_+	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
AZV15635.1|3448040_3448985_+	hypothetical protein	NA	NA	NA	NA	NA
AZV17428.1|3449083_3450568_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AZV15636.1|3450567_3450819_-	hypothetical protein	NA	NA	NA	NA	NA
AZV17429.1|3450993_3452478_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AZV15637.1|3452477_3452729_-	hypothetical protein	NA	NA	NA	NA	NA
AZV15638.1|3452896_3453949_+|integrase	site-specific integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3454024:3454042	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 9
CP034760	Klebsiella pneumoniae strain NB5306 chromosome, complete genome	5261911	3899059	3944334	5261911	coat,lysis,tRNA,head,integrase,terminase	Escherichia_phage(26.42%)	64	3892272:3892318	3941406:3941452
3892272:3892318	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AZV16024.1|3899059_3901537_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
AZV16025.1|3901523_3901919_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
AZV16026.1|3901915_3902386_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
AZV17452.1|3902385_3902805_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
AZV16027.1|3902904_3906351_-	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
AZV16028.1|3906443_3906947_-	hypothetical protein	NA	NA	NA	NA	NA
AZV16029.1|3907074_3907860_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
AZV16030.1|3907925_3908639_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
AZV16031.1|3908628_3908799_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
AZV16032.1|3908898_3909258_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
AZV17453.1|3909274_3909745_-	hypothetical protein	NA	NA	NA	NA	NA
AZV16033.1|3910038_3910293_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
AZV16034.1|3910295_3911051_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
AZV16035.1|3911226_3911904_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
AZV16036.1|3911956_3912709_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
AZV16037.1|3912777_3913170_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
AZV16038.1|3913166_3913592_-	HK97 gp10 family phage protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
AZV16039.1|3913594_3913957_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
AZV16040.1|3913956_3914130_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
AZV16041.1|3914129_3914510_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
AZV16042.1|3914512_3914752_-	hypothetical protein	NA	NA	NA	NA	NA
AZV16043.1|3914762_3915857_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	62.8	1.7e-123
AZV16044.1|3915868_3916297_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
AZV16045.1|3916300_3917686_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
AZV16046.1|3917758_3918235_-	hypothetical protein	NA	NA	NA	NA	NA
AZV16047.1|3918276_3919281_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
AZV16048.1|3919255_3920677_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
AZV16049.1|3920689_3922162_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
AZV16050.1|3922161_3922764_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
AZV16051.1|3923134_3923464_+	hypothetical protein	NA	NA	NA	NA	NA
AZV16052.1|3923569_3924034_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
AZV16053.1|3924030_3924561_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
AZV16054.1|3924563_3924812_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AZV16055.1|3925721_3926411_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
AZV16056.1|3926407_3926938_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
AZV16057.1|3926930_3927068_-	YlcG family protein	NA	NA	NA	NA	NA
AZV16058.1|3927064_3927700_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
AZV16059.1|3927692_3927863_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
AZV16060.1|3927862_3928318_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
AZV17454.1|3928570_3928819_-	hypothetical protein	NA	NA	NA	NA	NA
AZV16061.1|3928818_3929466_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
AZV16062.1|3929638_3930481_-	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
AZV16063.1|3930587_3931094_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
AZV16064.1|3931090_3931384_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
AZV16065.1|3931383_3932814_-	helicase DnaB	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
AZV16066.1|3932803_3933703_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
AZV16067.1|3933927_3934149_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AZV16068.1|3934189_3934423_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
AZV16069.1|3934550_3935240_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
AZV16070.1|3935590_3935806_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
AZV16071.1|3935905_3936100_+	hypothetical protein	NA	NA	NA	NA	NA
AZV16072.1|3936188_3936473_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
AZV16073.1|3936488_3937334_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
AZV16074.1|3937330_3938011_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
AZV16075.1|3938007_3938166_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
AZV16076.1|3938162_3938819_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
AZV16077.1|3938815_3939583_+	dcm methylase	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
AZV16078.1|3939579_3939798_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
AZV16079.1|3939799_3940015_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
AZV16080.1|3940016_3940352_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZV17455.1|3940348_3941392_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.2	2.5e-177
AZV16081.1|3941822_3942689_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
3941406:3941452	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AZV16082.1|3942690_3942903_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AZV16083.1|3942948_3944334_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 10
CP034760	Klebsiella pneumoniae strain NB5306 chromosome, complete genome	5261911	4153888	4165542	5261911		Enterobacteria_phage(70.0%)	13	NA	NA
AZV16283.1|4153888_4154992_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
AZV16284.1|4155002_4156256_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AZV16285.1|4156608_4157799_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AZV16286.1|4157786_4158737_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
AZV16287.1|4158736_4159162_+	hypothetical protein	NA	NA	NA	NA	NA
AZV16288.1|4159730_4160297_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
AZV16289.1|4160314_4160560_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
AZV16290.1|4160556_4161294_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
AZV16291.1|4161835_4162102_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AZV16292.1|4162098_4162656_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AZV16293.1|4162652_4162880_+	hypothetical protein	NA	NA	NA	NA	NA
AZV16294.1|4162876_4163197_+	hypothetical protein	NA	NA	NA	NA	NA
AZV16295.1|4163208_4165542_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 1
CP034761	Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence	81092	1768	56223	81092	transposase,integrase	Escherichia_phage(37.5%)	59	NA	NA
AZV17509.1|1768_2968_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZV17510.1|2977_3166_-	hypothetical protein	NA	NA	NA	NA	NA
AZV17511.1|3717_3906_-	hypothetical protein	NA	NA	NA	NA	NA
AZV17512.1|4368_4626_+	hypothetical protein	NA	NA	NA	NA	NA
AZV17513.1|4683_5460_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AZV17514.1|5456_6200_-	hypothetical protein	NA	NA	NA	NA	NA
AZV17515.1|6250_6601_-	hypothetical protein	NA	NA	NA	NA	NA
AZV17584.1|7152_8241_+	transcriptional regulator	NA	NA	NA	NA	NA
AZV17516.1|8242_10468_+	phage T7 exclusion protein	NA	NA	NA	NA	NA
AZV17517.1|10517_11417_-	hypothetical protein	NA	NA	NA	NA	NA
AZV17518.1|11406_11697_-	hypothetical protein	NA	NA	NA	NA	NA
AZV17519.1|11877_12051_+	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
AZV17520.1|11992_12223_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AZV17521.1|12219_12636_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AZV17522.1|12797_14936_-	AAA family ATPase	NA	NA	NA	NA	NA
AZV17523.1|15289_15547_+	hypothetical protein	NA	NA	NA	NA	NA
AZV17524.1|15546_16137_+	hypothetical protein	NA	NA	NA	NA	NA
AZV17525.1|16399_17956_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
AZV17526.1|18147_18765_+	proQ/FINO family protein	NA	NA	NA	NA	NA
AZV17527.1|19057_20095_-	permease	NA	NA	NA	NA	NA
AZV17528.1|20199_20523_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZV17529.1|20721_21426_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	4.9e-137
AZV17585.1|21455_22160_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
AZV17530.1|22204_23455_+	hypothetical protein	NA	NA	NA	NA	NA
AZV17531.1|23554_23794_+	hypothetical protein	NA	NA	NA	NA	NA
AZV17532.1|23770_24367_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.7	7.1e-36
AZV17533.1|25404_25989_+	mobilization protein MobX	NA	NA	NA	NA	NA
AZV17534.1|26031_28668_-	restriction endonuclease	NA	NA	NA	NA	NA
AZV17535.1|28672_30721_-	site-specific DNA-methyltransferase	NA	A0A1B0XWD0	Campylobacter_phage	37.8	9.5e-64
AZV17536.1|30969_31173_-	hypothetical protein	NA	NA	NA	NA	NA
AZV17537.1|31215_31623_-	hypothetical protein	NA	NA	NA	NA	NA
AZV17538.1|31694_32237_-	hypothetical protein	NA	NA	NA	NA	NA
AZV17539.1|32220_32670_-	hypothetical protein	NA	NA	NA	NA	NA
AZV17540.1|32680_33220_-	hypothetical protein	NA	NA	NA	NA	NA
AZV17541.1|33867_34317_-	DNA-binding protein	NA	NA	NA	NA	NA
AZV17542.1|34627_35332_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZV17543.1|36383_36860_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AZV17544.1|36906_37782_-	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
AZV17545.1|38203_38908_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZV17546.1|40479_40659_+	hypothetical protein	NA	NA	NA	NA	NA
AZV17547.1|40774_41419_-	resolvase	NA	A0A1V0E035	Clostridioides_phage	28.3	9.8e-07
AZV17548.1|41713_42334_+	chromosome partitioning protein ParA	NA	A2I303	Vibrio_virus	33.8	6.3e-19
AZV17549.1|42385_42616_+	DNA partition complex ParG	NA	NA	NA	NA	NA
AZV17550.1|43039_44104_+	P-loop NTPase	NA	Q7M293	Enterobacteria_phage	30.4	6.3e-27
AZV17551.1|44237_44417_+	hypothetical protein	NA	NA	NA	NA	NA
AZV17586.1|44641_44995_-	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
AZV17552.1|45131_45578_-	hypothetical protein	NA	NA	NA	NA	NA
AZV17553.1|45581_46424_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
AZV17554.1|46444_47284_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
AZV17555.1|47222_47453_+	hypothetical protein	NA	NA	NA	NA	NA
AZV17556.1|48518_48770_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AZV17557.1|48759_49041_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	2.9e-24
AZV17587.1|49279_49468_-	hypothetical protein	NA	A0A077SL39	Escherichia_phage	96.7	8.8e-09
AZV17558.1|49537_50737_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZV17559.1|50746_50935_-	hypothetical protein	NA	NA	NA	NA	NA
AZV17560.1|52513_53308_+	aminoglycoside O-phosphotransferase APH(3')-IIa	NA	Q75ZG1	Hepacivirus	100.0	9.5e-153
AZV17561.1|53614_54319_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZV17562.1|54637_55393_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
AZV17563.1|55518_56223_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
