The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034738	Escherichia coli strain L65 chromosome, complete genome	4776769	334752	378491	4776769	plate,lysis,tRNA,capsid,integrase,terminase,tail,holin,protease,transposase,head,portal	Shigella_phage(44.9%)	61	325811:325826	343100:343115
325811:325826	attL	TGGCAGCATCACCAGC	NA	NA	NA	NA
AZU83412.1|334752_335859_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AZU83413.1|335912_336374_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AZU83414.1|336383_337037_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AZU83415.1|337208_338459_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
AZU83416.1|338571_340338_+	hypothetical protein	NA	NA	NA	NA	NA
AZU83417.1|340407_341268_+	DNA adenine methylase	NA	NA	NA	NA	NA
AZU83418.1|341257_342367_-|integrase	integrase	integrase	O21925	Phage_21	61.5	7.6e-124
AZU83419.1|343145_343391_-	excisionase	NA	NA	NA	NA	NA
343100:343115	attR	TGGCAGCATCACCAGC	NA	NA	NA	NA
AZU83420.1|343446_343983_-	HD family hydrolase	NA	A5LH62	Enterobacteria_phage	94.3	1.5e-93
AZU83421.1|344038_344260_-	hypothetical protein	NA	S5FNS4	Shigella_phage	95.9	2.4e-37
AZU83422.1|344624_345119_+	hypothetical protein	NA	NA	NA	NA	NA
AZU83423.1|345461_346136_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
AZU83424.1|346226_346427_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AZU83425.1|346470_347028_+	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
AZU83426.1|347203_347383_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AZU83427.1|347372_348314_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	3.6e-151
AZU83428.1|348805_349129_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	3.2e-51
AZU83429.1|349125_349515_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	1.3e-67
AZU83430.1|349534_350332_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
AZU83431.1|350339_351329_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	2.1e-194
AZU83432.1|351346_351709_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	95.0	2.5e-60
AZU83433.1|351759_352506_-	hypothetical protein	NA	NA	NA	NA	NA
AZU83434.1|352772_353108_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
AZU83435.1|353111_353588_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	94.3	6.2e-83
AZU83436.1|353584_354028_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	94.6	8.6e-71
AZU83437.1|354066_354441_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	97.6	4.3e-63
AZU83438.1|354558_354762_+	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.9	1.7e-13
AZU83439.1|354827_355178_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	3.6e-64
AZU83440.1|355303_355798_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	4.3e-87
AZU87349.1|356031_357528_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.7e-299
AZU83441.1|357539_357722_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
AZU83442.1|357721_358963_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.3e-241
AZU83443.1|358940_359591_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
AZU83444.1|359605_360811_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.3	4.5e-223
AZU83445.1|360860_361061_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
AZU83446.1|361063_361387_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
AZU83447.1|361383_361794_+|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	94.1	2.3e-70
AZU83448.1|361768_362275_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	2.9e-83
AZU83449.1|362271_362832_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	5.2e-105
AZU83450.1|362840_363011_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
AZU83451.1|362994_364491_+|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.4	4.2e-271
AZU83452.1|364490_364847_+|tail	phage tail protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
AZU83453.1|364846_365116_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
AZU83454.1|365082_365265_+	hypothetical protein	NA	NA	NA	NA	NA
AZU83455.1|365257_367090_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.4	2.0e-302
AZU83456.1|367181_367712_+	hypothetical protein	NA	NA	NA	NA	NA
AZU83457.1|367747_367945_+	hypothetical protein	NA	NA	NA	NA	NA
AZU83458.1|367901_368360_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	2.5e-12
AZU83459.1|368481_369810_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	5.5e-246
AZU83460.1|369806_370886_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	6.9e-207
AZU83461.1|370885_371434_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	5.1e-97
AZU87350.1|371433_371859_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	1.5e-80
AZU83462.1|371845_372904_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	1.4e-199
AZU83463.1|372894_373479_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.0	1.6e-112
AZU83464.1|373482_374121_+	hypothetical protein	NA	U5P0I1	Shigella_phage	69.5	4.4e-52
AZU83465.1|374122_374560_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.9	7.2e-46
AZU83466.1|374531_374927_-|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
AZU87351.1|374935_375340_-|tail	phage tail protein	tail	M1FN94	Enterobacteria_phage	42.3	1.2e-15
AZU83467.1|375333_375561_+	DNA invertase	NA	A0A1S6L009	Salmonella_phage	81.2	1.9e-13
AZU83468.1|375594_377484_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AZU83469.1|378299_378491_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	1.1e-22
>prophage 2
CP034738	Escherichia coli strain L65 chromosome, complete genome	4776769	780987	819126	4776769	terminase,tail,holin,capsid,head,portal	Enterobacteria_phage(50.0%)	47	NA	NA
AZU83816.1|780987_782448_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
AZU83817.1|782536_783820_-	MFS transporter	NA	NA	NA	NA	NA
AZU83818.1|784422_784536_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
AZU83819.1|784604_784838_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AZU83820.1|785154_785745_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
AZU83821.1|785842_786418_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	5.0e-103
AZU83822.1|786417_789768_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	2.4e-11
AZU83823.1|789832_790432_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	9.4e-105
AZU83824.1|790499_793979_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
AZU83825.1|794039_794642_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	5.6e-89
AZU83826.1|794578_795322_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	4.5e-149
AZU83827.1|795327_796026_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
AZU83828.1|796025_796355_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	4.7e-58
AZU83829.1|796351_798931_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	98.3	0.0e+00
AZU83830.1|798923_799358_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AZU83831.1|799339_799762_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	5.3e-70
AZU83832.1|799777_800518_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	3.0e-129
AZU83833.1|800525_800921_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AZU83834.1|800917_801496_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
AZU83835.1|801507_801861_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
AZU83836.1|801872_802268_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.2e-57
AZU83837.1|802309_803335_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
AZU83838.1|803390_803723_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
AZU83839.1|803732_805052_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.6e-232
AZU83840.1|805032_806634_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	2.2e-310
AZU83841.1|806630_806837_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AZU83842.1|806833_808759_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
AZU83843.1|808733_809279_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
AZU83844.1|809668_809902_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AZU83845.1|809959_810370_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AZU87369.1|810521_810695_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AZU87370.1|810866_811022_-	hypothetical protein	NA	NA	NA	NA	NA
AZU87371.1|811101_811167_-	hypothetical protein	NA	NA	NA	NA	NA
AZU87372.1|811169_811358_-	cold-shock protein	NA	NA	NA	NA	NA
AZU83846.1|811368_811581_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AZU83847.1|811944_812442_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AZU83848.1|812438_812972_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AZU83849.1|812968_813280_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	61.6	1.1e-24
AZU83850.1|813284_813500_-|holin	holin	holin	A5LH82	Enterobacteria_phage	94.4	2.9e-32
AZU83851.1|813690_814404_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZU83852.1|814810_815770_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AZU83853.1|815962_816487_+	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
AZU83854.1|816642_817020_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
AZU83855.1|817037_818087_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	2.3e-114
AZU83856.1|818088_818367_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
AZU87373.1|818433_818685_-	hypothetical protein	NA	NA	NA	NA	NA
AZU83857.1|818913_819126_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
>prophage 3
CP034738	Escherichia coli strain L65 chromosome, complete genome	4776769	824859	839028	4776769		Salmonella_phage(22.22%)	18	NA	NA
AZU83865.1|824859_825267_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	3.3e-24
AZU83866.1|825459_825612_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
AZU83867.1|825623_825989_+	hypothetical protein	NA	NA	NA	NA	NA
AZU83868.1|825957_826245_-	hypothetical protein	NA	NA	NA	NA	NA
AZU83869.1|826660_826849_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AZU83870.1|826845_827037_+	DUF1482 family protein	NA	NA	NA	NA	NA
AZU83871.1|827130_829602_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AZU87374.1|829689_829926_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
AZU83872.1|829960_831241_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	1.1e-155
AZU83873.1|831260_831371_-	transporter	NA	NA	NA	NA	NA
AZU83874.1|831428_832448_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
AZU83875.1|832459_833674_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AZU83876.1|833879_834206_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AZU83877.1|834340_834682_+	DUF1283 family protein	NA	NA	NA	NA	NA
AZU83878.1|834716_835277_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AZU83879.1|835279_835990_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AZU87375.1|836097_836403_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AZU83880.1|836601_839028_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	1.0e-213
>prophage 4
CP034738	Escherichia coli strain L65 chromosome, complete genome	4776769	1278904	1286439	4776769		Enterobacteria_phage(42.86%)	7	NA	NA
AZU84286.1|1278904_1279459_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.7	3.8e-52
AZU84287.1|1279463_1280342_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.9e-106
AZU84288.1|1280399_1281299_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	5.7e-29
AZU84289.1|1281298_1282384_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.4e-101
AZU84290.1|1282755_1283649_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AZU84291.1|1283891_1284887_-	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
AZU84292.1|1285044_1286439_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	8.3e-19
>prophage 5
CP034738	Escherichia coli strain L65 chromosome, complete genome	4776769	1333282	1397722	4776769	lysis,tRNA,integrase,terminase,tail,portal,holin,capsid,head,plate	Escherichia_phage(40.91%)	73	1338340:1338367	1370444:1370471
AZU84324.1|1333282_1334686_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
AZU84325.1|1334682_1335405_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AZU84326.1|1335595_1335928_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AZU84327.1|1336136_1336433_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AZU84328.1|1336434_1336731_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AZU84329.1|1336833_1338195_+	U32 family peptidase	NA	Q6DW11	Phage_TP	100.0	1.1e-217
1338340:1338367	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
AZU84330.1|1338468_1338723_-	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AZU84331.1|1338768_1339932_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	2.8e-206
AZU84332.1|1339931_1340411_-|tail	phage tail protein	tail	M1TAU1	Escherichia_phage	99.4	1.1e-84
AZU84333.1|1340425_1342873_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	94.5	0.0e+00
AZU87403.1|1342865_1342985_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AZU84334.1|1343017_1343293_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AZU84335.1|1343349_1343868_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AZU84336.1|1343880_1345071_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	8.1e-225
AZU84337.1|1345414_1346869_-	hypothetical protein	NA	NA	NA	NA	NA
AZU84338.1|1347305_1347833_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	91.4	1.2e-87
AZU84339.1|1347836_1349966_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	56.0	1.1e-142
AZU84340.1|1349976_1350507_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
AZU84341.1|1350499_1351408_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
AZU84342.1|1351412_1351760_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	1.1e-57
AZU84343.1|1351756_1352392_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.2	2.7e-110
AZU84344.1|1352458_1352911_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
AZU84345.1|1352903_1353371_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	2.5e-81
AZU87404.1|1353333_1353507_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	1.2e-23
AZU84346.1|1353478_1353904_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	1.4e-65
AZU84347.1|1353891_1354317_-	protein lysA	NA	U5N096	Enterobacteria_phage	91.5	2.8e-55
AZU84348.1|1354331_1354829_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AZU84349.1|1354828_1355110_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AZU84350.1|1355113_1355317_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AZU84351.1|1355316_1355826_-|head	head completion/stabilization protein	head	A0A0F7L9Y3	Escherichia_phage	100.0	1.9e-90
AZU84352.1|1355925_1356669_-|terminase	terminase	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
AZU84353.1|1356672_1357746_-|capsid	phage major capsid protein, P2 family	capsid	Q778Z0	Enterobacteria_phage	98.6	1.8e-199
AZU84354.1|1357804_1358659_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
AZU84355.1|1358832_1360605_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
AZU84356.1|1360604_1361639_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	1.6e-200
AZU84357.1|1362065_1364273_+	hypothetical protein	NA	NA	NA	NA	NA
AZU84358.1|1364503_1366792_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.0	0.0e+00
AZU84359.1|1366781_1367057_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AZU84360.1|1367053_1367278_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	97.3	2.5e-34
AZU84361.1|1367277_1367580_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
AZU84362.1|1367579_1367804_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AZU87405.1|1367867_1368368_-	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AZU84363.1|1368545_1368821_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
AZU84364.1|1368935_1369235_+	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
AZU84365.1|1369350_1370364_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
AZU84366.1|1370628_1370946_-	hypothetical protein	NA	NA	NA	NA	NA
1370444:1370471	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
AZU84367.1|1371360_1372260_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
AZU84368.1|1372341_1373121_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AZU84369.1|1373220_1374261_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AZU84370.1|1374308_1375664_-	galactitol permease IIC component	NA	NA	NA	NA	NA
AZU84371.1|1375667_1375952_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
AZU84372.1|1375982_1376435_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
AZU84373.1|1376444_1377707_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
AZU84374.1|1377735_1378590_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
AZU84375.1|1378592_1378826_-	hypothetical protein	NA	NA	NA	NA	NA
AZU84376.1|1378899_1379952_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AZU84377.1|1380208_1381486_+	nucleoside permease	NA	NA	NA	NA	NA
AZU84378.1|1381482_1382487_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.7	2.4e-12
AZU84379.1|1382483_1383449_+	sugar kinase	NA	NA	NA	NA	NA
AZU84380.1|1383422_1384169_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZU84381.1|1384220_1385039_-	glycosyl hydrolase 25 family protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
AZU84382.1|1385103_1385904_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AZU84383.1|1385900_1386689_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AZU84384.1|1386911_1387184_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
AZU84385.1|1387304_1388129_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AZU84386.1|1388347_1388686_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
AZU84387.1|1388767_1389802_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
AZU84388.1|1389817_1392298_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AZU84389.1|1392313_1392988_-	fimbrial assembly protein	NA	NA	NA	NA	NA
AZU84390.1|1393068_1393611_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AZU84391.1|1393903_1394185_-	DUF2574 family protein	NA	NA	NA	NA	NA
AZU84392.1|1394447_1395557_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AZU84393.1|1395688_1397722_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 6
CP034738	Escherichia coli strain L65 chromosome, complete genome	4776769	1410223	1419665	4776769		Enterobacteria_phage(85.71%)	10	NA	NA
AZU84398.1|1410223_1411360_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	1.0e-160
AZU84399.1|1411356_1413357_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
AZU87406.1|1413481_1413943_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AZU84400.1|1413983_1414454_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AZU84401.1|1414500_1415220_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AZU84402.1|1415216_1416902_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AZU84403.1|1417123_1417855_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AZU84404.1|1417914_1418022_+	protein YohO	NA	NA	NA	NA	NA
AZU84405.1|1418002_1418734_-	ABC transporter permease	NA	NA	NA	NA	NA
AZU84406.1|1418738_1419665_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
>prophage 7
CP034738	Escherichia coli strain L65 chromosome, complete genome	4776769	1619283	1694148	4776769	lysis,tRNA,integrase,terminase,protease,coat,holin,portal	Enterobacteria_phage(46.67%)	88	1616488:1616504	1669863:1669879
1616488:1616504	attL	ATGCGCGACATCAAAAA	NA	NA	NA	NA
AZU84574.1|1619283_1620096_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AZU84575.1|1620095_1621109_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZU84576.1|1621174_1622311_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
AZU84577.1|1622409_1623405_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AZU84578.1|1623401_1624580_-	MFS transporter	NA	NA	NA	NA	NA
AZU84579.1|1624863_1626084_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AZU84580.1|1626242_1628249_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AZU84581.1|1628369_1628648_-	YfcL family protein	NA	NA	NA	NA	NA
AZU84582.1|1628681_1629230_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AZU84583.1|1629229_1630039_-	hypothetical protein	NA	NA	NA	NA	NA
AZU84584.1|1630038_1630863_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AZU84585.1|1630866_1631952_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
AZU84586.1|1631986_1632919_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AZU84587.1|1633084_1633636_+	endonuclease SmrB	NA	NA	NA	NA	NA
AZU84588.1|1633708_1634560_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AZU84589.1|1634561_1635101_-	fimbrial protein	NA	NA	NA	NA	NA
AZU84590.1|1635097_1635586_-	fimbrial protein	NA	NA	NA	NA	NA
AZU84591.1|1635582_1636092_-	hypothetical protein	NA	NA	NA	NA	NA
AZU84592.1|1636107_1636860_-	fimbrial protein	NA	NA	NA	NA	NA
AZU84593.1|1636879_1639522_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AZU84594.1|1639603_1640167_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AZU84595.1|1640850_1641336_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AZU84596.1|1641538_1643683_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AZU84597.1|1643682_1644993_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AZU84598.1|1645172_1645457_-	DUF406 family protein	NA	NA	NA	NA	NA
AZU84599.1|1645828_1647169_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AZU84600.1|1647534_1648593_+	hypothetical protein	NA	NA	NA	NA	NA
AZU84601.1|1648774_1649530_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AZU84602.1|1649824_1650757_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
AZU87411.1|1651068_1652226_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.7	2.2e-222
AZU84603.1|1652379_1652742_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	3.0e-53
AZU84604.1|1652738_1653656_+	glycosyltransferase	NA	M1FQW5	Enterobacteria_phage	91.8	2.2e-161
AZU84605.1|1653652_1655125_+	hypothetical protein	NA	I1TED7	Salmonella_phage	27.6	5.8e-39
AZU84606.1|1657151_1657412_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	96.5	5.3e-36
AZU84607.1|1657501_1659499_-	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	96.5	0.0e+00
AZU84608.1|1659498_1660887_-	DNA transfer protein	NA	A0A220NR03	Salmonella_phage	66.9	5.5e-156
AZU84609.1|1660896_1661589_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.1	8.6e-110
AZU84610.1|1661591_1662047_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.7	1.5e-86
AZU84611.1|1662046_1662895_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.6	1.1e-103
AZU84612.1|1662894_1664313_-	hypothetical protein	NA	A0A2D1GM00	Escherichia_phage	99.2	2.3e-274
AZU84613.1|1664312_1664813_-	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	100.0	1.7e-91
AZU87412.1|1664790_1665369_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	62.4	3.6e-61
AZU84614.1|1665421_1666717_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.3	9.4e-243
AZU84615.1|1666716_1667628_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.7	3.7e-161
AZU84616.1|1667641_1669807_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.9	0.0e+00
AZU84617.1|1669807_1671307_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.8	1.4e-306
1669863:1669879	attR	TTTTTGATGTCGCGCAT	NA	NA	NA	NA
AZU84618.1|1671284_1671773_-	DNA-packaging protein	NA	A0A0M3ULC0	Salmonella_phage	100.0	5.0e-88
AZU84619.1|1671808_1672051_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AZU84620.1|1672198_1672414_-	DUF551 domain-containing protein	NA	A0A193GZ43	Enterobacter_phage	75.7	3.1e-26
AZU84621.1|1672713_1672866_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
AZU84622.1|1672853_1673291_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	97.9	1.1e-70
AZU84623.1|1673287_1673764_-	lysozyme	NA	A5VW81	Enterobacteria_phage	99.4	2.2e-88
AZU84624.1|1673747_1674071_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AZU84625.1|1674739_1675363_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
AZU84626.1|1675359_1676025_-	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	98.2	2.5e-130
AZU84627.1|1676002_1676209_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
AZU84628.1|1676205_1676817_-	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	7.9e-99
AZU84629.1|1676809_1676986_-	protein ninF	NA	G9L691	Escherichia_phage	98.2	1.3e-25
AZU84630.1|1676985_1677363_-	DUF2591 domain-containing protein	NA	A0A2D1GLI3	Escherichia_phage	98.4	8.7e-64
AZU84631.1|1677365_1677542_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
AZU87413.1|1677508_1677682_-	protein ninD	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
AZU84632.1|1677678_1678119_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
AZU87414.1|1678099_1678312_-	hypothetical protein	NA	A0A1V0E5J7	Salmonella_phage	100.0	2.8e-35
AZU84633.1|1678298_1678397_-	histone H1	NA	K7P6N8	Enterobacteria_phage	96.8	4.1e-10
AZU84634.1|1678393_1679770_-	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	2.2e-253
AZU84635.1|1679766_1680588_-	replication of DNA	NA	K7PJZ3	Enterobacterial_phage	99.3	4.4e-153
AZU84636.1|1680770_1681049_-	hypothetical protein	NA	Q8VNP9	Enterobacteria_phage	98.9	1.8e-42
AZU84637.1|1681157_1681352_-	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
AZU84638.1|1681458_1682175_+	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
AZU84639.1|1682195_1682564_+	hypothetical protein	NA	K7P6G1	Enterobacteria_phage	98.4	1.7e-56
AZU84640.1|1682931_1683231_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	96.0	5.0e-30
AZU84641.1|1683239_1683428_+	hypothetical protein	NA	K7PMF8	Enterobacteria_phage	90.9	1.1e-16
AZU84642.1|1683616_1684585_+	cell envelope biogenesis protein TolA	NA	K7P7J7	Enterobacteria_phage	100.0	2.0e-56
AZU84643.1|1684609_1684741_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
AZU84644.1|1684725_1684878_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
AZU84645.1|1685132_1685840_+	recombinase	NA	K7PKU3	Enterobacteria_phage	99.6	3.8e-137
AZU84646.1|1685840_1686314_+	single-stranded DNA-binding protein	NA	Q716E8	Shigella_phage	98.7	3.6e-59
AZU84647.1|1686323_1686803_+	hypothetical protein	NA	Q716E9	Shigella_phage	100.0	2.7e-94
AZU84648.1|1686816_1687110_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
AZU84649.1|1687120_1687285_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
AZU87415.1|1687281_1687812_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	58.0	4.1e-43
AZU84650.1|1687808_1688294_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.1	2.6e-68
AZU84651.1|1688290_1689127_+	DUF551 domain-containing protein	NA	K7P881	Enterobacteria_phage	61.2	2.7e-81
AZU84652.1|1689223_1689403_+	Eag protein	NA	A0A088CQ59	Enterobacteria_phage	100.0	1.5e-29
AZU84653.1|1689535_1689736_+	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AZU84654.1|1690265_1691513_-	MFS transporter	NA	NA	NA	NA	NA
AZU84655.1|1691584_1692499_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AZU84656.1|1692714_1694148_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 8
CP034738	Escherichia coli strain L65 chromosome, complete genome	4776769	1957724	1965488	4776769	transposase	Escherichia_phage(66.67%)	6	NA	NA
AZU84885.1|1957724_1958207_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AZU84886.1|1958949_1960179_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
AZU84887.1|1960217_1960634_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
AZU84888.1|1960705_1962454_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.7	0.0e+00
AZU84889.1|1962455_1964174_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	95.6	5.2e-305
AZU84890.1|1964325_1965488_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 9
CP034738	Escherichia coli strain L65 chromosome, complete genome	4776769	2038076	2045216	4776769		Escherichia_phage(83.33%)	6	NA	NA
AZU84961.1|2038076_2040638_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
AZU84962.1|2040743_2041400_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
AZU84963.1|2041450_2042218_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AZU84964.1|2042413_2043322_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	1.3e-118
AZU84965.1|2043318_2044581_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	6.3e-135
AZU84966.1|2044577_2045216_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 10
CP034738	Escherichia coli strain L65 chromosome, complete genome	4776769	3076201	3086166	4776769		Enterobacteria_phage(100.0%)	12	NA	NA
AZU85890.1|3076201_3077389_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	91.2	1.5e-207
AZU85891.1|3077435_3077963_-	hypothetical protein	NA	NA	NA	NA	NA
AZU85892.1|3077969_3079055_-	hypothetical protein	NA	NA	NA	NA	NA
AZU85893.1|3079351_3079924_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	95.2	7.2e-94
AZU85894.1|3079997_3080498_-	transactivation protein	NA	NA	NA	NA	NA
AZU85895.1|3080494_3081229_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	99.2	9.4e-131
AZU85896.1|3081780_3082047_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	97.7	1.4e-44
AZU85897.1|3082043_3082634_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
AZU85898.1|3082626_3082914_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
AZU85899.1|3082906_3083362_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
AZU85900.1|3083497_3083818_+	hypothetical protein	NA	NA	NA	NA	NA
AZU85901.1|3083832_3086166_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
>prophage 11
CP034738	Escherichia coli strain L65 chromosome, complete genome	4776769	4075477	4150049	4776769	transposase,tRNA,plate,protease	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
AZU86739.1|4075477_4076830_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
AZU86740.1|4076859_4079292_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AZU86741.1|4079413_4079899_+	molecular chaperone Skp	NA	NA	NA	NA	NA
AZU86742.1|4079902_4080928_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZU86743.1|4081032_4081488_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
AZU86744.1|4081491_4082280_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZU86745.1|4082279_4083428_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AZU86746.1|4083424_4084021_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
AZU86747.1|4084057_4087540_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
AZU86748.1|4087552_4088512_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AZU86749.1|4088610_4090752_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
AZU86750.1|4090808_4091198_+	VOC family protein	NA	NA	NA	NA	NA
AZU86751.1|4091262_4092561_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AZU86752.1|4092609_4092870_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
AZU86753.1|4092856_4093057_-	YaeP family protein	NA	NA	NA	NA	NA
AZU86754.1|4093222_4093768_+	YaeQ family protein	NA	NA	NA	NA	NA
AZU86755.1|4093764_4094187_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AZU86756.1|4094200_4094911_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
AZU86757.1|4094917_4095169_-	hypothetical protein	NA	NA	NA	NA	NA
AZU86758.1|4097223_4098942_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AZU86759.1|4099053_4099761_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AZU86760.1|4099757_4100162_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AZU86761.1|4100278_4101094_-	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AZU86762.1|4101133_4101787_-	methionine ABC transporter	NA	NA	NA	NA	NA
AZU86763.1|4101779_4102811_-	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
AZU86764.1|4102998_4103574_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AZU86765.1|4109474_4110278_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
AZU86766.1|4110274_4111189_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZU86767.1|4111429_4112230_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AZU86768.1|4112307_4113078_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZU86769.1|4113125_4114484_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AZU86770.1|4114555_4115311_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AZU86771.1|4115344_4116067_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZU86772.1|4116063_4116531_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AZU86773.1|4116595_4117327_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
AZU86774.1|4117866_4118652_+	aminopeptidase	NA	NA	NA	NA	NA
AZU86775.1|4118788_4119268_-	hypothetical protein	NA	NA	NA	NA	NA
AZU86776.1|4119277_4120192_-	hypothetical protein	NA	NA	NA	NA	NA
AZU86777.1|4120235_4120718_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AZU86778.1|4120741_4122094_-	hypothetical protein	NA	NA	NA	NA	NA
AZU87497.1|4122104_4125539_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AZU86779.1|4125647_4127063_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AZU86780.1|4127067_4127811_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AZU86781.1|4127807_4130567_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	9.4e-83
AZU86782.1|4130575_4131337_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AZU86783.1|4131341_4132673_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AZU86784.1|4132675_4133200_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AZU86785.1|4133196_4134477_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AZU86786.1|4134501_4135584_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AZU86787.1|4135547_4137398_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AZU86788.1|4137401_4137815_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AZU86789.1|4137821_4139297_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AZU86790.1|4139347_4139572_-	hypothetical protein	NA	NA	NA	NA	NA
AZU86791.1|4139606_4140107_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AZU86792.1|4140803_4141322_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AZU86793.1|4141531_4143673_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	3.7e-26
AZU86794.1|4143748_4148242_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	1.0e-22
AZU86795.1|4148243_4148501_+	hypothetical protein	NA	NA	NA	NA	NA
AZU86796.1|4148912_4150049_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 12
CP034738	Escherichia coli strain L65 chromosome, complete genome	4776769	4215993	4231684	4776769	integrase	Enterobacteria_phage(80.0%)	16	NA	NA
AZU86863.1|4215993_4217163_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	62.4	9.7e-146
AZU86864.1|4217164_4218868_+	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
AZU86865.1|4218864_4220487_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	23.8	3.1e-09
AZU86866.1|4220689_4221262_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
AZU86867.1|4221335_4221836_-	transactivation protein	NA	NA	NA	NA	NA
AZU86868.1|4221832_4222567_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.4	8.8e-129
AZU86869.1|4223119_4223386_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	1.4e-44
AZU86870.1|4223382_4223982_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.0	1.7e-50
AZU86871.1|4223974_4224262_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AZU86872.1|4224254_4224710_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	2.8e-64
AZU86873.1|4224845_4225166_+	hypothetical protein	NA	NA	NA	NA	NA
AZU86874.1|4225180_4227514_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
AZU86875.1|4227727_4227880_+|integrase	attP region and P4int integrase	integrase	NA	NA	NA	NA
AZU86876.1|4228130_4228541_-	transcriptional regulator	NA	NA	NA	NA	NA
AZU86877.1|4228519_4229476_-	XdhC family protein	NA	NA	NA	NA	NA
AZU86878.1|4229485_4231684_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	5.6e-38
>prophage 1
CP034739	Escherichia coli strain L65 plasmid pL65-2, complete sequence	145346	4603	78671	145346	integrase,transposase,protease,bacteriocin	Macacine_betaherpesvirus(26.67%)	53	41630:41647	83842:83859
AZU87521.1|4603_5575_+|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	32.1	1.1e-25
AZU87522.1|7929_8901_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
AZU87523.1|8900_10067_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
AZU87524.1|11782_12640_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AZU87525.1|12636_13494_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AZU87526.1|13490_14318_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
AZU87527.1|14317_15232_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZU87528.1|15354_15546_-	prephenate dehydratase	NA	NA	NA	NA	NA
AZU87529.1|17716_18929_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
AZU87530.1|19474_20452_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
AZU87531.1|20736_21477_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
AZU87532.1|21597_21786_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AZU87533.1|22159_23068_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
AZU87534.1|23130_24240_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AZU87535.1|24298_24583_+	hypothetical protein	NA	NA	NA	NA	NA
AZU87536.1|24672_25626_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
AZU87537.1|25729_26119_+	GlcNAc transferase	NA	NA	NA	NA	NA
AZU87538.1|26486_26750_-	hypothetical protein	NA	NA	NA	NA	NA
AZU87650.1|26899_27082_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU87539.1|29894_31082_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
AZU87540.1|31078_33019_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
AZU87541.1|33022_34393_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
AZU87542.1|35189_36131_-	hypothetical protein	NA	NA	NA	NA	NA
AZU87543.1|36140_36329_-	hypothetical protein	NA	NA	NA	NA	NA
AZU87544.1|38391_39585_-	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AZU87545.1|39999_40224_-	hypothetical protein	NA	NA	NA	NA	NA
41630:41647	attL	CAACTGCGCACGCGACAC	NA	NA	NA	NA
AZU87546.1|42670_42964_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AZU87547.1|43479_43662_-	hypothetical protein	NA	NA	NA	NA	NA
AZU87651.1|45648_45912_+	hypothetical protein	NA	NA	NA	NA	NA
AZU87548.1|46110_47226_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
AZU87549.1|47239_51025_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
AZU87550.1|51128_52358_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
AZU87551.1|52442_53399_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
AZU87552.1|53443_55621_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
AZU87553.1|56563_56767_-	hypothetical protein	NA	NA	NA	NA	NA
AZU87554.1|56744_56981_-	colicin V immunity protein	NA	NA	NA	NA	NA
AZU87555.1|57444_57726_-	hypothetical protein	NA	NA	NA	NA	NA
AZU87556.1|58083_58611_-	colicin B immunity protein	NA	NA	NA	NA	NA
AZU87557.1|58854_59670_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
AZU87652.1|59719_60073_-	colicin M immunity protein	NA	NA	NA	NA	NA
AZU87558.1|60250_61042_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
AZU87559.1|61038_61728_-	hypothetical protein	NA	NA	NA	NA	NA
AZU87560.1|61771_62122_-	hypothetical protein	NA	NA	NA	NA	NA
AZU87561.1|62653_66475_-	hypothetical protein	NA	NA	NA	NA	NA
AZU87562.1|66897_67245_-	hypothetical protein	NA	NA	NA	NA	NA
AZU87563.1|67546_68029_-	hypothetical protein	NA	NA	NA	NA	NA
AZU87564.1|68145_68994_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	39.0	5.0e-27
AZU87565.1|69039_69321_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AZU87566.1|71182_71575_+	cysteine hydrolase	NA	NA	NA	NA	NA
AZU87567.1|71712_72597_+	EamA family transporter	NA	NA	NA	NA	NA
AZU87568.1|72628_73828_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AZU87569.1|73906_74584_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU87570.1|75665_78671_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
83842:83859	attR	CAACTGCGCACGCGACAC	NA	NA	NA	NA
>prophage 1
CP034744	Escherichia coli strain L65 plasmid pL65-9, complete sequence	46161	0	3140	46161	transposase	Clostridium_phage(50.0%)	3	NA	NA
AZU87675.1|125_1346_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
AZU87676.1|1434_2097_-	resolvase	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
AZU87677.1|2477_3140_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
>prophage 2
CP034744	Escherichia coli strain L65 plasmid pL65-9, complete sequence	46161	7740	8256	46161		Tupanvirus(100.0%)	1	NA	NA
AZU87683.1|7740_8256_+	molecular chaperone DnaJ	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
>prophage 3
CP034744	Escherichia coli strain L65 plasmid pL65-9, complete sequence	46161	26887	31058	46161		Moraxella_phage(33.33%)	3	NA	NA
AZU87708.1|26887_27382_+	micrococcal nuclease	NA	A0A0R6PHV6	Moraxella_phage	37.3	8.0e-17
AZU87709.1|27464_28727_+	ATP-binding protein	NA	A0A1V0SKF8	Klosneuvirus	31.4	1.3e-07
AZU87710.1|28730_31058_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	8.6e-37
>prophage 4
CP034744	Escherichia coli strain L65 plasmid pL65-9, complete sequence	46161	36222	41586	46161	transposase	Bacillus_phage(33.33%)	3	NA	NA
AZU87719.1|36222_39240_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
AZU87720.1|39459_40461_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	2.6e-51
AZU87721.1|40569_41586_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 5
CP034744	Escherichia coli strain L65 plasmid pL65-9, complete sequence	46161	44848	45943	46161	transposase	Escherichia_phage(100.0%)	2	NA	NA
AZU87726.1|44848_45553_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AZU87727.1|45586_45943_-	sOS mutagenesis and repair protein UmuD	NA	A0A222YZE2	Escherichia_phage	46.6	5.5e-20
