The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022481	Ralstonia solanacearum strain HA4-1 chromosome, complete genome	3890347	383026	447777	3890347	protease,coat,transposase	Lake_Baikal_phage(25.0%)	58	NA	NA
AZU55072.1|383026_384013_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
AZU55073.1|384088_391309_+	hemolysin-type protein	NA	NA	NA	NA	NA
AZU55074.1|391958_392276_-	hypothetical protein	NA	NA	NA	NA	NA
AZU55075.1|392757_392970_-	hypothetical protein	NA	NA	NA	NA	NA
AZU57956.1|393068_393323_-	translation initiation factor 1	NA	NA	NA	NA	NA
AZU55076.1|393405_393636_-	isochorismatase	NA	NA	NA	NA	NA
AZU55077.1|394091_394256_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	57.1	3.2e-07
AZU55078.1|394302_395631_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AZU55079.1|396143_396470_+	hypothetical protein	NA	NA	NA	NA	NA
AZU57957.1|396563_396848_+	hypothetical protein	NA	NA	NA	NA	NA
AZU57958.1|396934_397309_+	hypothetical protein	NA	NA	NA	NA	NA
AZU55080.1|398187_398505_+	hypothetical protein	NA	NA	NA	NA	NA
AZU55081.1|398655_398952_+	hypothetical protein	NA	NA	NA	NA	NA
AZU55082.1|399048_399909_+	transglutaminase family protein	NA	NA	NA	NA	NA
AZU57959.1|399925_400186_-	hypothetical protein	NA	NA	NA	NA	NA
AZU55083.1|401532_402036_+|coat	spore coat protein	coat	NA	NA	NA	NA
AZU55084.1|402094_402598_+|coat	spore coat protein	coat	NA	NA	NA	NA
AZU55085.1|402716_403436_+	phytochrome sensor protein	NA	NA	NA	NA	NA
AZU55086.1|403485_405750_+	usher protein	NA	NA	NA	NA	NA
AZU55087.1|405746_406256_+	hypothetical protein	NA	NA	NA	NA	NA
AZU55088.1|406325_406868_+	hypothetical protein	NA	NA	NA	NA	NA
AZU55089.1|407473_408418_+	hydrogen peroxide-inducible genes activator	NA	A0A2P0ZL89	Lactobacillus_phage	23.9	4.0e-09
AZU55090.1|408636_408885_+	hypothetical protein	NA	NA	NA	NA	NA
AZU55091.1|408943_409186_+	hypothetical protein	NA	NA	NA	NA	NA
AZU55092.1|409345_409846_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	36.2	2.1e-20
AZU55093.1|409919_410795_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AZU55094.1|410791_411070_-	hypothetical protein	NA	NA	NA	NA	NA
AZU55095.1|411091_411916_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AZU55096.1|411950_412673_-	YggS family pyridoxal phosphate enzyme	NA	NA	NA	NA	NA
AZU55097.1|412797_413841_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AZU55098.1|413893_415033_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AZU55099.1|415227_415668_+	pilus assembly protein PilE	NA	NA	NA	NA	NA
AZU55100.1|415671_416160_+	general secretion pathway protein GspH	NA	NA	NA	NA	NA
AZU55101.1|416156_416747_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
AZU55102.1|416743_417772_+	pilus assembly protein PilW	NA	NA	NA	NA	NA
AZU55103.1|417775_418312_+	pilus assembly protein	NA	NA	NA	NA	NA
AZU55104.1|418343_421556_+	pilus assembly protein PilY	NA	NA	NA	NA	NA
AZU57960.1|421651_422149_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.2	5.5e-26
AZU55105.1|422165_422864_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
AZU55106.1|422906_423386_-	cupin	NA	NA	NA	NA	NA
AZU55107.1|423436_423832_-	glyoxalase	NA	NA	NA	NA	NA
AZU55108.1|423990_424713_-	LrgB family protein	NA	NA	NA	NA	NA
AZU55109.1|424709_425087_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
AZU55110.1|425138_426386_-	glycolate oxidase iron-sulfur subunit	NA	NA	NA	NA	NA
AZU55111.1|426395_427517_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
AZU55112.1|427527_429021_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AZU55113.1|429191_430082_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZU55114.1|430092_431511_-	2-hydroxy-acid oxidase	NA	NA	NA	NA	NA
AZU55115.1|431631_432189_+	ATP:cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
AZU55116.1|432262_433159_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AZU55117.1|433443_433779_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU55118.1|433902_434982_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	45.0	1.1e-76
AZU55119.1|435374_436835_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AZU55120.1|436862_437732_-	acyltransferase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	25.3	8.3e-09
AZU55121.1|437737_442015_-	TIGR02099 family protein	NA	NA	NA	NA	NA
AZU55122.1|442194_445062_+	bifunctional glutamine synthetase adenylyltransferase/deadenyltransferase	NA	NA	NA	NA	NA
AZU55123.1|445058_445679_+	rhombosortase	NA	NA	NA	NA	NA
AZU55124.1|445734_447777_-|protease	MprA protease, GlyGly-CTERM protein-sorting domain-containing form	protease	A0A1B0T6A2	Bacillus_phage	34.7	6.0e-10
>prophage 2
CP022481	Ralstonia solanacearum strain HA4-1 chromosome, complete genome	3890347	464804	474943	3890347		Hokovirus(14.29%)	9	NA	NA
AZU55141.1|464804_466766_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.8	1.4e-149
AZU55142.1|466900_468043_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.7	2.9e-22
AZU55143.1|468078_469959_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	37.4	7.9e-57
AZU55144.1|469914_470601_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.2	1.5e-13
AZU55145.1|470608_471316_-	ABC transporter permease	NA	NA	NA	NA	NA
AZU55146.1|471327_472152_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	31.3	2.4e-34
AZU55147.1|472208_472853_-	deoxynucleoside kinase	NA	M1IA15	Paramecium_bursaria_Chlorella_virus	27.8	2.2e-06
AZU55148.1|472886_473396_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AZU55149.1|473395_474943_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	33.6	3.6e-23
>prophage 3
CP022481	Ralstonia solanacearum strain HA4-1 chromosome, complete genome	3890347	1982114	2067923	3890347	head,holin,capsid,protease,tRNA,tail,portal,terminase,plate	Ralstonia_phage(44.44%)	83	NA	NA
AZU56331.1|1982114_1983512_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AZU56332.1|1983685_1984645_+	esterase	NA	H8ZJB8	Ostreococcus_tauri_virus	28.3	6.5e-07
AZU56333.1|1984718_1985387_-	peptidoglycan endopeptidase	NA	NA	NA	NA	NA
AZU56334.1|1985676_1987332_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	3.2e-17
AZU56335.1|1987328_1988453_-	ABC transporter permease	NA	NA	NA	NA	NA
AZU56336.1|1988459_1989515_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
AZU56337.1|1989533_1991411_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZU56338.1|1991677_1992472_+	enoyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
AZU56339.1|1992873_1994124_-	aspartate kinase	NA	NA	NA	NA	NA
AZU56340.1|1994252_1995680_-|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AZU56341.1|1995648_1996617_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AZU56342.1|1996703_1997579_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
AZU56343.1|1997563_1998961_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.0	3.0e-37
AZU56344.1|1999203_1999863_+	hypothetical protein	NA	NA	NA	NA	NA
AZU56345.1|1999916_2000489_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AZU58051.1|2000527_2001034_+	cyclophilin	NA	NA	NA	NA	NA
AZU56346.1|2001030_2001837_+	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AZU56347.1|2001858_2002605_-	serine acetyltransferase	NA	NA	NA	NA	NA
AZU56348.1|2002741_2003605_-	RNA methyltransferase	NA	NA	NA	NA	NA
AZU58052.1|2003718_2004531_+	inositol monophosphatase	NA	NA	NA	NA	NA
AZU56349.1|2004576_2005125_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZU56350.1|2005217_2005946_+	glutamine amidotransferase	NA	NA	NA	NA	NA
AZU56351.1|2005942_2006668_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AZU56352.1|2006676_2008479_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
AZU56353.1|2008554_2010426_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.3	6.1e-09
AZU56354.1|2010559_2011375_-	2,5-didehydrogluconate reductase B	NA	A0A1V0SDE7	Indivirus	33.1	1.0e-29
AZU56355.1|2011407_2012610_-	MFS transporter	NA	NA	NA	NA	NA
AZU56356.1|2012722_2013616_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZU56357.1|2014432_2014963_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56358.1|2015679_2018541_+	Rhs element Vgr protein	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.2	2.7e-40
AZU56359.1|2018551_2020558_+	phospholipase	NA	NA	NA	NA	NA
AZU58053.1|2020630_2021869_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AZU56360.1|2021890_2022181_+	PAAR domain-containing protein	NA	R4JMI1	Burkholderia_phage	35.6	4.1e-05
AZU56361.1|2022217_2022865_+	hypothetical protein	NA	NA	NA	NA	NA
AZU56362.1|2023310_2023649_+	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
AZU56363.1|2023670_2024750_-|portal	phage portal protein	portal	A0A077K9Q8	Ralstonia_phage	92.0	1.8e-194
AZU56364.1|2024746_2026528_-	oxidoreductase	NA	A0A077K8Q7	Ralstonia_phage	91.2	0.0e+00
AZU56365.1|2026664_2027507_+|capsid	capsid scaffolding protein	capsid	A4PE29	Ralstonia_virus	77.9	7.0e-122
AZU56366.1|2027545_2028598_+|capsid	phage major capsid protein, P2 family	capsid	A4PE30	Ralstonia_virus	74.0	4.0e-143
AZU56367.1|2028594_2029317_+|terminase	terminase	terminase	A4PE31	Ralstonia_virus	77.5	8.7e-97
AZU56368.1|2029366_2029894_+|head	head completion/stabilization protein	head	A0A077K9R2	Ralstonia_phage	84.0	9.9e-74
AZU56369.1|2029893_2030097_+|tail	phage tail protein	tail	A0A077K8R0	Ralstonia_phage	86.8	7.2e-25
AZU56370.1|2030112_2030520_+	hypothetical protein	NA	A0A077K9X1	Ralstonia_phage	91.1	3.4e-21
AZU56371.1|2030516_2030834_+|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	94.1	5.2e-46
AZU56372.1|2030830_2031634_+	peptidoglycan-binding protein	NA	A4PE36	Ralstonia_virus	84.2	3.2e-124
AZU56373.1|2031630_2032065_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	86.8	1.2e-69
AZU56374.1|2032061_2032532_+	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	81.6	6.1e-59
AZU56375.1|2033258_2033918_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56376.1|2035327_2035945_+|plate	phage baseplate assembly protein V	plate	A0A077K9S0	Ralstonia_phage	94.6	1.4e-108
AZU56377.1|2035941_2036289_+|plate	baseplate assembly protein	plate	A4PE42	Ralstonia_virus	98.3	1.9e-57
AZU58054.1|2037191_2037809_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	95.7	1.9e-100
AZU56378.1|2037813_2039478_+|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	98.0	0.0e+00
AZU56379.1|2039490_2040243_+|tail	phage tail protein	tail	A0A077K9S5	Ralstonia_phage	89.2	5.5e-118
AZU56380.1|2040239_2040704_+	hypothetical protein	NA	A0A077K8R9	Ralstonia_phage	91.6	2.4e-79
AZU56381.1|2040797_2041973_+|tail	phage tail protein	tail	A0A077K9Y4	Ralstonia_phage	94.6	5.8e-215
AZU56382.1|2042004_2042514_+|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	84.6	1.2e-81
AZU58055.1|2042589_2042916_+|tail	phage tail protein	tail	A4PE51	Ralstonia_virus	94.4	9.8e-48
AZU56383.1|2042912_2043014_+|tail	GpE family phage tail protein	tail	A0A077K821	Ralstonia_phage	93.9	2.7e-09
AZU56384.1|2043010_2045674_+|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	96.9	0.0e+00
AZU56385.1|2045676_2046099_+	oxidoreductase	NA	A4PE53	Ralstonia_virus	99.3	1.4e-73
AZU56386.1|2046095_2047223_+|tail	phage tail protein	tail	A4PE54	Ralstonia_virus	96.0	4.6e-201
AZU58056.1|2047333_2047528_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	69.2	1.6e-13
AZU56387.1|2047490_2048357_+	DNA cytosine methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	59.2	5.6e-50
AZU56388.1|2048505_2048712_-	hypothetical protein	NA	A0A077K8S5	Ralstonia_phage	87.9	1.6e-27
AZU56389.1|2048997_2049468_-	XRE family transcriptional regulator	NA	A0A077K9Z1	Ralstonia_phage	61.2	7.5e-41
AZU56390.1|2049812_2050061_+	transcriptional regulator	NA	A0A077K829	Ralstonia_phage	82.9	4.7e-34
AZU56391.1|2050178_2050733_+	transcriptional regulator	NA	A0A077K9T3	Ralstonia_phage	85.2	8.5e-84
AZU56392.1|2050919_2051156_+	hypothetical protein	NA	A4PE65	Ralstonia_virus	80.8	5.1e-30
AZU56393.1|2051148_2051358_+	hypothetical protein	NA	A4PE66	Ralstonia_virus	72.9	5.5e-20
AZU56394.1|2051772_2054457_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	92.8	0.0e+00
AZU56395.1|2054516_2054744_+	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	73.1	7.6e-23
AZU58057.1|2054744_2056028_-	alpha/beta hydrolase	NA	C7BGE7	Burkholderia_phage	55.9	4.0e-137
AZU58058.1|2056207_2058850_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.3	3.5e-26
AZU56396.1|2058849_2059914_+	hypothetical protein	NA	NA	NA	NA	NA
AZU56397.1|2059969_2060494_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AZU56398.1|2060505_2061735_+	cupin	NA	NA	NA	NA	NA
AZU56399.1|2061961_2062240_+	hypothetical protein	NA	NA	NA	NA	NA
AZU56400.1|2062377_2063163_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.5	1.0e-26
AZU56401.1|2063197_2064394_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AZU56402.1|2064434_2065319_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AZU56403.1|2065437_2066010_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZU56404.1|2066029_2067232_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AZU56405.1|2067245_2067923_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 4
CP022481	Ralstonia solanacearum strain HA4-1 chromosome, complete genome	3890347	2099145	2124191	3890347	integrase,transposase	Burkholderia_phage(33.33%)	22	2093139:2093154	2125009:2125024
2093139:2093154	attL	GACGCTGGCCGACCTG	NA	NA	NA	NA
AZU56434.1|2099145_2100132_+|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
AZU56435.1|2100635_2101430_+	hypothetical protein	NA	NA	NA	NA	NA
AZU56436.1|2101547_2102597_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	75.1	9.9e-150
AZU56437.1|2102738_2103839_+	hypothetical protein	NA	NA	NA	NA	NA
AZU56438.1|2103891_2104731_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56439.1|2104788_2105591_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AZU56440.1|2105850_2106618_-	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	54.2	2.3e-71
AZU56441.1|2106630_2108154_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	53.4	2.5e-149
AZU56442.1|2108199_2108577_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56443.1|2109199_2110186_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
AZU56444.1|2110348_2110711_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56445.1|2111083_2111272_+	hypothetical protein	NA	NA	NA	NA	NA
AZU56446.1|2112291_2113203_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56447.1|2113199_2113727_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56448.1|2114224_2115310_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56449.1|2115309_2116632_-	phosphohydrolase	NA	NA	NA	NA	NA
AZU56450.1|2117779_2118148_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56451.1|2118147_2119980_-	hypothetical protein	NA	A0A2H4J185	uncultured_Caudovirales_phage	27.1	1.6e-25
AZU56452.1|2120083_2120599_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56453.1|2120656_2121481_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AZU56454.1|2121471_2122758_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56455.1|2122754_2124191_-|integrase	integrase	integrase	NA	NA	NA	NA
2125009:2125024	attR	CAGGTCGGCCAGCGTC	NA	NA	NA	NA
>prophage 5
CP022481	Ralstonia solanacearum strain HA4-1 chromosome, complete genome	3890347	2306522	2314757	3890347		Planktothrix_phage(16.67%)	8	NA	NA
AZU56618.1|2306522_2307575_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.4	2.6e-33
AZU56619.1|2307731_2308655_-	deacetylase	NA	A0A2K9KZC4	Tupanvirus	35.9	9.3e-43
AZU56620.1|2308772_2309885_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AZU56621.1|2309964_2310867_-	cysteine synthase B	NA	A0A1X9I5K7	Streptococcus_phage	40.8	8.2e-52
AZU56622.1|2310970_2311288_-	competence protein ComE	NA	NA	NA	NA	NA
AZU56623.1|2311417_2312413_-	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	R9S880	Prochlorococcus_phage	32.3	4.1e-28
AZU56624.1|2312409_2313357_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.6	9.0e-17
AZU56625.1|2313383_2314757_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.9	1.9e-76
>prophage 6
CP022481	Ralstonia solanacearum strain HA4-1 chromosome, complete genome	3890347	2357637	2366650	3890347		Acidithiobacillus_phage(50.0%)	9	NA	NA
AZU56658.1|2357637_2358099_-	glycoside hydrolase	NA	K4I410	Acidithiobacillus_phage	80.3	4.8e-64
AZU56659.1|2358095_2358572_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	84.2	1.4e-71
AZU56660.1|2358568_2358859_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	48.8	2.4e-13
AZU56661.1|2358926_2359151_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56662.1|2359160_2360996_-	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	45.6	1.4e-106
AZU56663.1|2361000_2361399_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56664.1|2361395_2361878_-	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	44.0	1.1e-13
AZU56665.1|2361881_2363048_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56666.1|2363059_2366650_-	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.6	0.0e+00
>prophage 7
CP022481	Ralstonia solanacearum strain HA4-1 chromosome, complete genome	3890347	2371869	2395815	3890347	head,capsid,protease,portal,terminase,transposase	uncultured_Caudovirales_phage(42.11%)	30	NA	NA
AZU58074.1|2371869_2373135_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.3	1.1e-38
AZU56670.1|2373613_2374945_+	type III effector HopG1	NA	NA	NA	NA	NA
AZU56671.1|2375245_2376343_-	methyltransferase	NA	Q6J1P4	Burkholderia_virus	57.2	8.0e-102
AZU56672.1|2376350_2377292_-	hypothetical protein	NA	Q8W6P3	Burkholderia_virus	71.3	2.5e-128
AZU56673.1|2377973_2378261_+	DNA-binding protein	NA	NA	NA	NA	NA
AZU56674.1|2378303_2378948_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56675.1|2378922_2379144_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56676.1|2379140_2379530_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56677.1|2379538_2380312_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.6	4.0e-47
AZU56678.1|2380434_2380881_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56679.1|2380886_2381189_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56680.1|2381191_2382196_-|capsid	major capsid protein E	capsid	A0A1B2LRS0	Wolbachia_phage	66.9	1.6e-109
AZU56681.1|2382202_2382580_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	48.8	1.4e-24
AZU56682.1|2382589_2383849_-|protease	Clp protease ClpP	protease	K4HZZ6	Acidithiobacillus_phage	42.7	2.3e-60
AZU56683.1|2383860_2385429_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.1	1.9e-149
AZU56684.1|2385428_2385650_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	1.3e-11
AZU56685.1|2385650_2386043_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56686.1|2386053_2386563_-	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	44.4	4.8e-25
AZU58075.1|2386605_2388585_-|terminase	terminase	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	86.0	0.0e+00
AZU56687.1|2388587_2389124_-	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	82.0	3.2e-72
AZU56688.1|2389209_2389431_+	hypothetical protein	NA	NA	NA	NA	NA
AZU56689.1|2389566_2390046_+	hypothetical protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	59.0	9.4e-23
AZU56690.1|2390165_2390669_+	hypothetical protein	NA	K4HZZ2	Acidithiobacillus_phage	33.1	1.9e-13
AZU58076.1|2390796_2391147_+	hypothetical protein	NA	NA	NA	NA	NA
AZU56691.1|2391376_2391745_-	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	43.1	2.1e-14
AZU56692.1|2391905_2392286_+	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	48.3	3.5e-20
AZU58077.1|2392474_2392840_+	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	59.5	1.0e-32
AZU56693.1|2392977_2393220_+	hypothetical protein	NA	NA	NA	NA	NA
AZU56694.1|2393179_2394415_-	DNA methylase N-4	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	80.7	4.2e-192
AZU56695.1|2394411_2395815_-	DNA modification methylase	NA	K4I3Y2	Acidithiobacillus_phage	61.6	1.8e-162
>prophage 8
CP022481	Ralstonia solanacearum strain HA4-1 chromosome, complete genome	3890347	2422734	2494665	3890347	transposase	Acidithiobacillus_phage(35.29%)	59	NA	NA
AZU56722.1|2422734_2423523_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU56723.1|2424023_2424869_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56724.1|2424881_2426633_-	peptide transporter	NA	NA	NA	NA	NA
AZU56725.1|2426644_2429185_-	hemagglutinin	NA	A0A0R6PJK4	Moraxella_phage	29.9	1.6e-15
AZU56726.1|2430269_2430578_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56727.1|2441700_2442033_+	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
AZU58079.1|2442084_2442381_-	hypothetical protein	NA	NA	NA	NA	NA
AZU58080.1|2442448_2442910_-	glycoside hydrolase	NA	K4I410	Acidithiobacillus_phage	80.3	1.1e-65
AZU56728.1|2442906_2443389_-	HNH endonuclease	NA	A0A076YKQ7	Mycobacterium_phage	48.3	1.4e-21
AZU56729.1|2443375_2443858_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	72.9	2.6e-60
AZU56730.1|2443854_2444145_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	46.4	2.7e-12
AZU56731.1|2444211_2444436_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56732.1|2444816_2445194_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56733.1|2445551_2446088_-	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	50.3	1.8e-46
AZU56734.1|2446299_2447124_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AZU56735.1|2447372_2448110_+	oxidoreductase	NA	NA	NA	NA	NA
AZU56736.1|2448513_2449200_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56737.1|2449252_2449612_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56738.1|2449812_2450157_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56739.1|2450396_2453519_-	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AZU56740.1|2453515_2454631_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZU58081.1|2454718_2455333_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZU56741.1|2455420_2456881_+	TolC family protein	NA	NA	NA	NA	NA
AZU56742.1|2456973_2457780_+	oxidoreductase	NA	NA	NA	NA	NA
AZU56743.1|2457829_2459293_+	MFS transporter	NA	NA	NA	NA	NA
AZU56744.1|2460037_2461024_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
AZU56745.1|2461913_2462150_-	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	82.3	1.6e-20
AZU56746.1|2462165_2462360_-	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	70.0	2.8e-18
AZU56747.1|2462552_2463355_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AZU56748.1|2463455_2464421_-	type III effector protein ript	NA	NA	NA	NA	NA
AZU56749.1|2464627_2465149_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	61.9	1.2e-23
AZU58082.1|2465277_2465568_+	hypothetical protein	NA	NA	NA	NA	NA
AZU58083.1|2465625_2465964_-	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
AZU56750.1|2466417_2467764_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56751.1|2468828_2469872_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZU56752.1|2469998_2470376_-	hypothetical protein	NA	U5P4I9	Shigella_phage	58.8	6.7e-16
AZU56753.1|2470692_2470965_-	hypothetical protein	NA	NA	NA	NA	NA
AZU58084.1|2470964_2472434_-	virulence factor	NA	NA	NA	NA	NA
AZU56754.1|2472442_2474650_-	hypothetical protein	NA	A0A077K801	Ralstonia_phage	32.9	1.9e-41
AZU56755.1|2474654_2477375_-	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.9	3.3e-88
AZU56756.1|2477830_2478064_+	hypothetical protein	NA	NA	NA	NA	NA
AZU56757.1|2478045_2478243_+	hypothetical protein	NA	NA	NA	NA	NA
AZU56758.1|2478579_2478987_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56759.1|2478976_2479186_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56760.1|2481700_2482090_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56761.1|2482095_2482500_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	50.4	6.3e-28
AZU56762.1|2482572_2483205_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	67.5	8.0e-62
AZU56763.1|2483222_2484095_-	hypothetical protein	NA	K4HZX9	Acidithiobacillus_phage	65.7	2.4e-101
AZU56764.1|2484091_2484589_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56765.1|2484585_2484870_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56766.1|2485291_2485897_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZU56767.1|2486051_2486864_+	oxidoreductase	NA	NA	NA	NA	NA
AZU56768.1|2487073_2488075_+	NADPH:quinone oxidoreductase	NA	NA	NA	NA	NA
AZU56769.1|2488503_2489478_-	hypothetical protein	NA	NA	NA	NA	NA
AZU58085.1|2489474_2490698_-	glycine hydroxymethyltransferase	NA	NA	NA	NA	NA
AZU56770.1|2491095_2492202_-	serine/threonine acetyltransferase	NA	NA	NA	NA	NA
AZU56771.1|2492861_2492993_-	elements of external origin	NA	NA	NA	NA	NA
AZU56772.1|2493240_2493531_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56773.1|2493678_2494665_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
>prophage 9
CP022481	Ralstonia solanacearum strain HA4-1 chromosome, complete genome	3890347	2498914	2559766	3890347	head,capsid,protease,portal,terminase,transposase	uncultured_Caudovirales_phage(33.33%)	56	NA	NA
AZU58086.1|2498914_2500348_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU56778.1|2500371_2502144_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56779.1|2502674_2503094_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AZU56780.1|2503102_2512765_-	filamentous hemagglutinin	NA	A0A0R6PJK4	Moraxella_phage	36.1	1.6e-36
AZU56781.1|2513140_2514088_+	HrgA protein	NA	NA	NA	NA	NA
AZU56782.1|2515552_2515984_+	hypothetical protein	NA	NA	NA	NA	NA
AZU56783.1|2517375_2517714_+	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
AZU56784.1|2518175_2519120_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56785.1|2520011_2520212_-	hypothetical protein	NA	NA	NA	NA	NA
AZU58087.1|2521133_2521850_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AZU58088.1|2522512_2522728_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AZU56786.1|2524102_2524354_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AZU56787.1|2524350_2524764_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AZU56788.1|2524835_2525858_-	methyltransferase	NA	Q6J1P4	Burkholderia_virus	58.3	1.5e-105
AZU56789.1|2526481_2526772_+	DNA-binding protein	NA	NA	NA	NA	NA
AZU56790.1|2526814_2527459_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56791.1|2527433_2527655_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56792.1|2527651_2528041_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56793.1|2528049_2528823_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.2	2.6e-46
AZU56794.1|2528923_2529370_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56795.1|2529375_2529678_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56796.1|2529680_2530685_-|capsid	major capsid protein E	capsid	A0A1B2LRS0	Wolbachia_phage	66.3	2.8e-109
AZU56797.1|2530691_2531069_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	49.6	1.4e-24
AZU56798.1|2531078_2532338_-|protease	Clp protease ClpP	protease	K4HZZ6	Acidithiobacillus_phage	44.9	2.9e-63
AZU56799.1|2532347_2533874_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	58.4	1.1e-152
AZU56800.1|2533873_2534095_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	4.5e-12
AZU56801.1|2534095_2534488_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56802.1|2534497_2535007_-	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	44.4	9.7e-26
AZU58089.1|2535049_2537029_-|terminase	terminase	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	85.7	0.0e+00
AZU56803.1|2537031_2537568_-	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	83.1	1.7e-73
AZU56804.1|2537709_2538396_-	type III effector protein ript	NA	NA	NA	NA	NA
AZU56805.1|2538878_2539373_+	hypothetical protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	53.4	7.7e-20
AZU58090.1|2539500_2539851_+	hypothetical protein	NA	NA	NA	NA	NA
AZU56806.1|2540140_2541049_+	type III effector	NA	NA	NA	NA	NA
AZU56807.1|2542119_2542921_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AZU56808.1|2543625_2543922_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56809.1|2544098_2544299_+	hypothetical protein	NA	NA	NA	NA	NA
AZU56810.1|2545644_2546373_-	nitroreductase family protein	NA	NA	NA	NA	NA
AZU58091.1|2546506_2547106_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZU56811.1|2547336_2547543_+	hypothetical protein	NA	NA	NA	NA	NA
AZU56812.1|2547557_2548364_-	endoglucanase	NA	NA	NA	NA	NA
AZU56813.1|2548460_2548664_-	hypothetical protein	NA	NA	NA	NA	NA
AZU58092.1|2548768_2549389_-	glutathione transferase GstA	NA	NA	NA	NA	NA
AZU56814.1|2549552_2549807_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU56815.1|2549878_2550277_-	hypothetical protein	NA	NA	NA	NA	NA
AZU56816.1|2550665_2551298_+	LysE family translocator	NA	NA	NA	NA	NA
AZU56817.1|2551369_2552620_+	oxidase	NA	NA	NA	NA	NA
AZU56818.1|2552630_2553002_+	sulfite:cytochrome C oxidoreductase subunit B	NA	NA	NA	NA	NA
AZU56819.1|2553015_2553243_-	SirA family protein	NA	NA	NA	NA	NA
AZU56820.1|2553282_2553864_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AZU56821.1|2553882_2554920_-	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
AZU56822.1|2554972_2555161_-	tautomerase	NA	NA	NA	NA	NA
AZU56823.1|2555173_2555959_-	class II aldolase	NA	NA	NA	NA	NA
AZU58093.1|2556041_2557262_-	MFS transporter	NA	NA	NA	NA	NA
AZU56824.1|2557370_2558279_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZU56825.1|2558353_2559766_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 10
CP022481	Ralstonia solanacearum strain HA4-1 chromosome, complete genome	3890347	3789477	3850713	3890347	head,capsid,protease,tail,portal,terminase,transposase,integrase,plate	Ralstonia_virus(55.1%)	75	3805698:3805743	3846473:3846518
AZU57830.1|3789477_3791472_+|protease	serine protease	protease	NA	NA	NA	NA
AZU57831.1|3791534_3791930_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AZU57832.1|3792059_3792548_-	DUF4437 domain-containing protein	NA	NA	NA	NA	NA
AZU57833.1|3792766_3793462_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZU57834.1|3793861_3794410_+	NAD(P)H dehydrogenase	NA	NA	NA	NA	NA
AZU57835.1|3794443_3796342_+	glutathione-regulated potassium-efflux system protein KefC	NA	NA	NA	NA	NA
AZU57836.1|3796363_3797194_-	cellulose 1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
AZU57837.1|3797316_3798111_-	DNA repair protein	NA	NA	NA	NA	NA
AZU57838.1|3798308_3799619_+	glutamate carboxypeptidase	NA	NA	NA	NA	NA
AZU58185.1|3799790_3800069_-	hypothetical protein	NA	NA	NA	NA	NA
AZU57839.1|3800558_3801689_+	porin	NA	NA	NA	NA	NA
AZU57840.1|3801819_3802845_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
AZU57841.1|3802848_3803553_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZU57842.1|3803635_3803947_-	high-potential iron-sulfur protein	NA	NA	NA	NA	NA
AZU57843.1|3804127_3804325_+	hypothetical protein	NA	NA	NA	NA	NA
AZU57844.1|3804717_3805056_+	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
3805698:3805743	attL	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAG	NA	NA	NA	NA
AZU57845.1|3806037_3806877_+	hypothetical protein	NA	NA	NA	NA	NA
AZU57846.1|3807047_3807359_+	hypothetical protein	NA	NA	NA	NA	NA
AZU57847.1|3807679_3807979_+	hypothetical protein	NA	NA	NA	NA	NA
AZU57848.1|3808732_3809398_+	hypothetical protein	NA	A4PE23	Ralstonia_virus	99.2	3.3e-66
AZU57849.1|3809399_3809903_+	hypothetical protein	NA	A4PE24	Ralstonia_virus	98.8	1.0e-91
AZU57850.1|3809889_3810237_+	hypothetical protein	NA	NA	NA	NA	NA
AZU58186.1|3810236_3810845_+	hypothetical protein	NA	A4PE25	Ralstonia_virus	93.6	2.1e-99
AZU57851.1|3810754_3811570_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	93.7	7.7e-150
AZU57852.1|3811554_3812661_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	98.4	5.1e-213
AZU57853.1|3812657_3814439_-	oxidoreductase	NA	A0A077K8Q7	Ralstonia_phage	99.2	0.0e+00
AZU57854.1|3814582_3815422_+|capsid	capsid scaffolding protein	capsid	A0A077K9W8	Ralstonia_phage	98.6	1.6e-150
AZU57855.1|3815475_3816492_+|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	100.0	4.7e-189
AZU57856.1|3816488_3817211_+|terminase	terminase	terminase	A0A077K804	Ralstonia_phage	97.9	9.9e-125
AZU58187.1|3817307_3817787_+|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	95.6	1.4e-82
AZU57857.1|3817786_3817990_+|tail	phage tail protein	tail	A0A077K8R0	Ralstonia_phage	98.5	1.7e-29
AZU57858.1|3818005_3818410_+	hypothetical protein	NA	A0A077K9X1	Ralstonia_phage	97.8	2.0e-26
AZU57859.1|3818406_3818718_+	hypothetical protein	NA	A0A077KER0	Ralstonia_phage	99.0	2.2e-49
AZU57860.1|3818714_3819521_+	peptidoglycan-binding protein	NA	A4PE36	Ralstonia_virus	95.9	6.9e-143
AZU57861.1|3819517_3820018_+	hypothetical protein	NA	A0A077K9R7	Ralstonia_phage	95.2	5.7e-79
AZU57862.1|3820014_3820449_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	97.2	7.9e-77
AZU57863.1|3820445_3820895_+	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	91.9	6.9e-68
AZU57864.1|3820958_3821765_-	hypothetical protein	NA	NA	NA	NA	NA
AZU58188.1|3821761_3822841_-	hypothetical protein	NA	Q332C0	Clostridium_botulinum_C_phage	22.4	5.3e-05
AZU57865.1|3823273_3823891_+|plate	baseplate assembly protein	plate	A4PE41	Ralstonia_virus	97.1	2.8e-112
AZU57866.1|3823887_3824235_+|plate	baseplate assembly protein	plate	A4PE42	Ralstonia_virus	96.5	7.2e-57
AZU57867.1|3824237_3825146_+|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	100.0	1.2e-162
AZU57868.1|3825138_3825756_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	98.4	9.1e-103
AZU57869.1|3825760_3827425_+|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	98.2	0.0e+00
AZU57870.1|3827437_3828190_+|tail	phage tail protein	tail	A0A077K9S5	Ralstonia_phage	99.6	6.0e-133
AZU57871.1|3828186_3828651_+	hypothetical protein	NA	A0A077K8R9	Ralstonia_phage	94.2	6.7e-82
AZU57872.1|3828749_3829925_+|tail	phage tail protein	tail	A0A077K9Y4	Ralstonia_phage	99.2	1.6e-225
AZU57873.1|3829956_3830466_+|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	99.4	1.4e-93
AZU58189.1|3830541_3830868_+|tail	phage tail protein	tail	A4PE51	Ralstonia_virus	98.1	1.8e-49
AZU57874.1|3830864_3830966_+|tail	GpE family phage tail protein	tail	A0A077K821	Ralstonia_phage	90.9	4.7e-09
AZU57875.1|3830962_3833626_+|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	96.9	0.0e+00
AZU57876.1|3833628_3834051_+	oxidoreductase	NA	A4PE53	Ralstonia_virus	95.7	3.7e-71
AZU57877.1|3834047_3835175_+|tail	phage tail protein	tail	A4PE54	Ralstonia_virus	95.7	4.6e-201
AZU57878.1|3835492_3835702_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	70.4	2.4e-15
AZU57879.1|3835652_3836435_+	DNA methylase N-4	NA	A0A1S5NPU0	Burkholderia_phage	67.8	9.2e-92
AZU57880.1|3836350_3837097_-	hypothetical protein	NA	A4PE55	Ralstonia_virus	94.8	1.9e-123
AZU58190.1|3837255_3837672_-	XRE family transcriptional regulator	NA	A4PE57	Ralstonia_virus	97.8	1.8e-70
AZU57881.1|3837973_3838165_+	hypothetical protein	NA	E5E3U0	Burkholderia_phage	50.9	3.4e-08
AZU57882.1|3838193_3838388_+	hypothetical protein	NA	A4PE59	Ralstonia_virus	95.3	1.3e-23
AZU57883.1|3838384_3838633_+	transcriptional regulator	NA	A4PE60	Ralstonia_virus	98.8	2.3e-41
AZU57884.1|3838747_3839302_+	transcriptional regulator	NA	A4PE61	Ralstonia_virus	100.0	1.2e-98
AZU57885.1|3839311_3839545_+	hypothetical protein	NA	A4PE62	Ralstonia_virus	94.8	6.4e-33
AZU57886.1|3839702_3839909_+	hypothetical protein	NA	A4PE64	Ralstonia_virus	95.6	2.1e-27
AZU57887.1|3839908_3840145_+	hypothetical protein	NA	A4PE65	Ralstonia_virus	98.7	3.5e-39
AZU57888.1|3840137_3840350_+	hypothetical protein	NA	A4PE66	Ralstonia_virus	95.7	2.7e-30
AZU57889.1|3840369_3840678_+	hypothetical protein	NA	NA	NA	NA	NA
AZU57890.1|3840679_3840901_+	hypothetical protein	NA	A4PE67	Ralstonia_virus	100.0	1.3e-35
AZU57891.1|3840897_3841170_+	hypothetical protein	NA	NA	NA	NA	NA
AZU57892.1|3841166_3841457_+	RNA-binding protein	NA	A4PE68	Ralstonia_virus	94.8	5.5e-50
AZU57893.1|3841456_3844261_+	hypothetical protein	NA	A4PE69	Ralstonia_virus	99.6	0.0e+00
AZU58191.1|3844420_3845140_+	hypothetical protein	NA	A4PE71	Ralstonia_virus	72.0	8.2e-79
AZU57894.1|3845351_3846434_+|integrase	integrase	integrase	A4PE72	Ralstonia_virus	99.7	7.9e-211
AZU57895.1|3846898_3847783_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
3846473:3846518	attR	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAG	NA	NA	NA	NA
AZU57896.1|3847957_3848371_+	hypothetical protein	NA	NA	NA	NA	NA
AZU58192.1|3849888_3850713_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP022482	Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence	1947245	4108	52131	1947245	transposase,integrase	Salmonella_phage(18.18%)	41	41951:41966	63396:63411
AZU58196.1|4108_4519_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU58197.1|4458_4935_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU59545.1|6482_9467_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	27.5	2.8e-80
AZU58198.1|9472_11182_-|integrase	integrase	integrase	NA	NA	NA	NA
AZU59546.1|11481_11922_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AZU58199.1|11937_12345_+	heat-shock protein	NA	NA	NA	NA	NA
AZU58200.1|12530_13097_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AZU59547.1|13296_13683_+	hypothetical protein	NA	NA	NA	NA	NA
AZU59548.1|13855_15793_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.8	7.7e-148
AZU58201.1|15971_16244_+	hypothetical protein	NA	NA	NA	NA	NA
AZU58202.1|17062_17320_-	hypothetical protein	NA	NA	NA	NA	NA
AZU58203.1|17353_17563_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59549.1|17806_18466_+	carbonic anhydrase	NA	NA	NA	NA	NA
AZU58204.1|18637_19273_+	diguanylate cyclase	NA	NA	NA	NA	NA
AZU58205.1|19449_19767_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.9	1.8e-17
AZU58206.1|19849_21472_+	molecular chaperone GroEL	NA	A0A240F779	uncultured_virus	60.8	5.2e-174
AZU58207.1|22079_23594_-	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	27.8	4.6e-47
AZU58208.1|23735_24146_+	hypothetical protein	NA	NA	NA	NA	NA
AZU58209.1|24142_24766_+	transglycosylase	NA	Q3T4W4	Enterobacteria_phage	35.1	3.2e-07
AZU58210.1|24853_25096_+	hypothetical protein	NA	NA	NA	NA	NA
AZU58211.1|25798_27352_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.9	9.8e-162
AZU58212.1|27360_28119_+	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	60.7	2.6e-83
AZU58213.1|28601_29663_+	peptidase C55	NA	NA	NA	NA	NA
AZU58214.1|29751_32718_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.7	0.0e+00
AZU58215.1|32874_33432_+	DNA invertase	NA	A0A0C4UR34	Shigella_phage	63.0	8.3e-55
AZU58216.1|33417_33720_-	hypothetical protein	NA	NA	NA	NA	NA
AZU58217.1|34776_35736_+	type III effector protein	NA	NA	NA	NA	NA
AZU58218.1|35988_36858_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZU58219.1|36899_37562_-	hypothetical protein	NA	NA	NA	NA	NA
AZU58220.1|37614_38184_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU58221.1|38577_40563_-	GALA protein 1	NA	NA	NA	NA	NA
AZU58222.1|40775_41882_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
41951:41966	attL	GCGCCGGCACCGCTGC	NA	NA	NA	NA
AZU58223.1|42179_43121_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZU58224.1|43202_44396_-	2-polyprenyl-6-methoxyphenol hydroxylase	NA	NA	NA	NA	NA
AZU58225.1|44535_45465_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZU58226.1|45567_46236_+	disulfide bond formation protein DsbA	NA	NA	NA	NA	NA
AZU58227.1|46312_47227_+	LLM class oxidoreductase	NA	NA	NA	NA	NA
AZU58228.1|47330_47714_+	DUF4437 domain-containing protein	NA	NA	NA	NA	NA
AZU58229.1|48176_49877_-|integrase	integrase	integrase	A0A2K9VH72	Gordonia_phage	25.5	1.5e-06
AZU58230.1|49875_50061_+	hypothetical protein	NA	NA	NA	NA	NA
AZU58231.1|50868_52131_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
63396:63411	attR	GCAGCGGTGCCGGCGC	NA	NA	NA	NA
>prophage 2
CP022482	Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence	1947245	854888	862422	1947245		Ralstonia_phage(83.33%)	7	NA	NA
AZU58770.1|854888_857549_+	type VI secretion protein	NA	A0A077K8Q4	Ralstonia_phage	83.3	0.0e+00
AZU58771.1|857551_857848_+	hypothetical protein	NA	A0A077K8Q4	Ralstonia_phage	51.4	2.0e-07
AZU58772.1|857844_858720_+	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	69.9	2.0e-103
AZU59608.1|858734_859559_+	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	86.5	1.0e-125
AZU58773.1|859555_861814_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	85.1	0.0e+00
AZU58774.1|861810_862149_+	hypothetical protein	NA	NA	NA	NA	NA
AZU58775.1|862155_862422_+	hypothetical protein	NA	R9U4D0	Rhizobium_phage	50.0	1.7e-05
>prophage 1
CP022483	Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence	143755	55358	115849	143755	transposase	Acidithiobacillus_phage(33.33%)	59	NA	NA
AZU59721.1|55358_56882_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	53.4	2.5e-149
AZU59722.1|56924_57983_+	amino acid-binding protein	NA	NA	NA	NA	NA
AZU59723.1|57996_59370_+	hypothetical protein	NA	NA	NA	NA	NA
AZU59724.1|59444_60005_+	hypothetical protein	NA	NA	NA	NA	NA
AZU59804.1|60236_63122_+	type VI secretion protein	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.9	5.3e-36
AZU59725.1|63149_63986_+	hypothetical protein	NA	NA	NA	NA	NA
AZU59726.1|64009_64570_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AZU59727.1|64562_66788_+	hypothetical protein	NA	NA	NA	NA	NA
AZU59728.1|66950_67334_+	hypothetical protein	NA	NA	NA	NA	NA
AZU59729.1|67943_70772_+	hypothetical protein	NA	NA	NA	NA	NA
AZU59730.1|71073_72993_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AZU59731.1|72989_75344_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AZU59732.1|75715_76372_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59805.1|76368_76986_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59733.1|77081_80204_-	relaxase	NA	NA	NA	NA	NA
AZU59734.1|80217_80880_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59735.1|80910_81270_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AZU59736.1|81612_82140_+	hypothetical protein	NA	NA	NA	NA	NA
AZU59806.1|82447_82723_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59737.1|83642_85532_-	chromosome partitioning protein ParB	NA	G8DH78	Emiliania_huxleyi_virus	27.3	5.6e-26
AZU59738.1|86415_87186_-	restriction endonuclease subunit M	NA	H7BVT3	unidentified_phage	34.7	1.1e-15
AZU59739.1|87820_88327_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59740.1|88323_89076_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59741.1|89072_89552_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59742.1|89964_91518_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.9	9.8e-162
AZU59743.1|91526_92285_+	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	60.7	2.6e-83
AZU59744.1|93290_94148_+	hypothetical protein	NA	NA	NA	NA	NA
AZU59745.1|94336_95935_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59746.1|96234_97788_-	Mobile element protein	NA	S5VTD3	Leptospira_phage	35.8	2.2e-73
AZU59747.1|97820_98231_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU59748.1|98170_98647_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU59749.1|99098_99434_+	hypothetical protein	NA	NA	NA	NA	NA
AZU59750.1|99501_99819_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59751.1|99840_100035_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
AZU59752.1|100114_100372_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59753.1|100391_100691_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59754.1|100701_101166_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59755.1|101296_101581_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59756.1|101655_101922_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59757.1|102361_102748_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59758.1|103233_103632_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59759.1|104145_104331_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59760.1|104343_105048_-	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	55.8	2.1e-23
AZU59761.1|105703_105934_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59762.1|105978_106278_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59763.1|106426_106855_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59764.1|107024_107315_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59765.1|107563_107785_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59766.1|107804_108416_-	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	48.4	6.4e-16
AZU59807.1|108498_108780_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59767.1|108850_109138_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59768.1|109738_110140_+	hypothetical protein	NA	NA	NA	NA	NA
AZU59769.1|110248_110599_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59770.1|110622_110844_-	hypothetical protein	NA	NA	NA	NA	NA
AZU59771.1|110910_111114_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZU59772.1|112338_112578_+	hypothetical protein	NA	NA	NA	NA	NA
AZU59808.1|112589_113177_+	hypothetical protein	NA	NA	NA	NA	NA
AZU59773.1|115022_115499_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU59774.1|115438_115849_+|transposase	transposase	transposase	NA	NA	NA	NA
