The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	14361	78240	5219584	transposase	Synechococcus_phage(12.5%)	53	NA	NA
AZU11157.1|14361_15189_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU11158.1|15182_15449_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU11159.1|15909_16677_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AZU11160.1|16684_16954_-	membrane protein	NA	NA	NA	NA	NA
AZU11161.1|17028_18489_-	cardiolipin synthetase	NA	NA	NA	NA	NA
AZU11162.1|18813_19539_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU11163.1|19588_19954_+	hypothetical protein	NA	NA	NA	NA	NA
AZU11164.1|20078_21206_-	DNA repair photolyase	NA	NA	NA	NA	NA
AZU11165.1|21391_22093_-	2OG-Fe(II) oxygenase	NA	A0A1D8KQ73	Synechococcus_phage	44.7	5.1e-17
AZU11166.1|22372_23713_-	membrane protein	NA	NA	NA	NA	NA
AZU11167.1|23936_24629_+	membrane protein	NA	NA	NA	NA	NA
AZU11168.1|24735_25056_+	hypothetical protein	NA	NA	NA	NA	NA
AZU11169.1|25055_26063_+	3-phosphoglycerate dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.6	2.5e-09
AZU11170.1|26210_27743_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	29.5	4.5e-26
AZU11171.1|27846_29082_-	peptidase M23	NA	A0A2H4J5G2	uncultured_Caudovirales_phage	32.0	4.6e-05
AZU11172.1|29242_29899_+	hypothetical protein	NA	NA	NA	NA	NA
AZU11173.1|30060_31857_+	aminopeptidase	NA	NA	NA	NA	NA
AZU11174.1|32169_32613_-	peptidase propeptide and ypeb domain-containing protein	NA	NA	NA	NA	NA
AZU11175.1|32910_34044_-	cellulase	NA	NA	NA	NA	NA
AZU11176.1|34665_35718_-	cellulase	NA	NA	NA	NA	NA
AZU11177.1|35847_36255_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11178.1|36492_37566_-	cellulase	NA	NA	NA	NA	NA
AZU11179.1|37873_38932_+	hydroxyacid dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.4	3.0e-77
AZU11180.1|39039_39615_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11181.1|40026_41508_-	glutamate synthase	NA	NA	NA	NA	NA
AZU11182.1|41638_46111_-	glutamate synthase	NA	NA	NA	NA	NA
AZU11183.1|46313_46694_-	Elastase inhibitor AFLEI Flags: Precursor	NA	NA	NA	NA	NA
AZU11184.1|46750_48028_+	DNA topoisomerase	NA	A0A0U2TSJ7	Niemeyer_virus	35.5	2.4e-41
AZU11185.1|48245_48590_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11186.1|48968_49838_-	NmrA family transcriptional regulator	NA	NA	NA	NA	NA
AZU11187.1|50001_50877_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZU11188.1|51079_51466_+	methicillin resistance protein	NA	NA	NA	NA	NA
AZU11189.1|51469_53215_+	ankyrin	NA	NA	NA	NA	NA
AZU11190.1|54186_54366_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11191.1|54356_54923_+	hypothetical protein	NA	NA	NA	NA	NA
AZU11192.1|54959_56141_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
AZU11193.1|56279_57065_-	Tat pathway signal protein	NA	NA	NA	NA	NA
AZU11194.1|57075_59691_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU11195.1|59835_60993_+	XylR family transcriptional regulator	NA	NA	NA	NA	NA
AZU11196.1|61137_63327_+	avirulence protein	NA	NA	NA	NA	NA
AZU11197.1|63814_65272_-	exonuclease	NA	NA	NA	NA	NA
AZU11198.1|65268_67764_-	helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	35.1	9.0e-08
AZU11199.1|67941_68604_+	hemolysin III	NA	NA	NA	NA	NA
AZU11200.1|68670_68928_+	prevent-host-death protein	NA	NA	NA	NA	NA
AZU11201.1|69387_70287_-	oxidoreductase	NA	NA	NA	NA	NA
AZU11202.1|70346_71084_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AZU11203.1|71209_72121_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU11204.1|72334_73414_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11205.1|74729_74996_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU11206.1|75016_75817_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU11207.1|76159_76777_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
AZU11208.1|76852_76987_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU11209.1|77259_78240_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	62.3	2.7e-101
>prophage 2
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	358598	424045	5219584	tRNA,transposase	uncultured_virus(20.0%)	58	NA	NA
AZU11444.1|358598_358865_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU11445.1|359522_360749_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU11446.1|360765_361023_+	hypothetical protein	NA	NA	NA	NA	NA
AZU11447.1|361130_361493_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11448.1|361479_361722_+	hypothetical protein	NA	NA	NA	NA	NA
AZU11449.1|361694_362129_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11450.1|362230_362575_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11451.1|362606_363023_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11452.1|363350_363614_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU11453.1|363607_364453_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.7	1.5e-44
AZU11454.1|365525_367364_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AZU11455.1|367747_369109_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU11456.1|369105_369237_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11457.1|369235_369424_+	proteinase inhibitor	NA	NA	NA	NA	NA
AZU11458.1|369481_370027_-	carbonic anhydrase	NA	NA	NA	NA	NA
AZU11459.1|370023_370248_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11460.1|370488_371799_+	MFS transporter	NA	NA	NA	NA	NA
AZU11461.1|371947_373207_+	phosphodiesterase	NA	NA	NA	NA	NA
AZU11462.1|373648_374179_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZU11463.1|375371_376139_+	3-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
AZU11464.1|376169_377651_+	benzaldehyde dehydrogenase	NA	NA	NA	NA	NA
AZU11465.1|378193_379078_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZU11466.1|379174_380359_+	4-hydroxybenzoate 3-monooxygenase	NA	NA	NA	NA	NA
AZU11467.1|380809_381322_+	hypothetical protein	NA	NA	NA	NA	NA
AZU11468.1|381437_382937_-	glycerol kinase	NA	NA	NA	NA	NA
AZU11469.1|383076_383898_-	glycerol transporter	NA	NA	NA	NA	NA
AZU11470.1|384072_385587_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZU11471.1|385809_386637_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AZU11472.1|387042_388026_-	diguanylate cyclase	NA	NA	NA	NA	NA
AZU11473.1|388126_389203_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AZU11474.1|389453_390317_+	3-oxoadipate:succinyl-CoA transferase	NA	NA	NA	NA	NA
AZU11475.1|391094_392303_+	beta-ketoadipyl CoA thiolase	NA	NA	NA	NA	NA
AZU11476.1|392381_393119_+	protocatechuate 3,4-dioxygenase	NA	NA	NA	NA	NA
AZU11477.1|393123_393687_+	protocatechuate 3,4-dioxygenase	NA	NA	NA	NA	NA
AZU11478.1|394041_395394_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
AZU11479.1|395404_396187_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AZU11480.1|396213_396627_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AZU11481.1|396806_397733_+	hydrolase	NA	NA	NA	NA	NA
AZU11482.1|398070_398931_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZU11483.1|399079_399940_+	kinase	NA	NA	NA	NA	NA
AZU11484.1|400215_401184_+	lipase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	28.3	1.9e-22
AZU11485.1|401482_402193_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11486.1|402401_404306_-|tRNA	tRNA uridine 5-carboxymethylaminomethyl modification protein	tRNA	NA	NA	NA	NA
AZU11487.1|404876_405350_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11488.1|405507_406467_+	serine dehydratase	NA	NA	NA	NA	NA
AZU11489.1|406451_407069_+	protein sanA-like protein	NA	NA	NA	NA	NA
AZU11490.1|407112_407532_+	isopropylmalate/homocitrate/citramalate synthase	NA	NA	NA	NA	NA
AZU11491.1|407736_408642_-	aspartyl beta-hydroxylase	NA	S4VR59	Pandoravirus	39.5	1.2e-37
AZU11492.1|408889_409774_-	malonyl-CoA O-methyltransferase	NA	NA	NA	NA	NA
AZU11493.1|410680_411442_-	pimelyl-ACP methyl ester esterase	NA	NA	NA	NA	NA
AZU11494.1|411544_411919_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11495.1|412110_413316_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AZU11496.1|413407_414442_-	biotin synthase	NA	NA	NA	NA	NA
AZU11497.1|414485_415217_+	competence protein ComF	NA	NA	NA	NA	NA
AZU11498.1|415484_416390_-	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AZU11499.1|417349_418801_-	HpaF protein	NA	NA	NA	NA	NA
AZU11500.1|419850_422280_-	serine kinase	NA	NA	NA	NA	NA
AZU11501.1|423061_424045_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
>prophage 3
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	651174	717940	5219584	transposase	uncultured_virus(16.67%)	46	NA	NA
AZU11689.1|651174_652401_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU11690.1|653520_654255_-	oxidoreductase	NA	NA	NA	NA	NA
AZU11691.1|654305_655250_+	cupin	NA	NA	NA	NA	NA
AZU11692.1|655804_657301_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11693.1|657603_657915_+	hypothetical protein	NA	NA	NA	NA	NA
AZU11694.1|657987_659574_-	oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
AZU11695.1|659932_660712_+	hypothetical protein	NA	A0A2D2W2L0	Stenotrophomonas_phage	66.9	2.4e-92
AZU11696.1|660871_661846_+	glutathionyl-hydroquinone reductase YqjG	NA	NA	NA	NA	NA
AZU11697.1|661919_662315_+	glyoxalase	NA	NA	NA	NA	NA
AZU11698.1|662461_662923_-	membrane protein	NA	NA	NA	NA	NA
AZU11699.1|663423_664251_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU11700.1|664244_664511_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU11701.1|664708_665344_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11702.1|665791_666031_+	membrane protein	NA	NA	NA	NA	NA
AZU11703.1|666432_668760_-	peptidase S9	NA	NA	NA	NA	NA
AZU11704.1|669159_670593_+	hypothetical protein	NA	NA	NA	NA	NA
AZU11705.1|670634_671726_-	lipoprotein	NA	NA	NA	NA	NA
AZU11706.1|672228_674103_+	histidine kinase	NA	A0A127AWB9	Bacillus_phage	31.5	2.2e-14
AZU11707.1|674164_674686_+	BadM/Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AZU11708.1|674788_675688_+	thioredoxin reductase	NA	NA	NA	NA	NA
AZU11709.1|676048_676240_+	membrane protein	NA	NA	NA	NA	NA
AZU11710.1|676464_677016_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11711.1|677221_678106_-	methyltransferase	NA	NA	NA	NA	NA
AZU11712.1|678304_679180_+	membrane protein	NA	NA	NA	NA	NA
AZU11713.1|679455_681228_-	cellulase	NA	NA	NA	NA	NA
AZU11714.1|681421_681529_+	hypothetical protein	NA	NA	NA	NA	NA
AZU11715.1|681635_683336_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
AZU11716.1|683483_683777_+	hypothetical protein	NA	NA	NA	NA	NA
AZU11717.1|684237_684471_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11718.1|684489_685866_+	amino acid permease	NA	NA	NA	NA	NA
AZU11719.1|685951_687073_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AZU11720.1|687316_688228_+	magnesium transporter	NA	NA	NA	NA	NA
AZU11721.1|688430_689126_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11722.1|689707_691381_-	trehalase	NA	NA	NA	NA	NA
AZU11723.1|691654_692425_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11724.1|692529_693282_+	endonuclease	NA	NA	NA	NA	NA
AZU11725.1|693811_694804_+	hypothetical protein	NA	NA	NA	NA	NA
AZU11726.1|695160_696090_-	histidine kinase	NA	NA	NA	NA	NA
AZU11727.1|696656_699536_-	peptidase M16	NA	NA	NA	NA	NA
AZU11728.1|702614_703712_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU11729.1|704056_707347_+	ATPase	NA	A0A1V0SGX0	Hokovirus	36.8	1.4e-32
AZU11730.1|707373_708012_-	chemotaxis protein CheY	NA	NA	NA	NA	NA
AZU11731.1|710304_716343_+	hypothetical protein	NA	A0A2L1IV18	Escherichia_phage	25.6	2.6e-53
AZU11732.1|716456_716804_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11733.1|716852_717590_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU11734.1|717673_717940_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	852278	937680	5219584	tRNA,transposase,protease	Staphylococcus_phage(20.0%)	58	NA	NA
AZU11840.1|852278_855113_-|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0S951	Catovirus	34.3	3.9e-132
AZU11841.1|855320_855746_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AZU11842.1|855745_856117_-	membrane protein	NA	NA	NA	NA	NA
AZU11843.1|856116_857589_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	9.0e-48
AZU11844.1|857696_858779_+	membrane protein	NA	NA	NA	NA	NA
AZU11845.1|858775_859882_+	membrane protein	NA	NA	NA	NA	NA
AZU11846.1|859983_860181_+	hypothetical protein	NA	NA	NA	NA	NA
AZU11847.1|860440_860902_-	membrane protein	NA	NA	NA	NA	NA
AZU11848.1|861289_862261_+	recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.5	3.5e-16
AZU11849.1|862743_863541_+	chitinase	NA	NA	NA	NA	NA
AZU11850.1|864058_868111_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	9.8e-121
AZU11851.1|868780_871927_+	adhesin	NA	NA	NA	NA	NA
AZU11852.1|872029_873913_+|protease	protease	protease	A0A217EQY2	Bacillus_phage	31.7	3.6e-17
AZU11853.1|874452_881523_+	membrane protein	NA	NA	NA	NA	NA
AZU11854.1|881746_883627_+|protease	protease	protease	A0A1B0T6A2	Bacillus_phage	33.2	2.3e-24
AZU11855.1|883756_885484_+	general secretion pathway protein GspE	NA	NA	NA	NA	NA
AZU11856.1|885659_886877_+	general secretion pathway protein GspF	NA	NA	NA	NA	NA
AZU11857.1|887147_887579_+	general secretion pathway protein GspG	NA	NA	NA	NA	NA
AZU11858.1|887588_888098_+	general secretion pathway protein GspH	NA	NA	NA	NA	NA
AZU11859.1|888094_888511_+	general secretion pathway protein GspI	NA	NA	NA	NA	NA
AZU11860.1|888507_889143_+	general secretion pathway protein GspJ	NA	NA	NA	NA	NA
AZU11861.1|889139_889991_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
AZU11862.1|889987_891109_+	general secretion pathway protein GspL	NA	NA	NA	NA	NA
AZU11863.1|891092_891746_+	general secretion pathway protein GspM	NA	NA	NA	NA	NA
AZU11864.1|891735_892527_+	general secretion pathway protein GspN	NA	NA	NA	NA	NA
AZU11865.1|892523_894824_+	general secretion pathway protein GspD	NA	A7BJX1	Enterobacteria_phage	24.5	3.4e-09
AZU11866.1|894820_895660_+	glycosyltransferase	NA	NA	NA	NA	NA
AZU11867.1|896073_896802_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZU11868.1|896907_897483_-	aminotransferase	NA	NA	NA	NA	NA
AZU11869.1|897706_899869_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU11870.1|899900_901058_-	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AZU11871.1|901658_902498_+	glycosyl transferase	NA	NA	NA	NA	NA
AZU11872.1|903672_905580_+	glycosyltransferase	NA	NA	NA	NA	NA
AZU11873.1|905629_906925_+	membrane protein	NA	NA	NA	NA	NA
AZU11874.1|906906_907875_+	glycosidase-like protein	NA	NA	NA	NA	NA
AZU11875.1|909238_909505_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU11876.1|909525_910326_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU11877.1|910375_910648_+	hypothetical protein	NA	NA	NA	NA	NA
AZU11878.1|910853_911309_+	hypothetical protein	NA	NA	NA	NA	NA
AZU11879.1|911337_911814_+	hypothetical protein	NA	NA	NA	NA	NA
AZU11880.1|911899_914044_+	cellulose synthase	NA	NA	NA	NA	NA
AZU11881.1|914088_916416_+	cation tolerance protein CutA	NA	NA	NA	NA	NA
AZU11882.1|916412_917594_+	1,4-D-glucanase	NA	NA	NA	NA	NA
AZU11883.1|922386_924045_-|protease	serine protease	protease	NA	NA	NA	NA
AZU11884.1|924037_924463_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11885.1|924827_925250_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	63.0	3.0e-41
AZU11886.1|925586_926102_+	peptide deformylase	NA	NA	NA	NA	NA
AZU11887.1|926334_927996_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	28.8	5.4e-41
AZU11888.1|928220_928715_+	hypothetical protein	NA	NA	NA	NA	NA
AZU11889.1|928912_930166_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	3.5e-101
AZU11890.1|930268_930793_+	NrdR family transcriptional regulator	NA	NA	NA	NA	NA
AZU11891.1|930789_931278_+	acetyltransferase	NA	NA	NA	NA	NA
AZU11892.1|931270_932386_+	riboflavin biosynthesis protein RibD	NA	A0A1V0SE20	Indivirus	35.3	4.1e-45
AZU11893.1|933154_934381_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU11894.1|934562_934970_-	hypothetical protein	NA	NA	NA	NA	NA
AZU11895.1|935139_935742_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	38.0	6.1e-27
AZU11896.1|935738_936878_+	3,4-dihydroxy-2-butanone 4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	34.3	2.1e-52
AZU11897.1|937215_937680_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	40.9	1.7e-24
>prophage 5
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	1193025	1248017	5219584	transposase,protease	uncultured_virus(25.0%)	43	NA	NA
AZU12127.1|1193025_1194252_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU12128.1|1194331_1195315_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU12129.1|1195630_1196728_+	membrane protein	NA	NA	NA	NA	NA
AZU12130.1|1196919_1197435_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12131.1|1197454_1198315_+	pseudouridylate synthase	NA	NA	NA	NA	NA
AZU12132.1|1198265_1198658_-	HNH endonuclease	NA	NA	NA	NA	NA
AZU12133.1|1198660_1199869_-	2-amino-3-ketobutyrate CoA ligase	NA	V5LQ39	Emiliania_huxleyi_virus	26.2	1.3e-20
AZU12134.1|1199959_1201057_+	sulfate transporter subunit	NA	NA	NA	NA	NA
AZU12135.1|1201060_1201921_+	sulfate/thiosulfate transporter subunit	NA	NA	NA	NA	NA
AZU12136.1|1201917_1202871_+	sulfate/thiosulfate transporter permease subunit	NA	NA	NA	NA	NA
AZU12137.1|1202878_1203925_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	1.2e-25
AZU12138.1|1204191_1204908_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12139.1|1205708_1206935_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU12140.1|1206996_1208019_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
AZU12141.1|1208583_1210917_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU12142.1|1211116_1213198_+	phospholipase C	NA	NA	NA	NA	NA
AZU12143.1|1213358_1215518_+	dipeptidyl-peptidase 7	NA	NA	NA	NA	NA
AZU12144.1|1215609_1216254_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
AZU12145.1|1216470_1217019_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12146.1|1217247_1218567_+	folylpolyglutamate synthase	NA	NA	NA	NA	NA
AZU12147.1|1218634_1219717_+	sporulation protein	NA	NA	NA	NA	NA
AZU12148.1|1219930_1220677_+	colicin V synthesis protein	NA	NA	NA	NA	NA
AZU12149.1|1220707_1222174_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.9	4.1e-85
AZU12150.1|1222369_1223194_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12151.1|1225158_1225578_+	lipoprotein	NA	NA	NA	NA	NA
AZU12152.1|1225766_1226510_-	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AZU12153.1|1227070_1227613_-	phosphoesterase	NA	NA	NA	NA	NA
AZU12154.1|1227593_1228730_-	glycosyl transferase	NA	NA	NA	NA	NA
AZU12155.1|1228974_1230501_-	exopolyphosphatase	NA	NA	NA	NA	NA
AZU12156.1|1230673_1232776_-	polyphosphate kinase	NA	NA	NA	NA	NA
AZU12157.1|1232888_1234217_-	histidine kinase	NA	W8CYF6	Bacillus_phage	33.3	6.4e-29
AZU12158.1|1234289_1234979_-	transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
AZU12159.1|1235161_1236868_-	peptidase	NA	NA	NA	NA	NA
AZU12160.1|1236957_1237266_+	glutaredoxin	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	2.1e-07
AZU12161.1|1237262_1237658_+	alkylhydroperoxidase	NA	NA	NA	NA	NA
AZU12162.1|1238019_1239027_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
AZU12163.1|1239165_1239927_-	membrane protein	NA	NA	NA	NA	NA
AZU12164.1|1241106_1241751_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12165.1|1242097_1243324_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU12166.1|1243812_1244073_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12167.1|1244593_1245886_+	trigger factor	NA	NA	NA	NA	NA
AZU12168.1|1245978_1246605_+|protease	Clp protease ClpP	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
AZU12169.1|1246730_1248017_+|protease	Clp protease ATP-binding protein	protease	G3M9Z9	Bacillus_virus	59.9	5.3e-137
>prophage 6
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	1321779	1390273	5219584	transposase,protease	Brazilian_cedratvirus(14.29%)	51	NA	NA
AZU12232.1|1321779_1322643_+|protease	membrane protease HflC	protease	NA	NA	NA	NA
AZU12233.1|1323267_1323732_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU12234.1|1324211_1325504_+	adenylosuccinate synthetase	NA	A0A2R8FF47	Brazilian_cedratvirus	38.2	2.9e-74
AZU12235.1|1325871_1328544_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	28.6	8.6e-81
AZU12236.1|1328796_1328982_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12237.1|1329236_1329950_-	oxidoreductase	NA	NA	NA	NA	NA
AZU12238.1|1330021_1330612_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU12239.1|1331388_1332024_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12240.1|1333329_1333713_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12241.1|1334356_1335931_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AZU12242.1|1336339_1337092_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12243.1|1337442_1338198_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12244.1|1338264_1338894_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU12245.1|1339888_1340758_+	ADP-dependent (S)-NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AZU12246.1|1341177_1342656_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AZU12247.1|1342787_1344593_-	glycoside hydrolase family 15	NA	NA	NA	NA	NA
AZU12248.1|1344589_1345465_-	oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	52.7	2.7e-76
AZU12249.1|1345915_1348270_-	sugar hydrolase	NA	NA	NA	NA	NA
AZU12250.1|1348344_1348473_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12251.1|1348689_1348869_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12252.1|1348900_1349530_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AZU12253.1|1349874_1351584_+	thioredoxin reductase	NA	NA	NA	NA	NA
AZU12254.1|1351580_1351886_+	zinc finger UbP-type protein	NA	NA	NA	NA	NA
AZU12255.1|1352082_1352829_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AZU12256.1|1352977_1353616_+	guanosine polyphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AZU12257.1|1353699_1353807_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12258.1|1353873_1356396_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.5	1.0e-152
AZU12259.1|1357081_1363087_+	transducer protein car	NA	NA	NA	NA	NA
AZU12260.1|1364179_1366477_-	aldehyde oxidase	NA	NA	NA	NA	NA
AZU12261.1|1366473_1367562_-	FAD-binding molybdopterin dehydrogenase	NA	NA	NA	NA	NA
AZU12262.1|1367534_1368113_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AZU12263.1|1368410_1369742_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12264.1|1369738_1370332_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12265.1|1370394_1370739_+	cupin	NA	NA	NA	NA	NA
AZU12266.1|1370898_1371402_+	DNA-binding protein	NA	NA	NA	NA	NA
AZU12267.1|1371510_1371936_-	death-on-curing protein	NA	A0A1B3AYM0	Gordonia_phage	54.7	3.1e-09
AZU12268.1|1371944_1372166_-	transcriptional regulator	NA	NA	NA	NA	NA
AZU12269.1|1372316_1372922_+	LexA family transcriptional regulator	NA	A0A1W6JNS2	Morganella_phage	38.5	2.5e-12
AZU12270.1|1372923_1373577_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AZU12271.1|1373586_1375005_+	DNA repair nucleotidyltransferase	NA	NA	NA	NA	NA
AZU12272.1|1375050_1375194_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12273.1|1375180_1378432_+	DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.9	2.7e-81
AZU12274.1|1378864_1380457_+	peptidase S9	NA	NA	NA	NA	NA
AZU12275.1|1380666_1381485_+	histidine kinase	NA	NA	NA	NA	NA
AZU12276.1|1381912_1383865_+	peptide transporter	NA	NA	NA	NA	NA
AZU12277.1|1384741_1385008_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU12278.1|1385001_1385829_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU12279.1|1385853_1386612_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12280.1|1386906_1389027_+	peptidase S9	NA	NA	NA	NA	NA
AZU12281.1|1389185_1390013_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU12282.1|1390006_1390273_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	1394354	1457189	5219584	tRNA,transposase	Bacillus_phage(20.0%)	56	NA	NA
AZU12285.1|1394354_1395092_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU12286.1|1395175_1395442_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU12287.1|1395865_1397092_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU12288.1|1397072_1398779_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12289.1|1399185_1401294_-	catalase	NA	A0A2K9L0T1	Tupanvirus	47.9	7.3e-136
AZU12290.1|1401498_1402353_-	hypothetical protein	NA	A0A2H4PQR8	Staphylococcus_phage	30.0	5.8e-23
AZU12291.1|1402410_1404045_-	carboxylesterase	NA	A0A0M4JT58	Mollivirus	29.7	3.6e-37
AZU12292.1|1404212_1407077_-	glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.9	1.5e-261
AZU12293.1|1407543_1407723_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12294.1|1408145_1408949_+	sulfotransferase	NA	NA	NA	NA	NA
AZU12295.1|1409034_1410273_+	hemolysin D	NA	NA	NA	NA	NA
AZU12296.1|1410269_1412426_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	4.5e-32
AZU12297.1|1412704_1413958_+	MFS transporter	NA	NA	NA	NA	NA
AZU12298.1|1413974_1414337_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12299.1|1414341_1415196_-|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU12300.1|1415424_1416162_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU12301.1|1416245_1416512_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU12302.1|1418808_1420476_-	membrane protein	NA	NA	NA	NA	NA
AZU12303.1|1420472_1421237_-	membrane protein	NA	NA	NA	NA	NA
AZU12304.1|1421336_1423070_-	membrane protein	NA	NA	NA	NA	NA
AZU12305.1|1423286_1424003_+	chemotaxis protein CheY	NA	W8CYM9	Bacillus_phage	34.8	1.3e-23
AZU12306.1|1423968_1425285_+	histidine kinase	NA	NA	NA	NA	NA
AZU12307.1|1425469_1425961_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12308.1|1426029_1426287_-	cell division topological specificity factor	NA	NA	NA	NA	NA
AZU12309.1|1426289_1427099_-	cell division inhibitor MinD	NA	NA	NA	NA	NA
AZU12310.1|1427134_1427878_-	septum formation inhibitor	NA	NA	NA	NA	NA
AZU12311.1|1427881_1428481_-	acetyltransferase	NA	NA	NA	NA	NA
AZU12312.1|1428715_1429912_+	histidine kinase	NA	NA	NA	NA	NA
AZU12313.1|1429911_1430553_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AZU12314.1|1430461_1430827_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12315.1|1430903_1432085_+	polyketide cyclase	NA	NA	NA	NA	NA
AZU12316.1|1432166_1432553_+	membrane protein	NA	NA	NA	NA	NA
AZU12317.1|1432555_1433230_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AZU12318.1|1433305_1434103_-	peptidase	NA	NA	NA	NA	NA
AZU12319.1|1434230_1434413_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12320.1|1434409_1434694_-	membrane protein	NA	NA	NA	NA	NA
AZU12321.1|1434845_1435715_-	membrane protein	NA	NA	NA	NA	NA
AZU12322.1|1435839_1437042_+	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AZU12323.1|1437317_1438646_-	endonuclease	NA	NA	NA	NA	NA
AZU12324.1|1438599_1439514_-|tRNA	arginyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
AZU12325.1|1439554_1440163_+	calcium-binding protein	NA	NA	NA	NA	NA
AZU12326.1|1440329_1440785_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12327.1|1441095_1442289_-	RNA polymerase sigma70	NA	NA	NA	NA	NA
AZU12328.1|1442398_1442911_-	pathogenicity-like protein	NA	NA	NA	NA	NA
AZU12329.1|1443142_1444048_-	palmitoyl-CoA hydrolase	NA	NA	NA	NA	NA
AZU12330.1|1444118_1444889_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AZU12331.1|1444954_1445383_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12332.1|1445499_1445904_-	thioesterase	NA	NA	NA	NA	NA
AZU12333.1|1445903_1448870_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	4.3e-307
AZU12334.1|1449162_1449483_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
AZU12335.1|1449495_1449756_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
AZU12336.1|1449988_1451041_+	GTPase CgtA	NA	NA	NA	NA	NA
AZU12337.1|1451132_1451402_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AZU12338.1|1451518_1453111_+	membrane protein	NA	NA	NA	NA	NA
AZU12339.1|1453298_1454351_+	riboflavin kinase	NA	NA	NA	NA	NA
AZU12340.1|1454357_1457189_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.3	7.5e-43
>prophage 8
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	1473448	1545852	5219584	tRNA,transposase	Hokovirus(20.0%)	59	NA	NA
AZU12358.1|1473448_1474186_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU12359.1|1474269_1474536_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU12360.1|1474670_1475588_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12361.1|1475813_1479326_-	phospholipase	NA	NA	NA	NA	NA
AZU12362.1|1479340_1479601_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12363.1|1479931_1480171_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12364.1|1480261_1480507_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12365.1|1481160_1481748_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12366.1|1482083_1482647_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12367.1|1482657_1483764_-	recombinase	NA	A0A0A1I5U0	Burkholderia_phage	35.4	2.4e-45
AZU12368.1|1484325_1485261_+	cytochrome C oxidase subunit II	NA	NA	NA	NA	NA
AZU12369.1|1485260_1487261_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AZU12370.1|1487263_1487890_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AZU12371.1|1487889_1488225_+	cytochrome C oxidase	NA	NA	NA	NA	NA
AZU12372.1|1488576_1490274_+	peptidase M61	NA	NA	NA	NA	NA
AZU12373.1|1490522_1491914_+	DNA repair protein RadA	NA	NA	NA	NA	NA
AZU12374.1|1492327_1492714_+	membrane protein	NA	NA	NA	NA	NA
AZU12375.1|1493241_1494033_-	transcriptional regulator	NA	NA	NA	NA	NA
AZU12376.1|1494833_1496264_+	DNA-binding protein	NA	NA	NA	NA	NA
AZU12377.1|1496472_1498341_+	histidine kinase	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.0	4.0e-16
AZU12378.1|1498366_1500691_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12379.1|1501346_1502189_+	polyvinylalcohol dehydrogenase	NA	NA	NA	NA	NA
AZU12380.1|1502190_1502553_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
AZU12381.1|1502937_1503948_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU12382.1|1503944_1504820_+	histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	29.1	4.1e-24
AZU12383.1|1504809_1506765_+	histidine kinase	NA	NA	NA	NA	NA
AZU12384.1|1506858_1508565_-	glycosyl hydrolase family 43	NA	NA	NA	NA	NA
AZU12385.1|1508801_1511171_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU12386.1|1511277_1511724_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	38.4	9.4e-09
AZU12387.1|1511897_1512263_-	RNA signal recognition particle 4.5S RNA	NA	NA	NA	NA	NA
AZU12388.1|1512624_1513755_-	histidine kinase	NA	W8CYM9	Bacillus_phage	32.0	9.7e-10
AZU12389.1|1513751_1514336_-	chemotaxis protein CheB	NA	NA	NA	NA	NA
AZU12390.1|1514332_1515157_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
AZU12391.1|1515153_1518327_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	41.3	4.6e-33
AZU12392.1|1518486_1519650_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU12393.1|1519642_1520011_+	chemotaxis protein CheY	NA	NA	NA	NA	NA
AZU12394.1|1520238_1521822_-	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AZU12395.1|1521885_1522014_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12396.1|1522059_1523109_+	aldose epimerase	NA	NA	NA	NA	NA
AZU12397.1|1523384_1524176_-	membrane protein	NA	NA	NA	NA	NA
AZU12398.1|1524527_1525904_+	signal recognition particle	NA	NA	NA	NA	NA
AZU12399.1|1526643_1527714_+	2-nitropropane dioxygenase	NA	NA	NA	NA	NA
AZU12400.1|1527704_1528502_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12401.1|1528598_1528856_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AZU12402.1|1528899_1529412_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AZU12403.1|1529469_1530228_+|tRNA	tRNA (guanine-N1)-methyltransferase	tRNA	NA	NA	NA	NA
AZU12404.1|1530372_1530780_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZU12405.1|1531034_1532528_-	multidrug transporter MatE	NA	NA	NA	NA	NA
AZU12406.1|1532585_1532690_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12407.1|1533053_1533749_+	DNA-binding protein	NA	NA	NA	NA	NA
AZU12408.1|1533807_1534464_+	glutathione S-transferase	NA	NA	NA	NA	NA
AZU12409.1|1534688_1535096_+|tRNA	tRNA synthetase RNA-binding protein	tRNA	NA	NA	NA	NA
AZU12410.1|1535217_1537464_-	hydroperoxidase	NA	NA	NA	NA	NA
AZU12411.1|1537892_1538507_-	calcium-binding protein	NA	NA	NA	NA	NA
AZU12412.1|1538806_1541428_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.3	2.0e-29
AZU12413.1|1541540_1542395_-|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU12414.1|1542412_1542685_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU12415.1|1544749_1545013_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU12416.1|1545006_1545852_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.7	1.5e-44
>prophage 9
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	1683068	1723576	5219584	coat,transposase,protease	Shigella_phage(33.33%)	31	NA	NA
AZU12535.1|1683068_1684415_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
AZU12536.1|1684441_1685632_-	1-deoxy-D-xylulose 5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AZU12537.1|1685634_1686462_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AZU12538.1|1686458_1687217_-	UDP diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	32.6	1.0e-15
AZU12539.1|1687234_1687792_-	ribosome recycling factor	NA	NA	NA	NA	NA
AZU12540.1|1687993_1688716_-	uridylate kinase	NA	NA	NA	NA	NA
AZU12541.1|1688821_1690345_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.0	3.1e-19
AZU12542.1|1690619_1691498_-	elongation factor Ts	NA	NA	NA	NA	NA
AZU12543.1|1691667_1692465_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AZU12544.1|1692920_1693634_-	pilus assembly protein	NA	NA	NA	NA	NA
AZU12545.1|1693636_1693969_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12546.1|1694017_1695052_-|coat	spore coat protein U	coat	NA	NA	NA	NA
AZU12547.1|1695048_1697400_-	fimbriae usher protein	NA	NA	NA	NA	NA
AZU12548.1|1697416_1698187_-	pilus assembly protein	NA	NA	NA	NA	NA
AZU12549.1|1698195_1698720_-	sigma-fimbriae tip adhesin	NA	NA	NA	NA	NA
AZU12550.1|1699038_1699815_+	methionine aminopeptidase	NA	NA	NA	NA	NA
AZU12551.1|1699811_1702421_+	protein-PII uridylyltransferase	NA	NA	NA	NA	NA
AZU12552.1|1702442_1703639_+	2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AZU12553.1|1703829_1704186_+	arsenate reductase	NA	NA	NA	NA	NA
AZU12554.1|1704432_1705563_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AZU12555.1|1705855_1707550_+	asparagine synthetase B	NA	A0A0P0C1V4	Ostreococcus_lucimarinus_virus	39.0	1.2e-88
AZU12556.1|1707617_1708670_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12557.1|1708942_1709089_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12558.1|1709105_1711244_-	ligand-gated channel	NA	NA	NA	NA	NA
AZU12559.1|1711651_1714069_-	penicillin acylase	NA	NA	NA	NA	NA
AZU12560.1|1714215_1714701_+	bacterioferritin	NA	NA	NA	NA	NA
AZU12561.1|1714929_1715196_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU12562.1|1715189_1716017_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU12563.1|1717707_1719951_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
AZU12564.1|1722431_1722704_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU12565.1|1722721_1723576_+|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
>prophage 10
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	1901905	1971061	5219584	tRNA,transposase,integrase,protease	Catovirus(22.22%)	58	1930793:1930810	1957601:1957618
AZU12725.1|1901905_1903300_-|tRNA	asparaginyl-tRNA synthetase	tRNA	A0A2P1EMB4	Moumouvirus	39.0	1.1e-79
AZU12726.1|1903504_1903843_+	Fe-S cluster assembly protein HesB	NA	NA	NA	NA	NA
AZU12727.1|1904298_1904730_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AZU12728.1|1904741_1904972_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AZU12729.1|1905160_1905610_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AZU12730.1|1905819_1909323_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AZU12731.1|1909379_1910111_+	cell division protein ZipA	NA	NA	NA	NA	NA
AZU12732.1|1910117_1910501_+	membrane protein	NA	NA	NA	NA	NA
AZU12733.1|1910679_1911804_-	aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	24.7	4.5e-07
AZU12734.1|1912138_1914640_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	37.2	8.2e-118
AZU12735.1|1914636_1915599_+|tRNA	lysyl-tRNA synthetase	tRNA	A0A1V0SAC0	Catovirus	26.2	1.8e-20
AZU12736.1|1915707_1916394_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12737.1|1916581_1917646_+	methylthioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
AZU12738.1|1917855_1920555_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.4	9.8e-109
AZU12739.1|1920859_1923280_+	glucose dehydrogenase	NA	NA	NA	NA	NA
AZU12740.1|1923658_1924387_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12741.1|1924651_1926319_-	urocanate hydratase	NA	NA	NA	NA	NA
AZU12742.1|1926335_1927193_-	formimidoylglutamase	NA	NA	NA	NA	NA
AZU12743.1|1927189_1927378_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12744.1|1927374_1928916_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.8	1.3e-78
AZU12745.1|1928929_1930135_-	imidazolonepropionase	NA	NA	NA	NA	NA
AZU12746.1|1930195_1931566_+	N-formimino-L-glutamate deiminase	NA	NA	NA	NA	NA
1930793:1930810	attL	GCGCTGCCGGATGCGGTG	NA	NA	NA	NA
AZU12747.1|1931626_1931854_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12748.1|1931843_1932620_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZU12749.1|1932806_1933811_-	membrane protein	NA	NA	NA	NA	NA
AZU12750.1|1934347_1934908_-	poly(hydroxyalcanoate) granule associated protein	NA	NA	NA	NA	NA
AZU12751.1|1935070_1935346_-	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
AZU12752.1|1935583_1936393_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12753.1|1936334_1936991_-	sulfite oxidase	NA	NA	NA	NA	NA
AZU12754.1|1937116_1938085_-	sulfoxide reductase catalytic subunit YedY	NA	NA	NA	NA	NA
AZU12755.1|1938261_1939347_+	MFS transporter	NA	M1Q1P2	Streptococcus_phage	43.6	1.5e-76
AZU12756.1|1939430_1940639_+	prephenate dehydratase	NA	NA	NA	NA	NA
AZU12757.1|1940762_1942085_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZU12758.1|1942426_1942894_-	energy transducer TonB	NA	NA	NA	NA	NA
AZU12759.1|1943250_1943922_-	energy transducer TonB	NA	NA	NA	NA	NA
AZU12760.1|1944033_1945314_+|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.4	3.3e-99
AZU12761.1|1945634_1946219_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AZU12762.1|1946319_1947336_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZU12763.1|1947882_1949352_+|integrase	integrase	integrase	NA	NA	NA	NA
AZU12764.1|1949868_1950696_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU12765.1|1950689_1950956_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU12766.1|1951423_1952251_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU12767.1|1952244_1952511_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU12768.1|1954804_1955995_-	FAD-binding monooxygenase	NA	NA	NA	NA	NA
AZU12769.1|1956031_1956496_-	transcriptional regulator	NA	NA	NA	NA	NA
AZU12770.1|1956535_1956706_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12771.1|1956857_1956971_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12772.1|1959930_1960275_-	chemotaxis protein CheY	NA	NA	NA	NA	NA
1957601:1957618	attR	GCGCTGCCGGATGCGGTG	NA	NA	NA	NA
AZU12773.1|1960573_1962091_+	circadian clock protein KaiC	NA	NA	NA	NA	NA
AZU12774.1|1962077_1964150_+	histidine kinase	NA	NA	NA	NA	NA
AZU12775.1|1964507_1965215_-	C-type cytochrome biogenesis protein	NA	NA	NA	NA	NA
AZU12776.1|1965208_1965706_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AZU12777.1|1965705_1966248_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AZU12778.1|1966244_1968233_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AZU12779.1|1968296_1968767_-	cytochrome C biogenesis protein CcmE	NA	NA	NA	NA	NA
AZU12780.1|1968763_1968970_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
AZU12781.1|1968966_1969725_-	heme ABC transporter permease	NA	NA	NA	NA	NA
AZU12782.1|1969735_1971061_-|protease	serine protease	protease	A0A217EQY2	Bacillus_phage	39.6	5.3e-23
>prophage 11
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	2029321	2040149	5219584	tRNA	Micromonas_pusilla_virus(16.67%)	7	NA	NA
AZU12839.1|2029321_2030998_+	ubiquinone biosynthesis protein UbiB	NA	G8DDN0	Micromonas_pusilla_virus	29.2	7.1e-41
AZU12840.1|2031085_2031727_+	LexA family transcriptional regulator	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
AZU12841.1|2031899_2032934_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.1e-113
AZU12842.1|2033227_2033716_+	recombinase RecX	NA	NA	NA	NA	NA
AZU12843.1|2033817_2036466_+|tRNA	alanyl-tRNA synthetase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.8e-84
AZU12844.1|2036605_2036818_+	carbon storage regulator	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
AZU12845.1|2038190_2040149_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.1	9.6e-13
>prophage 12
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	2221206	2233983	5219584	transposase,protease	uncultured_virus(100.0%)	10	NA	NA
AZU12977.1|2221206_2221473_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU12978.1|2221466_2222294_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU12979.1|2222318_2223113_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12980.1|2223260_2225636_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12981.1|2225996_2226215_-	hypothetical protein	NA	NA	NA	NA	NA
AZU12982.1|2226732_2227470_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU12983.1|2227553_2227820_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU12984.1|2229960_2230290_+	hypothetical protein	NA	NA	NA	NA	NA
AZU12985.1|2230280_2231507_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU12986.1|2233431_2233983_-|protease	CAAX protease	protease	NA	NA	NA	NA
>prophage 13
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	2393263	2441244	5219584	transposase	Ralstonia_phage(40.0%)	34	NA	NA
AZU13094.1|2393263_2393530_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU13095.1|2393523_2394351_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU13096.1|2395369_2397028_-	chemotaxis protein	NA	NA	NA	NA	NA
AZU13097.1|2397030_2397657_-	chemotaxis protein	NA	NA	NA	NA	NA
AZU13098.1|2397656_2398049_-	histidine kinase	NA	NA	NA	NA	NA
AZU13099.1|2398084_2398852_-	flagellar biosynthesis sigma factor	NA	NA	NA	NA	NA
AZU13100.1|2398848_2399733_-	cobyrinic acid a,c-diamide synthase	NA	NA	NA	NA	NA
AZU13101.1|2399719_2401411_-	flagellar biosynthesis regulator FlhF	NA	NA	NA	NA	NA
AZU13102.1|2402162_2404256_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AZU13103.1|2404252_2405383_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
AZU13104.1|2405737_2407825_-	membrane protein	NA	G3MA91	Bacillus_virus	34.9	6.6e-20
AZU13105.1|2411258_2412242_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU13106.1|2415708_2416500_-	flagellar biosynthesis protein FliR	NA	NA	NA	NA	NA
AZU13107.1|2416513_2416783_-	flagellar biogenesis protein	NA	NA	NA	NA	NA
AZU13108.1|2417233_2418217_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU13109.1|2418878_2419724_-	flagellar biosynthesis protein flip	NA	NA	NA	NA	NA
AZU13110.1|2419725_2420133_-	flagellar protein	NA	NA	NA	NA	NA
AZU13111.1|2420129_2420468_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AZU13112.1|2420464_2421478_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AZU13113.1|2421488_2422016_-	flagellar basal body protein FliL	NA	NA	NA	NA	NA
AZU13114.1|2422206_2423499_-	flagellar protein	NA	NA	NA	NA	NA
AZU13115.1|2423495_2423951_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
AZU13116.1|2423954_2425331_-	flagellar protein FliI	NA	NA	NA	NA	NA
AZU13117.1|2425327_2425948_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AZU13118.1|2425944_2426934_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AZU13119.1|2426944_2428669_-	flagellar MS-ring protein	NA	NA	NA	NA	NA
AZU13120.1|2428682_2429054_-	flagellar hook-basal body protein	NA	NA	NA	NA	NA
AZU13121.1|2429483_2432978_-	O-antigen biosynthesis protein	NA	K7QL84	Escherichia_phage	25.9	6.5e-12
AZU13122.1|2433424_2433670_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13123.1|2436057_2436786_-	methyltransferase	NA	NA	NA	NA	NA
AZU13124.1|2436797_2437547_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AZU13125.1|2437590_2438874_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13126.1|2439816_2441043_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU13127.1|2441127_2441244_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	2570237	2591834	5219584	transposase,protease	uncultured_virus(75.0%)	17	NA	NA
AZU13228.1|2570237_2572973_-|protease	serine protease	protease	NA	NA	NA	NA
AZU13229.1|2574096_2574372_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13230.1|2574849_2575266_+	membrane protein	NA	NA	NA	NA	NA
AZU13231.1|2575262_2576576_+	sorbosone dehydrogenase	NA	NA	NA	NA	NA
AZU13232.1|2576814_2576997_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13233.1|2577031_2578258_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU13234.1|2578300_2579329_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13235.1|2580003_2580987_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU13236.1|2581067_2582294_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU13237.1|2584060_2584381_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13238.1|2584824_2586051_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU13239.1|2586888_2588253_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZU13240.1|2588547_2589216_-	glycosyl transferase	NA	NA	NA	NA	NA
AZU13241.1|2589212_2589815_-	methyltransferase	NA	NA	NA	NA	NA
AZU13242.1|2589811_2590570_-	N- acetylglucosaminylphosphatidylinositol deacetylase	NA	NA	NA	NA	NA
AZU13243.1|2590557_2591076_-	dehydrogenase	NA	NA	NA	NA	NA
AZU13244.1|2591567_2591834_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	2822020	2872133	5219584	tRNA,transposase,protease	Moumouvirus(12.5%)	47	NA	NA
AZU13449.1|2822020_2823448_+|tRNA	cysteinyl-tRNA synthetase	tRNA	M1PG92	Moumouvirus	32.6	2.4e-37
AZU13450.1|2824012_2824450_+	Fe-S cluster assembly protein SufE	NA	NA	NA	NA	NA
AZU13451.1|2824446_2825697_+	multidrug transporter	NA	NA	NA	NA	NA
AZU13452.1|2825902_2826403_-	molecular chaperone DnaK	NA	NA	NA	NA	NA
AZU13453.1|2826449_2827028_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13454.1|2827027_2827321_+	membrane protein	NA	NA	NA	NA	NA
AZU13455.1|2827317_2828667_+	dihydroorotase	NA	NA	NA	NA	NA
AZU13456.1|2828666_2829509_+	peptidase M23	NA	A0A075BS18	Microcystis_phage	43.0	1.3e-14
AZU13457.1|2829583_2830126_+	glyoxalase	NA	NA	NA	NA	NA
AZU13458.1|2830544_2831909_+	ethanolamine permease	NA	NA	NA	NA	NA
AZU13459.1|2831905_2833315_+	ethanolamine ammonia-lyase	NA	NA	NA	NA	NA
AZU13460.1|2833311_2834127_+	ethanolamine ammonia-lyase	NA	NA	NA	NA	NA
AZU13461.1|2834183_2834474_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13462.1|2834567_2835449_-	beta-lactamase	NA	NA	NA	NA	NA
AZU13463.1|2835568_2836057_-	general stress protein	NA	NA	NA	NA	NA
AZU13464.1|2836667_2837513_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13465.1|2838886_2839870_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU13466.1|2840608_2842279_+	polygalacturonase	NA	NA	NA	NA	NA
AZU13467.1|2842364_2842631_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU13468.1|2842624_2843452_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU13469.1|2843689_2844379_-	phytoene synthase	NA	NA	NA	NA	NA
AZU13470.1|2844407_2845100_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AZU13471.1|2845185_2845905_-	3-demethylubiquinone-9 3-methyltransferase	NA	NA	NA	NA	NA
AZU13472.1|2845936_2847274_-	N-ethylammeline chlorohydrolase	NA	NA	NA	NA	NA
AZU13473.1|2847291_2848104_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13474.1|2848298_2848865_-	elongation factor P	NA	NA	NA	NA	NA
AZU13475.1|2848967_2849996_+	lysine 2,3-aminomutase	NA	NA	NA	NA	NA
AZU13476.1|2850229_2852347_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AZU13477.1|2852343_2853273_-	metal-binding protein	NA	NA	NA	NA	NA
AZU13478.1|2853324_2854089_-	RNA methyltransferase	NA	NA	NA	NA	NA
AZU13479.1|2854206_2855040_+	inositol monophosphatase	NA	NA	NA	NA	NA
AZU13480.1|2855235_2855847_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
AZU13481.1|2856101_2856542_+	ribonuclease	NA	NA	NA	NA	NA
AZU13482.1|2856538_2856964_+	barnase inhibitor	NA	NA	NA	NA	NA
AZU13483.1|2857246_2859136_-	ABC transporter ATPase	NA	A0A2K9L3Z8	Tupanvirus	27.4	3.6e-49
AZU13484.1|2859246_2860623_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	1.2e-54
AZU13485.1|2860724_2861285_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	49.0	6.5e-31
AZU13486.1|2861379_2862936_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13487.1|2863217_2864093_+	carboxylesterase	NA	NA	NA	NA	NA
AZU13488.1|2864187_2865015_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU13489.1|2865008_2865275_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU13490.1|2865502_2866201_-	glutathione S-transferase	NA	NA	NA	NA	NA
AZU13491.1|2866371_2866581_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	63.9	5.7e-17
AZU13492.1|2867136_2867685_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13493.1|2867681_2868863_+	membrane protein	NA	NA	NA	NA	NA
AZU13494.1|2869084_2871154_+	membrane protein	NA	NA	NA	NA	NA
AZU13495.1|2871254_2872133_-|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 16
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	2985977	3015302	5219584	tRNA,transposase	uncultured_Mediterranean_phage(83.33%)	29	NA	NA
AZU13579.1|2985977_2987204_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU13580.1|2987857_2988826_-	preprotein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	29.9	8.9e-28
AZU13581.1|2988940_2990785_-	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
AZU13582.1|2990975_2991329_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AZU13583.1|2991460_2992606_-|tRNA	queuine tRNA-ribosyltransferase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.9	1.9e-85
AZU13584.1|2992687_2993758_-|tRNA	S-adenosylmethionine:tRNA ribosyltransferase-isomerase	tRNA	NA	NA	NA	NA
AZU13585.1|2993911_2994343_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZU13586.1|2994342_2994447_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13587.1|2994464_2995961_+	lysine 6-aminotransferase	NA	NA	NA	NA	NA
AZU13588.1|2996103_2996301_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13589.1|2996297_2997005_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13590.1|2997380_2998760_-	phosphoesterase	NA	NA	NA	NA	NA
AZU13591.1|2998756_2999878_-	phytase	NA	NA	NA	NA	NA
AZU13592.1|2999874_3002433_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU13593.1|3002584_3003217_+	Uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AZU13594.1|3003590_3005351_-	cellulase	NA	NA	NA	NA	NA
AZU13595.1|3005347_3005461_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13596.1|3005641_3007420_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AZU13597.1|3007416_3007701_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.1e-18
AZU13598.1|3007691_3007874_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13599.1|3007932_3008430_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13600.1|3008476_3008983_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
AZU13601.1|3008979_3009603_-	methyltransferase	NA	NA	NA	NA	NA
AZU13602.1|3009842_3011747_+	heat shock protein 90	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.4	2.3e-112
AZU13603.1|3012340_3013078_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU13604.1|3013160_3013427_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU13605.1|3013420_3014248_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU13606.1|3014360_3014627_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU13607.1|3015035_3015302_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	3018331	3069646	5219584	terminase,integrase,transposase,plate,head,portal,capsid,tail	Stenotrophomonas_phage(55.17%)	59	3018263:3018322	3077936:3078324
3018263:3018322	attL	GGTAATCCCCCCGCCCATTAGCAGACGCCAGAAGTGGAATTTTCTCGTATCCTTTCTCGA	NA	NA	NA	NA
AZU13609.1|3018331_3018598_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU13610.1|3018717_3019146_+	hypothetical protein	NA	A0A218MND5	uncultured_virus	58.5	1.5e-08
AZU13611.1|3020000_3020267_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU13612.1|3020927_3021569_-	carboxypeptidase	NA	NA	NA	NA	NA
AZU13613.1|3023435_3024497_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13614.1|3024597_3025320_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13615.1|3025426_3027880_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13616.1|3027981_3028251_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13617.1|3028285_3028696_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13618.1|3028753_3029584_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13619.1|3029646_3030687_-	type IV secretion system energizing component VirB11	NA	NA	NA	NA	NA
AZU13620.1|3030701_3031871_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13621.1|3031867_3032635_-	Type IV secretory pathway, VirB9 component	NA	NA	NA	NA	NA
AZU13622.1|3032631_3033663_-	conjugative transfer protein	NA	NA	NA	NA	NA
AZU13623.1|3033788_3034199_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13624.1|3034531_3036205_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13625.1|3036241_3036484_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13626.1|3037362_3039384_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AZU13627.1|3040280_3041510_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.2	5.3e-118
AZU13628.1|3041509_3041728_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	55.9	3.3e-15
AZU13629.1|3041724_3041934_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13630.1|3041930_3042203_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13631.1|3042199_3042424_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13632.1|3042420_3042693_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13633.1|3042685_3042868_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13634.1|3042860_3043286_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13635.1|3043364_3043637_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13636.1|3043636_3043924_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13637.1|3043920_3044139_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13638.1|3044462_3046883_-	toprim domain protein	NA	V9IQW5	Stenotrophomonas_phage	68.8	4.0e-271
AZU13639.1|3046885_3047731_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.7	1.5e-44
AZU13640.1|3047724_3047988_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU13641.1|3048217_3049204_-	phage late control protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	51.8	1.7e-90
AZU13642.1|3049200_3049599_-	oxidoreductase	NA	V9IQX3	Stenotrophomonas_phage	61.4	4.6e-39
AZU13643.1|3049611_3052482_-|tail	tail protein	tail	V9IQL1	Stenotrophomonas_phage	48.0	1.2e-194
AZU13644.1|3052511_3052625_-	P2 GpE family protein	NA	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
AZU13645.1|3052633_3052936_-|tail	tail protein	tail	V9IQM4	Stenotrophomonas_phage	67.4	4.9e-25
AZU13646.1|3052980_3053490_-|tail	major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	80.5	3.6e-73
AZU13647.1|3053520_3054687_-|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	63.2	5.9e-135
AZU13648.1|3054698_3055058_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.9	1.5e-36
AZU13649.1|3055054_3055618_-|plate	baseplate assembly protein	plate	Q9ZXL0	Pseudomonas_virus	47.0	1.4e-25
AZU13650.1|3055678_3056257_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
AZU13651.1|3056266_3057772_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	46.6	1.0e-51
AZU13652.1|3057781_3058327_-|tail	tail protein	tail	V9IQK7	Stenotrophomonas_phage	54.7	4.6e-50
AZU13653.1|3058319_3058763_-|plate	baseplate assembly protein	plate	R4JDM0	Burkholderia_phage	53.8	1.3e-34
AZU13654.1|3059028_3059829_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU13655.1|3059849_3060116_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU13656.1|3060715_3061162_-|tail	tail protein	tail	V9IQH0	Stenotrophomonas_phage	62.4	1.6e-40
AZU13657.1|3061149_3061569_-|tail	tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	63.7	8.2e-39
AZU13658.1|3061565_3062054_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	51.7	7.6e-28
AZU13659.1|3062053_3062692_-	lysozyme	NA	V9IQK6	Stenotrophomonas_phage	61.5	2.1e-49
AZU13660.1|3062691_3062967_-	hypothetical protein	NA	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
AZU13661.1|3062959_3063316_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
AZU13662.1|3063320_3063530_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
AZU13663.1|3063529_3063997_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.0	1.2e-30
AZU13664.1|3064095_3064815_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	62.9	2.2e-68
AZU13665.1|3064818_3065838_-|capsid	capsid protein	capsid	Q9ZXM3	Pseudomonas_virus	69.7	6.7e-135
AZU13666.1|3065884_3066727_-|capsid	phage capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.1	2.9e-67
AZU13667.1|3068632_3069646_+|portal	Presumed portal vertex protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.8	3.6e-141
3077936:3078324	attR	GGTAATCCCCCCGCCCATTAGCAGACGCCAGAAGTGGAATTTTCTCGTATCCTTTCTCGAGGAGGTTCCATGAAGAAGTCCCGCTTTACCGACAGCCAGATCATCGCCGTGCTCAAGCAGGCCCAGGCCGGTGCGCCCGTGCCGGAGCTGTGCCGCGAGCACGGCATCAGCTCGGCCACGTTCTACAAGTGGCGCAGCAAGTTCGGCGGCATGGACGTGTCCATGGTCGCGCGCATGAAGGAGCTGGAGGAGGAGAACCGCCGGCTCAAGAAGATGTACGCCGAGGCGCAGCTCAGTACCGACCTGCTGAAGGAAGCGCTCGCAAAAAAATGGTGAGGCCATCTCAGCGACGCGAGATGGCCCAATCGGCAGTCACGAGCGGGCGTACG	NA	NA	NA	NA
>prophage 18
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	3076561	3104327	5219584	tRNA,transposase	Leptospira_phage(25.0%)	26	NA	NA
AZU13672.1|3076561_3076825_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU13673.1|3076818_3077664_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.7	1.5e-44
AZU13674.1|3078004_3078271_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU13675.1|3078354_3079092_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU15415.1|3079715_3080147_-	pilus assembly protein PilE	NA	NA	NA	NA	NA
AZU13676.1|3080370_3080637_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU13677.1|3080630_3081458_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU13678.1|3084708_3085263_-	pilus assembly protein	NA	NA	NA	NA	NA
AZU13679.1|3085259_3086285_-	Tfp pilus assembly protein PilW	NA	NA	NA	NA	NA
AZU13680.1|3086281_3086749_-	prepilin	NA	NA	NA	NA	NA
AZU13681.1|3086760_3087333_-	prepilin	NA	NA	NA	NA	NA
AZU13682.1|3087501_3088530_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	34.6	1.7e-16
AZU13683.1|3088531_3089917_-	LOG family protein	NA	NA	NA	NA	NA
AZU13684.1|3090023_3093248_-	Oar protein	NA	NA	NA	NA	NA
AZU13685.1|3093873_3094473_-	membrane protein	NA	NA	NA	NA	NA
AZU13686.1|3094469_3095213_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AZU13687.1|3095209_3095530_-	glutaredoxin	NA	NA	NA	NA	NA
AZU13688.1|3095651_3096230_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	42.2	4.0e-36
AZU13689.1|3096371_3097517_-	phosphoribosylaminoimidazole carboxylase	NA	NA	NA	NA	NA
AZU13690.1|3097513_3098017_-	N5-carboxyaminoimidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.1	2.4e-16
AZU13691.1|3098075_3098345_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13692.1|3098341_3099229_+	nicotinate-nucleotide pyrophosphorylase	NA	NA	NA	NA	NA
AZU13693.1|3099292_3100351_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13694.1|3100700_3102815_-	polynucleotide phosphorylase/polyadenylase	NA	NA	NA	NA	NA
AZU13695.1|3102983_3103244_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
AZU13696.1|3103400_3104327_-|tRNA	tRNA pseudouridine synthase B	tRNA	NA	NA	NA	NA
>prophage 19
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	3398739	3457309	5219584	transposase	Prochlorococcus_phage(25.0%)	57	NA	NA
AZU13947.1|3398739_3399966_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU13948.1|3400131_3401103_+	thiamine biosynthesis protein ApbE	NA	NA	NA	NA	NA
AZU13949.1|3401099_3402881_+	sulfite reductase	NA	NA	NA	NA	NA
AZU13950.1|3403124_3403982_-	HutD-family protein	NA	NA	NA	NA	NA
AZU13951.1|3404408_3404741_-	competence protein ComEA	NA	NA	NA	NA	NA
AZU13952.1|3404940_3406434_+	peptidase M20	NA	NA	NA	NA	NA
AZU13953.1|3406969_3407242_+	membrane protein	NA	NA	NA	NA	NA
AZU13954.1|3407299_3408319_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AZU13955.1|3408315_3409026_+	mannose-1-phosphate guanylyltransferase	NA	A0A1D7XFC1	Escherichia_phage	33.9	3.3e-08
AZU13956.1|3409246_3409948_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13957.1|3409944_3411111_-	membrane protein	NA	NA	NA	NA	NA
AZU13958.1|3411107_3412220_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13959.1|3412350_3413376_+	phosphoribosylaminoimidazole synthetase	NA	Q58MH8	Prochlorococcus_phage	44.1	2.1e-72
AZU13960.1|3413393_3413852_+	membrane protein	NA	NA	NA	NA	NA
AZU13961.1|3413874_3414492_+	membrane protein	NA	NA	NA	NA	NA
AZU13962.1|3414478_3415147_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.7	1.0e-19
AZU13963.1|3415213_3416041_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13964.1|3416044_3416728_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13965.1|3417288_3417612_-	membrane protein	NA	NA	NA	NA	NA
AZU13966.1|3417608_3418883_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZU13967.1|3419134_3419362_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AZU13968.1|3419415_3420417_+	D-arabinose 5-phosphate isomerase	NA	E3T535	Cafeteria_roenbergensis_virus	24.9	1.4e-12
AZU13969.1|3420465_3421014_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	NA	NA	NA	NA
AZU13970.1|3421010_3421586_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13971.1|3421572_3422145_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13972.1|3422144_3422864_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.3	5.6e-27
AZU13973.1|3422904_3424344_+	RNA polymerase sigma54 factor	NA	NA	NA	NA	NA
AZU13974.1|3424431_3424749_+	ribosome hibernation promoting factor HPF	NA	NA	NA	NA	NA
AZU13975.1|3424770_3425229_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
AZU13976.1|3425225_3426176_+	serine kinase	NA	NA	NA	NA	NA
AZU13977.1|3426172_3427045_+	nucleotide-binding protein	NA	A0A0R8VB27	Thermobifida_phage	30.5	7.8e-07
AZU13978.1|3427577_3427970_+	PTS system fructose IIA component family protein	NA	NA	NA	NA	NA
AZU13979.1|3427962_3428232_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AZU13980.1|3429979_3430333_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13981.1|3430647_3432009_+	magnesium transporter	NA	NA	NA	NA	NA
AZU13982.1|3432150_3432948_+	phospholipase	NA	NA	NA	NA	NA
AZU13983.1|3432982_3433999_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AZU13984.1|3434101_3434929_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU13985.1|3434922_3435189_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU13986.1|3435307_3435430_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU13987.1|3436718_3437429_+	type IV secretory pathway, TrbF protein	NA	NA	NA	NA	NA
AZU13988.1|3437455_3438448_+	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
AZU13989.1|3438463_3439819_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
AZU13990.1|3439991_3440198_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13991.1|3440208_3440448_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13992.1|3440520_3440769_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13993.1|3442608_3446217_-	hypothetical protein	NA	NA	NA	NA	NA
AZU13994.1|3447103_3448381_-	murein transglycosylase	NA	NA	NA	NA	NA
AZU13995.1|3448512_3449259_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	35.7	9.2e-33
AZU13996.1|3449859_3450237_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13997.1|3450788_3450977_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13998.1|3451176_3451776_+	hypothetical protein	NA	NA	NA	NA	NA
AZU13999.1|3452395_3452662_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU14000.1|3452918_3453224_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14001.1|3453822_3454152_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15412.1|3454644_3455487_-	Xanthomonas outer protein AF, type III effector XopAF	NA	NA	NA	NA	NA
AZU14002.1|3456481_3457309_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	3544716	3630935	5219584	transposase,protease	uncultured_virus(27.27%)	58	NA	NA
AZU14068.1|3544716_3544983_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU14069.1|3545185_3546412_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU14070.1|3547281_3547737_-	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
AZU14071.1|3548514_3548742_+	hypothetical protein	NA	NA	NA	NA	NA
AZU14072.1|3548742_3549138_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
AZU14073.1|3549285_3550395_-	glycine cleavage system protein T	NA	NA	NA	NA	NA
AZU14074.1|3550568_3551003_-	membrane protein	NA	NA	NA	NA	NA
AZU14075.1|3551006_3551969_-	membrane protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	33.5	1.5e-22
AZU14076.1|3552127_3552463_-	membrane protein	NA	A0A218MNG8	uncultured_virus	57.8	6.8e-28
AZU14077.1|3553704_3554505_-	3'-5'-bisphosphate nucleotidase	NA	NA	NA	NA	NA
AZU14078.1|3554501_3555050_-	ADP-ribose diphosphatase	NA	NA	NA	NA	NA
AZU14079.1|3555091_3556510_+	adenosylmethionine-8-amino-7-oxononanoate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	20.7	2.1e-09
AZU14080.1|3556500_3557235_+	16S rRNA methyltransferase	NA	NA	NA	NA	NA
AZU14081.1|3557546_3558563_-	glucokinase	NA	NA	NA	NA	NA
AZU14082.1|3560994_3561732_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14083.1|3561815_3562082_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14084.1|3563334_3565020_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
AZU14085.1|3565023_3566091_+	glycosyl hydrolase	NA	A0A2P1CFB9	Microbacterium_phage	23.4	1.1e-07
AZU14086.1|3566355_3568806_+	beta-hexosaminidase	NA	NA	NA	NA	NA
AZU14087.1|3568827_3571518_+	beta-mannosidase	NA	NA	NA	NA	NA
AZU14088.1|3572001_3574662_+	glycoside hydrolase family 3	NA	NA	NA	NA	NA
AZU14089.1|3575244_3576708_+	Tat pathway signal protein	NA	NA	NA	NA	NA
AZU14090.1|3576818_3579161_+	alpha-mannosidase	NA	NA	NA	NA	NA
AZU14091.1|3579475_3581311_+	beta-galactosidase	NA	NA	NA	NA	NA
AZU14092.1|3581360_3583799_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AZU14093.1|3584533_3584734_+	hypothetical protein	NA	NA	NA	NA	NA
AZU14094.1|3584791_3585121_-	R body protein RebB-like protein	NA	NA	NA	NA	NA
AZU14095.1|3587089_3588805_+	leucine-rich repeat (LRR) protein	NA	NA	NA	NA	NA
AZU14096.1|3588909_3589641_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AZU14097.1|3589637_3590702_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
AZU14098.1|3591412_3591610_+	hypothetical protein	NA	NA	NA	NA	NA
AZU14099.1|3591636_3592230_-	alanine acetyltransferase	NA	NA	NA	NA	NA
AZU14100.1|3592461_3592938_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AZU14101.1|3592971_3594159_-	chemotaxis protein	NA	NA	NA	NA	NA
AZU14102.1|3594166_3601372_-	chemotaxis protein CheY	NA	W8CYM9	Bacillus_phage	31.9	1.3e-11
AZU14103.1|3601485_3603522_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.2	3.6e-23
AZU14104.1|3603561_3604092_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AZU14105.1|3604091_3604454_-	chemotaxis protein CheY	NA	A0A220YL79	Alteromonas_virus	27.7	4.1e-10
AZU14106.1|3604471_3604873_-	pilus assembly protein PilG	NA	NA	NA	NA	NA
AZU14107.1|3605109_3606060_+	glutathione synthetase	NA	NA	NA	NA	NA
AZU14108.1|3606056_3606932_+	energy transducer TonB	NA	NA	NA	NA	NA
AZU14109.1|3607277_3608195_-	ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	47.1	2.0e-66
AZU14110.1|3608191_3608911_-|protease	glycoprotease	protease	NA	NA	NA	NA
AZU14111.1|3609129_3609225_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14112.1|3609272_3611264_-	helicase	NA	A0A127AW80	Bacillus_phage	33.0	1.9e-93
AZU14113.1|3611542_3612067_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14114.1|3612080_3614525_-	penicillin-binding protein	NA	NA	NA	NA	NA
AZU14115.1|3614762_3616847_+	glycosyl transferase	NA	NA	NA	NA	NA
AZU14116.1|3617207_3618650_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14117.1|3618921_3621108_-	(p)ppGpp synthetase	NA	NA	NA	NA	NA
AZU14118.1|3621561_3622461_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
AZU14119.1|3622457_3623210_+	pyrroloquinoline quinone biosynthesis protein PqqC	NA	NA	NA	NA	NA
AZU14120.1|3623206_3623485_+	pyrroloquinoline quinone biosynthesis protein PqqD	NA	NA	NA	NA	NA
AZU14121.1|3623481_3624600_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
AZU14122.1|3624662_3625175_+	hypothetical protein	NA	NA	NA	NA	NA
AZU14123.1|3625600_3627115_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
AZU14124.1|3627417_3628452_+	glucokinase	NA	NA	NA	NA	NA
AZU14125.1|3629708_3630935_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
>prophage 21
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	3746363	3839518	5219584	integrase,transposase	uncultured_virus(21.05%)	84	3789550:3789609	3839495:3840824
AZU14216.1|3746363_3747164_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14217.1|3747184_3747451_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14218.1|3747480_3749322_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.6	7.3e-15
AZU14219.1|3749524_3749959_-	membrane protein	NA	NA	NA	NA	NA
AZU14220.1|3749945_3750470_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14221.1|3750472_3751294_-	laccase	NA	NA	NA	NA	NA
AZU14222.1|3751295_3752291_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AZU14223.1|3752411_3753293_+	competence protein	NA	NA	NA	NA	NA
AZU14224.1|3753607_3754585_+	hypothetical protein	NA	A0A0N9SJH5	Pseudomonas_phage	41.0	1.7e-55
AZU14225.1|3754603_3756244_-	NAD synthetase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	4.9e-95
AZU14226.1|3756266_3756638_-	DNA methyltransferase	NA	NA	NA	NA	NA
AZU14227.1|3757304_3758180_-	succinyl-CoA synthetase subunit alpha	NA	NA	NA	NA	NA
AZU14228.1|3758204_3759374_-	succinyl-CoA synthetase subunit beta	NA	NA	NA	NA	NA
AZU14229.1|3759605_3761219_+	ATPase	NA	NA	NA	NA	NA
AZU14230.1|3761549_3762944_+	chemotaxis protein CheY	NA	NA	NA	NA	NA
AZU14231.1|3763348_3763468_-	pilus assembly protein	NA	NA	NA	NA	NA
AZU14232.1|3763712_3765449_-	general secretion pathway protein GspE	NA	NA	NA	NA	NA
AZU14233.1|3765513_3765969_-	fimbrial protein	NA	NA	NA	NA	NA
AZU14234.1|3766078_3766519_-	fimbrial protein	NA	NA	NA	NA	NA
AZU14235.1|3766812_3768039_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU14236.1|3768210_3769467_+	type II secretory pathway protein	NA	NA	NA	NA	NA
AZU14237.1|3769473_3770337_+	methyltransferase	NA	NA	NA	NA	NA
AZU14238.1|3770347_3770959_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
AZU14239.1|3772259_3772526_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU14240.1|3772546_3773347_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU14241.1|3773729_3775064_-	histidine kinase	NA	NA	NA	NA	NA
AZU14242.1|3775056_3775734_-	XRE family transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
AZU14243.1|3776409_3777297_-	ribosomal protein S6 modification protein	NA	A0A1D7SR78	Cyanophage	32.0	3.5e-31
AZU14244.1|3777788_3779921_+	glycogen debranching protein	NA	NA	NA	NA	NA
AZU14245.1|3780379_3780772_-	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AZU14246.1|3780862_3781255_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14247.1|3781363_3782023_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14248.1|3782779_3783052_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU14249.1|3783069_3783924_+|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU15416.1|3784681_3784873_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14250.1|3784943_3785423_-	RadC family protein	NA	NA	NA	NA	NA
AZU14251.1|3785778_3786516_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14252.1|3786599_3786866_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14253.1|3787020_3787245_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14254.1|3788008_3788992_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
3789550:3789609	attL	GAGCGTGTGCAGAATTTTGTGTAACCGTGGTTTGGGTTACCGCTGAGGAAGTCGCCCCTC	NA	NA	NA	NA
AZU14255.1|3789585_3790812_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU14256.1|3792203_3793430_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU14257.1|3793466_3794249_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	33.1	7.9e-11
AZU14258.1|3794519_3794786_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU14259.1|3794869_3795607_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU14260.1|3796240_3797041_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14261.1|3797061_3797328_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14262.1|3799026_3800307_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	49.3	5.7e-107
AZU14263.1|3800293_3800725_-	peptidase S24	NA	A0A2H4J538	uncultured_Caudovirales_phage	42.0	2.6e-19
AZU14264.1|3801277_3802222_-	membrane protein	NA	NA	NA	NA	NA
AZU14265.1|3802301_3803030_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZU14266.1|3803796_3804585_+	protein kinase	NA	NA	NA	NA	NA
AZU14267.1|3804967_3805837_+	hypothetical protein	NA	A0A142K541	Mycobacterium_phage	27.2	1.5e-05
AZU14268.1|3806017_3806818_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14269.1|3806838_3807105_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14270.1|3807272_3808973_+	hypothetical protein	NA	NA	NA	NA	NA
AZU14271.1|3808989_3809550_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AZU14272.1|3810066_3810465_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14273.1|3810830_3812042_-	nuclease	NA	NA	NA	NA	NA
AZU14274.1|3812254_3813034_+	conjugal transfer protein	NA	NA	NA	NA	NA
AZU14275.1|3813030_3813576_+|integrase	integrase	integrase	NA	NA	NA	NA
AZU14276.1|3813644_3814046_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AZU14277.1|3814167_3816174_+	DNA mismatch repair protein MutL	NA	NA	NA	NA	NA
AZU14278.1|3816213_3819528_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14279.1|3819995_3820193_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14280.1|3820207_3822229_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	26.4	5.0e-33
AZU14281.1|3822771_3824277_+	DNA methyltransferase	NA	Q6V7R9	Burkholderia_virus	44.9	1.4e-101
AZU14282.1|3824714_3825515_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14283.1|3825535_3825802_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14284.1|3825963_3826350_+	hypothetical protein	NA	NA	NA	NA	NA
AZU14285.1|3826445_3826889_+	hypothetical protein	NA	NA	NA	NA	NA
AZU14286.1|3827016_3827730_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZU14287.1|3828026_3828824_+	GTPase	NA	NA	NA	NA	NA
AZU14288.1|3829835_3830573_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14289.1|3830656_3830923_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14290.1|3830988_3831462_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14291.1|3831549_3831750_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14292.1|3831857_3832685_+	hypothetical protein	NA	A0A2C9CYF8	Yersinia_phage	36.1	1.1e-42
AZU14293.1|3832761_3833433_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15417.1|3833549_3833729_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14294.1|3833879_3834140_+	hypothetical protein	NA	NA	NA	NA	NA
AZU14295.1|3834218_3834869_+	hypothetical protein	NA	NA	NA	NA	NA
AZU14296.1|3834942_3836052_+	methyltransferase	NA	NA	NA	NA	NA
AZU14297.1|3838291_3839518_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
3839495:3840824	attR	GAGGGGCGACTTCCTCAGCGGTAACCCAAACCACGGTTACACAAAATTCTGCACACGCTCAACAGGGCTTGATCTGCTGGAGTTCCCCACAATTGTCTTCATGCAATCAGGGTGGAACATCTACACGCTTCAGCAGGCCGCACGTCGCTCATGGCGTATAGGCCAGAAGTTGCGTGTGAGGGTGATCTACTTGGGGTACATGGCCACGTCGCAGATGACGTGCCTTGCTCTGATGGCCAAAAAGATCCTGGTGTCTCAAAGCACGTCGGGCGACGTCCCGGAATCGGGGCTTGACGTGCTCAATCAGGATGGCGACTCAATTGAGGTCGCTTTGGCGCGGCAGCTTGTTGCTGCTTGATGTCCAGAATCAGCCGGCACCCTTCGGGGCGCCGGCTTTTTTTTCTAATGCATACTTCTGCTACCGATGGTTTGACAATCAGCACGCCAGAACATGGATGAGCGCTAATTCGCATTCTTTACTGACCGGGGTTGCTGTCTGCAGGGATGGTATCGGCTTACTGCAACAGGAAGCCGGTTCATGCAAAACATCTGCTGCTCCTCACTCCTGGCTGGCTGTGGTCTGGTAGTCGCTGCCATTTTTACTGGTGGTTGCGCCACTACGTCTTCAGAAGTTCAGCCGCCCCCTACTGAAGAGGTAATCGCTCCCCGCGACCAGACCGATCCGGAGTTGATTCCAGTGATCCGCTATGGGCGCTACACCCTGGTTGAACTGTCTCCTGGCTCAGCACAGCGCGACCTACTGCTGCAGGTCATCGATGTGCGGATGCCAGACGAAGCGAGAGCTAGTGTTGGCGATGGCCTACGCCACGTTCTCAACCGCAGTGGCTACCAAATGTGTGAGACGGGATCAGCCGCCCTTGAACTCTACCCGCTGCCAATGCCCGCCGCCCATCTGCAACTGGGCCCTATGACTCTGCGCGATGCGCTACTCACTCTGGCAGGCCCTGCTTGGGATGTTGAGGTCAATGACAGCACACGGCAGGTGTGCTTTGTCCGTCCTGGAACTCATGTTGACCTTCAATCTCAGGATCTTCGAAGCTCCGAGCCGGCTCAGGTGTTTCCGCAAGATGGAGCCCAGCAATGACTAGATCCAAGATCATCTTCGGCGCGAAACATTCACGAGCCTACTCAATCATCCAGATATTGCTGTGGGTGTGGCTTGTCGGGCTTATGGCCTTAGTGATGATCGCGTTGCTCGCTGTGCAGTCGCAACGCGAAAAGACCCTCAATCGTTTGCACGCGCTGGAGGTAGGTCAGGCGCAAATCGCTGACGCAAATCGGGCGCTACAGGCCCGGCCGGAATCGGCCA	NA	NA	NA	NA
>prophage 22
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	3857755	3904766	5219584	integrase,tRNA,transposase	Bacillus_virus(50.0%)	35	3851094:3851109	3901542:3901557
3851094:3851109	attL	CGACGCCGATGGCATG	NA	NA	NA	NA
AZU14313.1|3857755_3858556_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14314.1|3858576_3858843_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14315.1|3858894_3859839_+	conjugal transfer protein	NA	NA	NA	NA	NA
AZU14316.1|3859912_3861250_+	conjugal transfer protein	NA	NA	NA	NA	NA
AZU14317.1|3861246_3861594_+	hypothetical protein	NA	NA	NA	NA	NA
AZU14318.1|3861609_3863133_+	membrane protein	NA	NA	NA	NA	NA
AZU14319.1|3863144_3863504_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14320.1|3863729_3864488_+	hypothetical protein	NA	NA	NA	NA	NA
AZU14321.1|3864480_3865407_+	hypothetical protein	NA	NA	NA	NA	NA
AZU14322.1|3865436_3865727_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14323.1|3865825_3866848_-	hypothetical protein	NA	G3MA91	Bacillus_virus	34.1	9.1e-23
AZU14324.1|3867236_3869159_+	hypothetical protein	NA	NA	NA	NA	NA
AZU14325.1|3871657_3873034_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14326.1|3873030_3873690_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14327.1|3873686_3874217_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14328.1|3875156_3876293_-	Type IV secretion system protein virB6	NA	NA	NA	NA	NA
AZU14329.1|3876324_3876972_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14330.1|3877991_3879539_-	histidine kinase	NA	NA	NA	NA	NA
AZU14331.1|3880721_3883985_+	DNA helicase	NA	NA	NA	NA	NA
AZU14332.1|3884241_3884508_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU14333.1|3884782_3885520_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14334.1|3885603_3885870_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU14335.1|3886649_3890681_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14336.1|3890695_3891103_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14337.1|3891099_3892017_-	radical SAM protein	NA	NA	NA	NA	NA
AZU14338.1|3892432_3893329_+	hypothetical protein	NA	NA	NA	NA	NA
AZU14339.1|3893532_3894318_+	hypothetical protein	NA	NA	NA	NA	NA
AZU14340.1|3894761_3895646_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AZU14341.1|3896789_3897791_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14342.1|3897823_3898243_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14343.1|3898427_3900308_-|integrase	integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	50.8	2.8e-102
AZU14344.1|3900740_3902525_-	esterase	NA	NA	NA	NA	NA
3901542:3901557	attR	CATGCCATCGGCGTCG	NA	NA	NA	NA
AZU14345.1|3902712_3902913_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AZU14346.1|3902962_3903757_+	thiazole synthase	NA	NA	NA	NA	NA
AZU14347.1|3904007_3904766_+|tRNA	tRNA (guanine-N7)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 23
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	4166343	4188662	5219584	holin,transposase	Shigella_phage(28.57%)	24	NA	NA
AZU14545.1|4166343_4166610_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU14546.1|4166657_4167884_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU14547.1|4167967_4168768_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU14548.1|4169165_4170119_+	DegV domain-containing protein	NA	NA	NA	NA	NA
AZU14549.1|4170669_4171008_+	hypothetical protein	NA	NA	NA	NA	NA
AZU14550.1|4171238_4171511_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU14551.1|4171528_4172383_+|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU14552.1|4172413_4173244_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZU14553.1|4173302_4173878_-	glutathione-dependent formaldehyde-activating protein	NA	NA	NA	NA	NA
AZU14554.1|4173946_4175056_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	1.1e-34
AZU14555.1|4175122_4175398_-	regulator	NA	NA	NA	NA	NA
AZU14556.1|4175727_4176075_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14557.1|4176528_4177629_-	glycosyltransferase	NA	A0A142BZU7	Faustovirus	29.4	5.2e-16
AZU14558.1|4177706_4178486_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU14559.1|4178482_4179985_+	histidine kinase	NA	W8CYF6	Bacillus_phage	24.4	8.7e-14
AZU14560.1|4179996_4180179_+	hypothetical protein	NA	NA	NA	NA	NA
AZU14561.1|4180172_4181555_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AZU14562.1|4181662_4182451_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14563.1|4182542_4183166_-	GTP-binding protein	NA	NA	NA	NA	NA
AZU14564.1|4183309_4184107_+	cytochrome C	NA	NA	NA	NA	NA
AZU14565.1|4184201_4184852_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AZU14566.1|4184943_4185759_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AZU14567.1|4185808_4186546_+	endonuclease	NA	NA	NA	NA	NA
AZU14568.1|4186682_4188662_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	26.1	5.3e-19
>prophage 24
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	4208587	4216638	5219584	coat	Enterobacteria_phage(42.86%)	7	NA	NA
AZU14588.1|4208587_4209934_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.2	4.8e-32
AZU14589.1|4209980_4211384_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.8	1.9e-47
AZU14590.1|4211686_4212853_-	UDP-glucose 6-dehydrogenase	NA	M1HV26	Paramecium_bursaria_Chlorella_virus	57.8	1.6e-116
AZU14591.1|4213193_4214093_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.6e-26
AZU14592.1|4214089_4214647_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	49.4	3.0e-44
AZU14593.1|4214643_4215531_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	57.8	1.7e-94
AZU14594.1|4215582_4216638_-|coat	spore coat protein	coat	I7HTA3	Enterobacteria_phage	45.0	2.4e-79
>prophage 25
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	4637729	4706805	5219584	tRNA,transposase,protease	Listeria_phage(27.27%)	58	NA	NA
AZU14979.1|4637729_4638734_-|tRNA	tRNA-dihydrouridine synthase A	tRNA	NA	NA	NA	NA
AZU14980.1|4639190_4639415_-	membrane protein	NA	NA	NA	NA	NA
AZU14981.1|4639990_4640596_-	ankyrin	NA	NA	NA	NA	NA
AZU14982.1|4640655_4642179_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.3	9.8e-98
AZU14983.1|4642553_4643165_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14984.1|4643161_4644295_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14985.1|4644315_4644483_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14986.1|4646213_4647440_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU14987.1|4647420_4648026_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14988.1|4648022_4649162_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14989.1|4649449_4651582_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
AZU14990.1|4651878_4652115_-	membrane protein	NA	NA	NA	NA	NA
AZU14991.1|4652111_4652486_-	membrane protein	NA	NA	NA	NA	NA
AZU14992.1|4652475_4653327_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
AZU14993.1|4653391_4654273_+	TolB-like protein	NA	NA	NA	NA	NA
AZU14994.1|4654921_4657456_-	iron-uptake factor	NA	NA	NA	NA	NA
AZU14995.1|4657686_4658439_+	endonuclease	NA	H6X497	Enterobacteria_phage	33.8	3.0e-23
AZU14996.1|4658810_4659803_-	delta-aminolevulinic acid dehydratase	NA	NA	NA	NA	NA
AZU14997.1|4659827_4659989_-	hypothetical protein	NA	NA	NA	NA	NA
AZU14998.1|4660012_4660261_-	membrane protein	NA	NA	NA	NA	NA
AZU14999.1|4660477_4660948_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15000.1|4661046_4662837_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15001.1|4663739_4665989_-	peptidase S9	NA	NA	NA	NA	NA
AZU15002.1|4667216_4667408_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15003.1|4667574_4670589_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU15004.1|4670775_4671477_+	peptidase	NA	NA	NA	NA	NA
AZU15005.1|4671466_4672480_+	cupin	NA	NA	NA	NA	NA
AZU15006.1|4672490_4674056_+	tryptophan halogenase	NA	E3SL43	Synechococcus_phage	28.5	2.5e-40
AZU15007.1|4674195_4675206_+	energy transducer TonB	NA	NA	NA	NA	NA
AZU15008.1|4675452_4676646_-	sodium ABC transporter permease	NA	NA	NA	NA	NA
AZU15009.1|4676642_4677389_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.2e-19
AZU15010.1|4677420_4679022_-|protease	cysteine protease	protease	NA	NA	NA	NA
AZU15011.1|4679082_4679283_-	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
AZU15012.1|4679279_4679867_-	membrane protein	NA	NA	NA	NA	NA
AZU15013.1|4680307_4681870_+	beta-xylosidase	NA	NA	NA	NA	NA
AZU15014.1|4681959_4682232_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15015.1|4682296_4683310_+	cation transporter	NA	NA	NA	NA	NA
AZU15016.1|4683401_4684124_-	phenol hydroxylase	NA	NA	NA	NA	NA
AZU15017.1|4684265_4685261_+	ABC transporter	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.1	1.0e-23
AZU15018.1|4685278_4686070_+	membrane protein	NA	NA	NA	NA	NA
AZU15019.1|4686075_4687014_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AZU15020.1|4687793_4688060_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU15021.1|4688080_4688881_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU15022.1|4689171_4689576_-	thioesterase	NA	NA	NA	NA	NA
AZU15023.1|4689612_4690065_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15024.1|4690102_4690429_-	thioredoxin	NA	NA	NA	NA	NA
AZU15025.1|4690400_4690895_-	flavodoxin	NA	A0A068CFW0	Listeria_phage	36.1	6.1e-17
AZU15026.1|4691120_4691591_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15027.1|4691590_4692289_-	hypothetical protein	NA	I3NLD4	Bifidobacterium_phage	28.1	1.6e-15
AZU15028.1|4692331_4693375_-	ribonucleotide-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	76.0	8.6e-154
AZU15029.1|4693552_4696051_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A088FNW1	Listeria_phage	67.1	6.4e-304
AZU15030.1|4696653_4697697_-	hypothetical protein	NA	A0A172Q0Y5	Acinetobacter_phage	50.7	1.1e-79
AZU15031.1|4697802_4700511_-	GCN5 family acetyltransferase	NA	NA	NA	NA	NA
AZU15032.1|4700625_4701993_-	magnesium transporter	NA	NA	NA	NA	NA
AZU15033.1|4702575_4703403_+	carbonic anhydrase	NA	NA	NA	NA	NA
AZU15034.1|4703620_4705426_+	potassium transporter KefB	NA	NA	NA	NA	NA
AZU15035.1|4705717_4705984_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU15036.1|4706067_4706805_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 26
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	4964162	5035371	5219584	transposase	Bacillus_phage(33.33%)	49	NA	NA
AZU15222.1|4964162_4964429_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU15223.1|4964512_4965250_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU15224.1|4965522_4965765_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15225.1|4966045_4966564_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15226.1|4968877_4969717_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15227.1|4971617_4972190_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15228.1|4972342_4972546_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15229.1|4972980_4973961_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZU15230.1|4974298_4976968_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZU15231.1|4976967_4977939_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15232.1|4978349_4979402_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZU15233.1|4979569_4982608_+	membrane protein	NA	NA	NA	NA	NA
AZU15234.1|4982659_4982782_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15235.1|4982933_4985969_+	membrane protein	NA	NA	NA	NA	NA
AZU15236.1|4985992_4987594_+	tryptophan halogenase	NA	M4T1E3	Cyanophage	29.2	6.3e-47
AZU15237.1|4987978_4988707_-	orotidine 5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AZU15238.1|4988703_4989669_-	acid phosphatase	NA	NA	NA	NA	NA
AZU15239.1|4990018_4990675_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15240.1|4990838_4991690_-	radical SAM protein	NA	NA	NA	NA	NA
AZU15241.1|4991697_4993059_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AZU15242.1|4993055_4993898_-	metalloenzyme domain-containing protein	NA	NA	NA	NA	NA
AZU15243.1|4993866_4994961_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15244.1|4994980_4995892_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15245.1|4996034_4997156_+	ATPase AAA	NA	A0A2H4PB07	Aphanizomenon_phage	28.9	4.3e-18
AZU15246.1|4997152_4997566_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15247.1|4997562_4999410_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15248.1|5002208_5003243_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15249.1|5003294_5003831_-	acetyltransferase	NA	NA	NA	NA	NA
AZU15250.1|5004393_5006370_-	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	8.2e-113
AZU15251.1|5006578_5007208_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.6	6.7e-53
AZU15252.1|5007636_5008881_+	histidine kinase	NA	NA	NA	NA	NA
AZU15253.1|5009043_5010645_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AZU15254.1|5010713_5011691_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15255.1|5012349_5013087_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU15256.1|5013170_5013437_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU15257.1|5013582_5014398_-	5-hydroxymethyluracil DNA glycosylase	NA	A0A127AWE5	Bacillus_phage	27.4	8.3e-19
AZU15258.1|5021157_5022339_+	membrane protein	NA	NA	NA	NA	NA
AZU15259.1|5022413_5024318_-	phytochrome	NA	Q6XLU9	Feldmannia_irregularis_virus	27.4	1.1e-18
AZU15260.1|5024314_5024908_-	heme oxygenase	NA	NA	NA	NA	NA
AZU15261.1|5025007_5026273_-	MFS transporter	NA	NA	NA	NA	NA
AZU15262.1|5026869_5029032_-	epimerase	NA	NA	NA	NA	NA
AZU15263.1|5029210_5029417_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15264.1|5029633_5029912_-	zinc chelation protein SecC	NA	NA	NA	NA	NA
AZU15265.1|5031210_5031570_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15266.1|5031581_5031896_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15267.1|5031976_5032747_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15268.1|5032849_5033191_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU15269.1|5034283_5034550_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU15270.1|5034633_5035371_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	5055043	5115470	5219584	integrase,transposase	uncultured_virus(66.67%)	41	5044585:5044599	5122758:5122772
5044585:5044599	attL	GCTGCAGGGCTTTGC	NA	NA	NA	NA
AZU15287.1|5055043_5056270_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU15288.1|5056441_5060464_+	ATP-binding protein	NA	NA	NA	NA	NA
AZU15289.1|5060538_5061342_-	membrane protein	NA	NA	NA	NA	NA
AZU15290.1|5061619_5063173_+|integrase	integrase	integrase	NA	NA	NA	NA
AZU15291.1|5063577_5064804_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU15292.1|5065312_5066932_+	enterochelin esterase	NA	NA	NA	NA	NA
AZU15293.1|5067035_5067434_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15294.1|5068197_5068890_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15295.1|5068920_5069823_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AZU15296.1|5070155_5071733_+	chlamydia polymorphic membrane family protein	NA	NA	NA	NA	NA
AZU15297.1|5072657_5072924_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU15298.1|5073180_5073486_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15299.1|5078051_5080103_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15300.1|5080196_5081216_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15301.1|5082356_5084942_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15302.1|5085880_5086858_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15303.1|5086988_5088632_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15304.1|5089051_5090230_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15305.1|5090306_5091950_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15306.1|5092238_5092763_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15307.1|5092943_5094023_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15308.1|5094019_5094781_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15309.1|5094789_5095056_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15310.1|5095058_5095751_-	type III secretion system protein	NA	NA	NA	NA	NA
AZU15311.1|5095750_5096803_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15312.1|5097027_5097492_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15313.1|5097991_5098429_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15314.1|5098430_5099780_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15315.1|5099782_5100142_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15316.1|5100202_5102299_-	type III secretion system protein InvA	NA	NA	NA	NA	NA
AZU15317.1|5102548_5103664_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15318.1|5106715_5107828_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15319.1|5107860_5108130_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15320.1|5108195_5108480_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15321.1|5109932_5110607_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15322.1|5110603_5110837_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15323.1|5111018_5111333_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU15324.1|5111332_5112148_+|integrase	integrase	integrase	NA	NA	NA	NA
AZU15325.1|5113138_5113441_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15326.1|5113984_5114245_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15327.1|5114294_5115470_+|integrase	integrase	integrase	Q5QBN6	Enterobacteria_phage	25.4	8.5e-17
5122758:5122772	attR	GCTGCAGGGCTTTGC	NA	NA	NA	NA
>prophage 28
CP012048	Xanthomonas axonopodis pv. phaseoli strain ISO18C2, complete genome	5219584	5125316	5181948	5219584	tail,transposase	Shigella_phage(16.67%)	51	NA	NA
AZU15333.1|5125316_5126300_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU15334.1|5126403_5126814_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15335.1|5128338_5128644_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15336.1|5128775_5129576_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU15337.1|5129596_5129863_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU15338.1|5129927_5130857_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15339.1|5130850_5131306_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15340.1|5131368_5131653_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15341.1|5131642_5131915_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU15342.1|5131932_5132787_+|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU15343.1|5132917_5135302_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15344.1|5135368_5135737_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15345.1|5135755_5136313_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15346.1|5137741_5138008_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU15347.1|5138091_5138829_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU15348.1|5138825_5139026_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15349.1|5139143_5139989_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.7	1.5e-44
AZU15350.1|5139982_5140246_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU15351.1|5140911_5141643_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15352.1|5141634_5141961_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15419.1|5142110_5142314_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15353.1|5142310_5145958_-	urea carboxylase	NA	NA	NA	NA	NA
AZU15354.1|5146041_5147841_-	allophanate hydrolase	NA	NA	NA	NA	NA
AZU15355.1|5147966_5148155_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15356.1|5148190_5148667_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AZU15357.1|5148730_5149300_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU15358.1|5149416_5149989_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU15359.1|5150073_5150817_+	oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.8	5.0e-15
AZU15360.1|5151182_5151701_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15361.1|5152693_5153026_+	lipoprotein	NA	NA	NA	NA	NA
AZU15362.1|5153340_5155266_+	aminopeptidase precursor	NA	NA	NA	NA	NA
AZU15363.1|5155333_5155513_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15364.1|5155615_5157004_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AZU15365.1|5157358_5157649_-	XRE family transcriptional regulator	NA	M9MUN2	Rhodococcus_phage	52.5	2.8e-14
AZU15366.1|5157666_5157780_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15367.1|5158044_5160552_-	exodeoxyribonuclease V subunit alpha	NA	A0A0N9S864	Staphylococcus_phage	44.9	3.7e-09
AZU15368.1|5160739_5164726_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	21.9	2.4e-10
AZU15369.1|5164722_5168127_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
AZU15370.1|5168479_5173255_-	hemagglutinin	NA	F5B3Z3	Synechococcus_phage	50.5	9.4e-22
AZU15371.1|5173516_5174068_+	microcystin-dependent protein	NA	A0A0U4JQ24	Arthrobacter_phage	32.6	1.1e-11
AZU15372.1|5174115_5174643_+|tail	tail collar protein	tail	A0A0U4JYA4	Arthrobacter_phage	34.3	4.5e-18
AZU15373.1|5175247_5175796_+	acetyltransferase	NA	NA	NA	NA	NA
AZU15374.1|5175814_5176102_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15375.1|5176483_5177278_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
AZU15376.1|5177277_5178027_+	ABC transporter permease	NA	NA	NA	NA	NA
AZU15377.1|5178038_5178584_+	mammalian cell entry protein	NA	NA	NA	NA	NA
AZU15378.1|5178580_5179243_+	organic solvent ABC transporter	NA	NA	NA	NA	NA
AZU15379.1|5179232_5179523_+	anti-sigma B factor antagonist	NA	NA	NA	NA	NA
AZU15380.1|5179533_5180589_+	lipoprotein	NA	NA	NA	NA	NA
AZU15381.1|5180860_5181598_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU15382.1|5181681_5181948_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
CP012049	Xanthomonas axonopodis pv. phaseoli strain ISO18C2 plasmid pXap59, complete sequence	58947	7557	24085	58947	transposase	Leptospira_phage(50.0%)	17	NA	NA
AZU15429.1|7557_7824_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU15430.1|7817_8645_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.2	9.8e-44
AZU15431.1|9463_9643_-	hypothetical protein	NA	A0A218MNI4	uncultured_virus	47.2	3.8e-09
AZU15432.1|9836_10574_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.7	5.7e-43
AZU15433.1|10657_10924_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU15434.1|12160_13201_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	27.5	1.9e-07
AZU15435.1|13360_13681_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15436.1|13724_13955_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15437.1|13951_14263_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15438.1|14404_14926_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15439.1|14947_16174_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU15440.1|16154_16382_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15441.1|16378_16720_-	hypothetical protein	NA	NA	NA	NA	NA
AZU15442.1|18343_18820_+	hypothetical protein	NA	NA	NA	NA	NA
AZU15443.1|19481_20309_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.2	9.8e-44
AZU15444.1|20302_20569_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU15445.1|21055_24085_-|transposase	transposase	transposase	NA	NA	NA	NA
