The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	14361	78240	5217177	transposase	Synechococcus_phage(12.5%)	53	NA	NA
AZU32683.1|14361_15189_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU32684.1|15182_15449_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU32685.1|15909_16677_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AZU32686.1|16684_16954_-	membrane protein	NA	NA	NA	NA	NA
AZU32687.1|17028_18489_-	cardiolipin synthetase	NA	NA	NA	NA	NA
AZU32688.1|18813_19539_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU32689.1|19588_19954_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32690.1|20078_21206_-	DNA repair photolyase	NA	NA	NA	NA	NA
AZU32691.1|21391_22093_-	2OG-Fe(II) oxygenase	NA	A0A1D8KQ73	Synechococcus_phage	44.7	5.1e-17
AZU32692.1|22372_23713_-	membrane protein	NA	NA	NA	NA	NA
AZU32693.1|23936_24629_+	membrane protein	NA	NA	NA	NA	NA
AZU32694.1|24735_25056_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32695.1|25055_26063_+	3-phosphoglycerate dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.6	2.5e-09
AZU32696.1|26210_27743_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	29.5	4.5e-26
AZU32697.1|27846_29082_-	peptidase M23	NA	A0A2H4J5G2	uncultured_Caudovirales_phage	32.0	4.6e-05
AZU32698.1|29242_29899_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32699.1|30060_31857_+	aminopeptidase	NA	NA	NA	NA	NA
AZU32700.1|32169_32613_-	peptidase propeptide and ypeb domain-containing protein	NA	NA	NA	NA	NA
AZU32701.1|32910_34044_-	cellulase	NA	NA	NA	NA	NA
AZU32702.1|34665_35718_-	cellulase	NA	NA	NA	NA	NA
AZU32703.1|35847_36255_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32704.1|36492_37566_-	cellulase	NA	NA	NA	NA	NA
AZU32705.1|37873_38932_+	hydroxyacid dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.4	3.0e-77
AZU32706.1|39039_39615_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32707.1|40026_41508_-	glutamate synthase	NA	NA	NA	NA	NA
AZU32708.1|41638_46111_-	glutamate synthase	NA	NA	NA	NA	NA
AZU32709.1|46313_46694_-	Elastase inhibitor AFLEI Flags: Precursor	NA	NA	NA	NA	NA
AZU32710.1|46750_48028_+	DNA topoisomerase	NA	A0A0U2TSJ7	Niemeyer_virus	35.5	2.4e-41
AZU32711.1|48245_48590_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32712.1|48968_49838_-	NmrA family transcriptional regulator	NA	NA	NA	NA	NA
AZU32713.1|50001_50877_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZU32714.1|51079_51466_+	methicillin resistance protein	NA	NA	NA	NA	NA
AZU32715.1|51469_53215_+	ankyrin	NA	NA	NA	NA	NA
AZU32716.1|54186_54366_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32717.1|54356_54923_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32718.1|54959_56141_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
AZU32719.1|56279_57065_-	Tat pathway signal protein	NA	NA	NA	NA	NA
AZU32720.1|57075_59691_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU32721.1|59835_60993_+	XylR family transcriptional regulator	NA	NA	NA	NA	NA
AZU32722.1|61137_63327_+	avirulence protein	NA	NA	NA	NA	NA
AZU32723.1|63814_65272_-	exonuclease	NA	NA	NA	NA	NA
AZU32724.1|65268_67764_-	helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	35.1	9.0e-08
AZU32725.1|67941_68604_+	hemolysin III	NA	NA	NA	NA	NA
AZU32726.1|68670_68928_+	prevent-host-death protein	NA	NA	NA	NA	NA
AZU32727.1|69387_70287_-	oxidoreductase	NA	NA	NA	NA	NA
AZU32728.1|70346_71084_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AZU32729.1|71209_72121_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU32730.1|72334_73414_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32731.1|74729_74996_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU32732.1|75016_75817_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU32733.1|76159_76777_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
AZU32734.1|76852_76987_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU32735.1|77259_78240_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	62.3	2.7e-101
>prophage 2
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	358598	424045	5217177	transposase,tRNA	uncultured_virus(20.0%)	58	NA	NA
AZU32970.1|358598_358865_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU32971.1|359522_360749_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU32972.1|360765_361023_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32973.1|361130_361493_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32974.1|361479_361722_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32975.1|361694_362129_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32976.1|362230_362575_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32977.1|362606_363023_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32978.1|363350_363614_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU32979.1|363607_364453_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.7	1.5e-44
AZU32980.1|365525_367364_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AZU32981.1|367747_369109_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU32982.1|369105_369237_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32983.1|369235_369424_+	proteinase inhibitor	NA	NA	NA	NA	NA
AZU32984.1|369481_370027_-	carbonic anhydrase	NA	NA	NA	NA	NA
AZU32985.1|370023_370248_-	hypothetical protein	NA	NA	NA	NA	NA
AZU32986.1|370488_371799_+	MFS transporter	NA	NA	NA	NA	NA
AZU32987.1|371947_373207_+	phosphodiesterase	NA	NA	NA	NA	NA
AZU32988.1|373648_374179_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZU32989.1|375371_376139_+	3-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
AZU32990.1|376169_377651_+	benzaldehyde dehydrogenase	NA	NA	NA	NA	NA
AZU32991.1|378193_379078_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZU32992.1|379174_380359_+	4-hydroxybenzoate 3-monooxygenase	NA	NA	NA	NA	NA
AZU32993.1|380809_381322_+	hypothetical protein	NA	NA	NA	NA	NA
AZU32994.1|381437_382937_-	glycerol kinase	NA	NA	NA	NA	NA
AZU32995.1|383076_383898_-	glycerol transporter	NA	NA	NA	NA	NA
AZU32996.1|384072_385587_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZU32997.1|385809_386637_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AZU32998.1|387042_388026_-	diguanylate cyclase	NA	NA	NA	NA	NA
AZU32999.1|388126_389203_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AZU33000.1|389453_390317_+	3-oxoadipate:succinyl-CoA transferase	NA	NA	NA	NA	NA
AZU33001.1|391094_392303_+	beta-ketoadipyl CoA thiolase	NA	NA	NA	NA	NA
AZU33002.1|392381_393119_+	protocatechuate 3,4-dioxygenase	NA	NA	NA	NA	NA
AZU33003.1|393123_393687_+	protocatechuate 3,4-dioxygenase	NA	NA	NA	NA	NA
AZU33004.1|394041_395394_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
AZU33005.1|395404_396187_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AZU33006.1|396213_396627_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AZU33007.1|396806_397733_+	hydrolase	NA	NA	NA	NA	NA
AZU33008.1|398070_398931_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZU33009.1|399079_399940_+	kinase	NA	NA	NA	NA	NA
AZU33010.1|400215_401184_+	lipase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	28.3	1.9e-22
AZU33011.1|401482_402193_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33012.1|402401_404306_-|tRNA	tRNA uridine 5-carboxymethylaminomethyl modification protein	tRNA	NA	NA	NA	NA
AZU33013.1|404876_405350_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33014.1|405507_406467_+	serine dehydratase	NA	NA	NA	NA	NA
AZU33015.1|406451_407069_+	protein sanA-like protein	NA	NA	NA	NA	NA
AZU33016.1|407112_407532_+	isopropylmalate/homocitrate/citramalate synthase	NA	NA	NA	NA	NA
AZU33017.1|407736_408642_-	aspartyl beta-hydroxylase	NA	S4VR59	Pandoravirus	39.5	1.2e-37
AZU33018.1|408889_409774_-	malonyl-CoA O-methyltransferase	NA	NA	NA	NA	NA
AZU33019.1|410680_411442_-	pimelyl-ACP methyl ester esterase	NA	NA	NA	NA	NA
AZU33020.1|411544_411919_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33021.1|412110_413316_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AZU33022.1|413407_414442_-	biotin synthase	NA	NA	NA	NA	NA
AZU33023.1|414485_415217_+	competence protein ComF	NA	NA	NA	NA	NA
AZU33024.1|415484_416390_-	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AZU33025.1|417349_418801_-	HpaF protein	NA	NA	NA	NA	NA
AZU33026.1|419850_422280_-	serine kinase	NA	NA	NA	NA	NA
AZU33027.1|423061_424045_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
>prophage 3
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	651174	717940	5217177	transposase	uncultured_virus(16.67%)	46	NA	NA
AZU33215.1|651174_652401_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU33216.1|653520_654255_-	oxidoreductase	NA	NA	NA	NA	NA
AZU33217.1|654305_655250_+	cupin	NA	NA	NA	NA	NA
AZU33218.1|655804_657301_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33219.1|657603_657915_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33220.1|657987_659574_-	oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
AZU33221.1|659932_660712_+	hypothetical protein	NA	A0A2D2W2L0	Stenotrophomonas_phage	66.9	2.4e-92
AZU33222.1|660871_661846_+	glutathionyl-hydroquinone reductase YqjG	NA	NA	NA	NA	NA
AZU33223.1|661919_662315_+	glyoxalase	NA	NA	NA	NA	NA
AZU33224.1|662461_662923_-	membrane protein	NA	NA	NA	NA	NA
AZU33225.1|663423_664251_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU33226.1|664244_664511_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU33227.1|664708_665344_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33228.1|665791_666031_+	membrane protein	NA	NA	NA	NA	NA
AZU33229.1|666432_668760_-	peptidase S9	NA	NA	NA	NA	NA
AZU33230.1|669159_670593_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33231.1|670634_671726_-	lipoprotein	NA	NA	NA	NA	NA
AZU33232.1|672228_674103_+	histidine kinase	NA	A0A127AWB9	Bacillus_phage	31.5	2.2e-14
AZU33233.1|674164_674686_+	BadM/Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AZU33234.1|674788_675688_+	thioredoxin reductase	NA	NA	NA	NA	NA
AZU33235.1|676048_676240_+	membrane protein	NA	NA	NA	NA	NA
AZU33236.1|676464_677016_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33237.1|677221_678106_-	methyltransferase	NA	NA	NA	NA	NA
AZU33238.1|678304_679180_+	membrane protein	NA	NA	NA	NA	NA
AZU33239.1|679455_681228_-	cellulase	NA	NA	NA	NA	NA
AZU33240.1|681421_681529_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33241.1|681635_683336_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
AZU33242.1|683483_683777_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33243.1|684237_684471_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33244.1|684489_685866_+	amino acid permease	NA	NA	NA	NA	NA
AZU33245.1|685951_687073_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AZU33246.1|687316_688228_+	magnesium transporter	NA	NA	NA	NA	NA
AZU33247.1|688430_689126_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33248.1|689707_691381_-	trehalase	NA	NA	NA	NA	NA
AZU33249.1|691654_692425_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33250.1|692529_693282_+	endonuclease	NA	NA	NA	NA	NA
AZU33251.1|693811_694804_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33252.1|695160_696090_-	histidine kinase	NA	NA	NA	NA	NA
AZU33253.1|696656_699536_-	peptidase M16	NA	NA	NA	NA	NA
AZU33254.1|702614_703712_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU33255.1|704056_707347_+	ATPase	NA	A0A1V0SGX0	Hokovirus	36.8	1.4e-32
AZU33256.1|707373_708012_-	chemotaxis protein CheY	NA	NA	NA	NA	NA
AZU33257.1|710304_716343_+	hypothetical protein	NA	A0A2L1IV18	Escherichia_phage	25.6	2.6e-53
AZU33258.1|716456_716804_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33259.1|716852_717590_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU33260.1|717673_717940_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	852278	937680	5217177	protease,tRNA,transposase	Staphylococcus_phage(20.0%)	58	NA	NA
AZU33366.1|852278_855113_-|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0S951	Catovirus	34.3	3.9e-132
AZU33367.1|855320_855746_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AZU33368.1|855745_856117_-	membrane protein	NA	NA	NA	NA	NA
AZU33369.1|856116_857589_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	9.0e-48
AZU33370.1|857696_858779_+	membrane protein	NA	NA	NA	NA	NA
AZU33371.1|858775_859882_+	membrane protein	NA	NA	NA	NA	NA
AZU33372.1|859983_860181_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33373.1|860440_860902_-	membrane protein	NA	NA	NA	NA	NA
AZU33374.1|861289_862261_+	recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.5	3.5e-16
AZU33375.1|862743_863541_+	chitinase	NA	NA	NA	NA	NA
AZU33376.1|864058_868111_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	9.8e-121
AZU33377.1|868780_871927_+	adhesin	NA	NA	NA	NA	NA
AZU33378.1|872029_873913_+|protease	protease	protease	A0A217EQY2	Bacillus_phage	31.7	3.6e-17
AZU33379.1|874452_881523_+	membrane protein	NA	NA	NA	NA	NA
AZU33380.1|881746_883627_+|protease	protease	protease	A0A1B0T6A2	Bacillus_phage	33.2	2.3e-24
AZU33381.1|883756_885484_+	general secretion pathway protein GspE	NA	NA	NA	NA	NA
AZU33382.1|885659_886877_+	general secretion pathway protein GspF	NA	NA	NA	NA	NA
AZU33383.1|887147_887579_+	general secretion pathway protein GspG	NA	NA	NA	NA	NA
AZU33384.1|887588_888098_+	general secretion pathway protein GspH	NA	NA	NA	NA	NA
AZU33385.1|888094_888511_+	general secretion pathway protein GspI	NA	NA	NA	NA	NA
AZU33386.1|888507_889143_+	general secretion pathway protein GspJ	NA	NA	NA	NA	NA
AZU33387.1|889139_889991_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
AZU33388.1|889987_891109_+	general secretion pathway protein GspL	NA	NA	NA	NA	NA
AZU33389.1|891092_891746_+	general secretion pathway protein GspM	NA	NA	NA	NA	NA
AZU33390.1|891735_892527_+	general secretion pathway protein GspN	NA	NA	NA	NA	NA
AZU33391.1|892523_894824_+	general secretion pathway protein GspD	NA	A7BJX1	Enterobacteria_phage	24.5	3.4e-09
AZU33392.1|894820_895660_+	glycosyltransferase	NA	NA	NA	NA	NA
AZU33393.1|896073_896802_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZU33394.1|896907_897483_-	aminotransferase	NA	NA	NA	NA	NA
AZU33395.1|897706_899869_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU33396.1|899900_901058_-	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AZU33397.1|901658_902498_+	glycosyl transferase	NA	NA	NA	NA	NA
AZU33398.1|903672_905580_+	glycosyltransferase	NA	NA	NA	NA	NA
AZU33399.1|905629_906925_+	membrane protein	NA	NA	NA	NA	NA
AZU33400.1|906906_907875_+	glycosidase-like protein	NA	NA	NA	NA	NA
AZU33401.1|909238_909505_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU33402.1|909525_910326_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU33403.1|910375_910648_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33404.1|910853_911309_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33405.1|911337_911814_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33406.1|911899_914044_+	cellulose synthase	NA	NA	NA	NA	NA
AZU33407.1|914088_916416_+	cation tolerance protein CutA	NA	NA	NA	NA	NA
AZU33408.1|916412_917594_+	1,4-D-glucanase	NA	NA	NA	NA	NA
AZU33409.1|922386_924045_-|protease	serine protease	protease	NA	NA	NA	NA
AZU33410.1|924037_924463_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33411.1|924827_925250_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	63.0	3.0e-41
AZU33412.1|925586_926102_+	peptide deformylase	NA	NA	NA	NA	NA
AZU33413.1|926334_927996_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	28.8	5.4e-41
AZU33414.1|928220_928715_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33415.1|928912_930166_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	3.5e-101
AZU33416.1|930268_930793_+	NrdR family transcriptional regulator	NA	NA	NA	NA	NA
AZU33417.1|930789_931278_+	acetyltransferase	NA	NA	NA	NA	NA
AZU33418.1|931270_932386_+	riboflavin biosynthesis protein RibD	NA	A0A1V0SE20	Indivirus	35.3	4.1e-45
AZU33419.1|933154_934381_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU33420.1|934562_934970_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33421.1|935139_935742_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	38.0	6.1e-27
AZU33422.1|935738_936878_+	3,4-dihydroxy-2-butanone 4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	34.3	2.1e-52
AZU33423.1|937215_937680_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	40.9	1.7e-24
>prophage 5
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	1193025	1248017	5217177	transposase,protease	uncultured_virus(25.0%)	43	NA	NA
AZU33653.1|1193025_1194252_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU33654.1|1194331_1195315_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU33655.1|1195630_1196728_+	membrane protein	NA	NA	NA	NA	NA
AZU33656.1|1196919_1197435_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33657.1|1197454_1198315_+	pseudouridylate synthase	NA	NA	NA	NA	NA
AZU33658.1|1198265_1198658_-	HNH endonuclease	NA	NA	NA	NA	NA
AZU33659.1|1198660_1199869_-	2-amino-3-ketobutyrate CoA ligase	NA	V5LQ39	Emiliania_huxleyi_virus	26.2	1.3e-20
AZU33660.1|1199959_1201057_+	sulfate transporter subunit	NA	NA	NA	NA	NA
AZU33661.1|1201060_1201921_+	sulfate/thiosulfate transporter subunit	NA	NA	NA	NA	NA
AZU33662.1|1201917_1202871_+	sulfate/thiosulfate transporter permease subunit	NA	NA	NA	NA	NA
AZU33663.1|1202878_1203925_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	1.2e-25
AZU33664.1|1204191_1204908_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33665.1|1205708_1206935_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU33666.1|1206996_1208019_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
AZU33667.1|1208583_1210917_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU33668.1|1211116_1213198_+	phospholipase C	NA	NA	NA	NA	NA
AZU33669.1|1213358_1215518_+	dipeptidyl-peptidase 7	NA	NA	NA	NA	NA
AZU33670.1|1215609_1216254_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
AZU33671.1|1216470_1217019_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33672.1|1217247_1218567_+	folylpolyglutamate synthase	NA	NA	NA	NA	NA
AZU33673.1|1218634_1219717_+	sporulation protein	NA	NA	NA	NA	NA
AZU33674.1|1219930_1220677_+	colicin V synthesis protein	NA	NA	NA	NA	NA
AZU33675.1|1220707_1222174_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.9	4.1e-85
AZU33676.1|1222369_1223194_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33677.1|1225158_1225578_+	lipoprotein	NA	NA	NA	NA	NA
AZU33678.1|1225766_1226510_-	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AZU33679.1|1227070_1227613_-	phosphoesterase	NA	NA	NA	NA	NA
AZU33680.1|1227593_1228730_-	glycosyl transferase	NA	NA	NA	NA	NA
AZU33681.1|1228974_1230501_-	exopolyphosphatase	NA	NA	NA	NA	NA
AZU33682.1|1230673_1232776_-	polyphosphate kinase	NA	NA	NA	NA	NA
AZU33683.1|1232888_1234217_-	histidine kinase	NA	W8CYF6	Bacillus_phage	33.3	6.4e-29
AZU33684.1|1234289_1234979_-	transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
AZU33685.1|1235161_1236868_-	peptidase	NA	NA	NA	NA	NA
AZU33686.1|1236957_1237266_+	glutaredoxin	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	2.1e-07
AZU33687.1|1237262_1237658_+	alkylhydroperoxidase	NA	NA	NA	NA	NA
AZU33688.1|1238019_1239027_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
AZU33689.1|1239165_1239927_-	membrane protein	NA	NA	NA	NA	NA
AZU33690.1|1241106_1241751_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33691.1|1242097_1243324_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU33692.1|1243812_1244073_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33693.1|1244593_1245886_+	trigger factor	NA	NA	NA	NA	NA
AZU33694.1|1245978_1246605_+|protease	Clp protease ClpP	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
AZU33695.1|1246730_1248017_+|protease	Clp protease ATP-binding protein	protease	G3M9Z9	Bacillus_virus	59.9	5.3e-137
>prophage 6
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	1321779	1390273	5217177	transposase,protease	Brazilian_cedratvirus(14.29%)	51	NA	NA
AZU33758.1|1321779_1322643_+|protease	membrane protease HflC	protease	NA	NA	NA	NA
AZU33759.1|1323267_1323732_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU33760.1|1324211_1325504_+	adenylosuccinate synthetase	NA	A0A2R8FF47	Brazilian_cedratvirus	38.2	2.9e-74
AZU33761.1|1325871_1328544_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	28.6	8.6e-81
AZU33762.1|1328796_1328982_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33763.1|1329236_1329950_-	oxidoreductase	NA	NA	NA	NA	NA
AZU33764.1|1330021_1330612_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU33765.1|1331388_1332024_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33766.1|1333329_1333713_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33767.1|1334356_1335931_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AZU33768.1|1336339_1337092_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33769.1|1337442_1338198_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33770.1|1338264_1338894_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU33771.1|1339888_1340758_+	ADP-dependent (S)-NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AZU33772.1|1341177_1342656_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AZU33773.1|1342787_1344593_-	glycoside hydrolase family 15	NA	NA	NA	NA	NA
AZU33774.1|1344589_1345465_-	oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	52.7	2.7e-76
AZU33775.1|1345915_1348270_-	sugar hydrolase	NA	NA	NA	NA	NA
AZU33776.1|1348344_1348473_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33777.1|1348689_1348869_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33778.1|1348900_1349530_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AZU33779.1|1349874_1351584_+	thioredoxin reductase	NA	NA	NA	NA	NA
AZU33780.1|1351580_1351886_+	zinc finger UbP-type protein	NA	NA	NA	NA	NA
AZU33781.1|1352082_1352829_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AZU33782.1|1352977_1353616_+	guanosine polyphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AZU33783.1|1353699_1353807_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33784.1|1353873_1356396_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.5	1.0e-152
AZU33785.1|1357081_1363087_+	transducer protein car	NA	NA	NA	NA	NA
AZU33786.1|1364179_1366477_-	aldehyde oxidase	NA	NA	NA	NA	NA
AZU33787.1|1366473_1367562_-	FAD-binding molybdopterin dehydrogenase	NA	NA	NA	NA	NA
AZU33788.1|1367534_1368113_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AZU33789.1|1368410_1369742_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33790.1|1369738_1370332_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33791.1|1370394_1370739_+	cupin	NA	NA	NA	NA	NA
AZU33792.1|1370898_1371402_+	DNA-binding protein	NA	NA	NA	NA	NA
AZU33793.1|1371510_1371936_-	death-on-curing protein	NA	A0A1B3AYM0	Gordonia_phage	54.7	3.1e-09
AZU33794.1|1371944_1372166_-	transcriptional regulator	NA	NA	NA	NA	NA
AZU33795.1|1372316_1372922_+	LexA family transcriptional regulator	NA	A0A1W6JNS2	Morganella_phage	38.5	2.5e-12
AZU33796.1|1372923_1373577_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AZU33797.1|1373586_1375005_+	DNA repair nucleotidyltransferase	NA	NA	NA	NA	NA
AZU33798.1|1375050_1375194_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33799.1|1375180_1378432_+	DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.9	2.7e-81
AZU33800.1|1378864_1380457_+	peptidase S9	NA	NA	NA	NA	NA
AZU33801.1|1380666_1381485_+	histidine kinase	NA	NA	NA	NA	NA
AZU33802.1|1381912_1383865_+	peptide transporter	NA	NA	NA	NA	NA
AZU33803.1|1384741_1385008_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU33804.1|1385001_1385829_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU33805.1|1385853_1386612_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33806.1|1386906_1389027_+	peptidase S9	NA	NA	NA	NA	NA
AZU33807.1|1389185_1390013_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU33808.1|1390006_1390273_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	1394354	1457189	5217177	transposase,tRNA	Bacillus_phage(20.0%)	56	NA	NA
AZU33811.1|1394354_1395092_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU33812.1|1395175_1395442_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU33813.1|1395865_1397092_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU33814.1|1397072_1398779_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33815.1|1399185_1401294_-	catalase	NA	A0A2K9L0T1	Tupanvirus	47.9	7.3e-136
AZU33816.1|1401498_1402353_-	hypothetical protein	NA	A0A2H4PQR8	Staphylococcus_phage	30.0	5.8e-23
AZU33817.1|1402410_1404045_-	carboxylesterase	NA	A0A0M4JT58	Mollivirus	29.7	3.6e-37
AZU33818.1|1404212_1407077_-	glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.9	1.5e-261
AZU33819.1|1407543_1407723_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33820.1|1408145_1408949_+	sulfotransferase	NA	NA	NA	NA	NA
AZU33821.1|1409034_1410273_+	hemolysin D	NA	NA	NA	NA	NA
AZU33822.1|1410269_1412426_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	4.5e-32
AZU33823.1|1412704_1413958_+	MFS transporter	NA	NA	NA	NA	NA
AZU33824.1|1413974_1414337_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33825.1|1414341_1415196_-|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU33826.1|1415424_1416162_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU33827.1|1416245_1416512_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU33828.1|1418808_1420476_-	membrane protein	NA	NA	NA	NA	NA
AZU33829.1|1420472_1421237_-	membrane protein	NA	NA	NA	NA	NA
AZU33830.1|1421336_1423070_-	membrane protein	NA	NA	NA	NA	NA
AZU33831.1|1423286_1424003_+	chemotaxis protein CheY	NA	W8CYM9	Bacillus_phage	34.8	1.3e-23
AZU33832.1|1423968_1425285_+	histidine kinase	NA	NA	NA	NA	NA
AZU33833.1|1425469_1425961_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33834.1|1426029_1426287_-	cell division topological specificity factor	NA	NA	NA	NA	NA
AZU33835.1|1426289_1427099_-	cell division inhibitor MinD	NA	NA	NA	NA	NA
AZU33836.1|1427134_1427878_-	septum formation inhibitor	NA	NA	NA	NA	NA
AZU33837.1|1427881_1428481_-	acetyltransferase	NA	NA	NA	NA	NA
AZU33838.1|1428715_1429912_+	histidine kinase	NA	NA	NA	NA	NA
AZU33839.1|1429911_1430553_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AZU33840.1|1430461_1430827_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33841.1|1430903_1432085_+	polyketide cyclase	NA	NA	NA	NA	NA
AZU33842.1|1432166_1432553_+	membrane protein	NA	NA	NA	NA	NA
AZU33843.1|1432555_1433230_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AZU33844.1|1433305_1434103_-	peptidase	NA	NA	NA	NA	NA
AZU33845.1|1434230_1434413_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33846.1|1434409_1434694_-	membrane protein	NA	NA	NA	NA	NA
AZU33847.1|1434845_1435715_-	membrane protein	NA	NA	NA	NA	NA
AZU33848.1|1435839_1437042_+	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AZU33849.1|1437317_1438646_-	endonuclease	NA	NA	NA	NA	NA
AZU33850.1|1438599_1439514_-|tRNA	arginyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
AZU33851.1|1439554_1440163_+	calcium-binding protein	NA	NA	NA	NA	NA
AZU33852.1|1440329_1440785_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33853.1|1441095_1442289_-	RNA polymerase sigma70	NA	NA	NA	NA	NA
AZU33854.1|1442398_1442911_-	pathogenicity-like protein	NA	NA	NA	NA	NA
AZU33855.1|1443142_1444048_-	palmitoyl-CoA hydrolase	NA	NA	NA	NA	NA
AZU33856.1|1444118_1444889_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AZU33857.1|1444954_1445383_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33858.1|1445499_1445904_-	thioesterase	NA	NA	NA	NA	NA
AZU33859.1|1445903_1448870_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	4.3e-307
AZU33860.1|1449162_1449483_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
AZU33861.1|1449495_1449756_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
AZU33862.1|1449988_1451041_+	GTPase CgtA	NA	NA	NA	NA	NA
AZU33863.1|1451132_1451402_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AZU33864.1|1451518_1453111_+	membrane protein	NA	NA	NA	NA	NA
AZU33865.1|1453298_1454351_+	riboflavin kinase	NA	NA	NA	NA	NA
AZU33866.1|1454357_1457189_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.3	7.5e-43
>prophage 8
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	1473448	1545852	5217177	transposase,tRNA	Hokovirus(20.0%)	59	NA	NA
AZU33884.1|1473448_1474186_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU33885.1|1474269_1474536_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU33886.1|1474670_1475588_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33887.1|1475813_1479326_-	phospholipase	NA	NA	NA	NA	NA
AZU33888.1|1479340_1479601_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33889.1|1479931_1480171_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33890.1|1480261_1480507_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33891.1|1481160_1481748_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33892.1|1482083_1482647_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33893.1|1482657_1483764_-	recombinase	NA	A0A0A1I5U0	Burkholderia_phage	35.4	2.4e-45
AZU33894.1|1484325_1485261_+	cytochrome C oxidase subunit II	NA	NA	NA	NA	NA
AZU33895.1|1485260_1487261_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AZU33896.1|1487263_1487890_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AZU33897.1|1487889_1488225_+	cytochrome C oxidase	NA	NA	NA	NA	NA
AZU33898.1|1488576_1490274_+	peptidase M61	NA	NA	NA	NA	NA
AZU33899.1|1490522_1491914_+	DNA repair protein RadA	NA	NA	NA	NA	NA
AZU33900.1|1492327_1492714_+	membrane protein	NA	NA	NA	NA	NA
AZU33901.1|1493241_1494033_-	transcriptional regulator	NA	NA	NA	NA	NA
AZU33902.1|1494833_1496264_+	DNA-binding protein	NA	NA	NA	NA	NA
AZU33903.1|1496472_1498341_+	histidine kinase	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.0	4.0e-16
AZU33904.1|1498366_1500691_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33905.1|1501346_1502189_+	polyvinylalcohol dehydrogenase	NA	NA	NA	NA	NA
AZU33906.1|1502190_1502553_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
AZU33907.1|1502937_1503948_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU33908.1|1503944_1504820_+	histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	29.1	4.1e-24
AZU33909.1|1504809_1506765_+	histidine kinase	NA	NA	NA	NA	NA
AZU33910.1|1506858_1508565_-	glycosyl hydrolase family 43	NA	NA	NA	NA	NA
AZU33911.1|1508801_1511171_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU33912.1|1511277_1511724_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	38.4	9.4e-09
AZU33913.1|1511897_1512263_-	RNA signal recognition particle 4.5S RNA	NA	NA	NA	NA	NA
AZU33914.1|1512624_1513755_-	histidine kinase	NA	W8CYM9	Bacillus_phage	32.0	9.7e-10
AZU33915.1|1513751_1514336_-	chemotaxis protein CheB	NA	NA	NA	NA	NA
AZU33916.1|1514332_1515157_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
AZU33917.1|1515153_1518327_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	41.3	4.6e-33
AZU33918.1|1518486_1519650_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU33919.1|1519642_1520011_+	chemotaxis protein CheY	NA	NA	NA	NA	NA
AZU33920.1|1520238_1521822_-	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AZU33921.1|1521885_1522014_-	hypothetical protein	NA	NA	NA	NA	NA
AZU33922.1|1522059_1523109_+	aldose epimerase	NA	NA	NA	NA	NA
AZU33923.1|1523384_1524176_-	membrane protein	NA	NA	NA	NA	NA
AZU33924.1|1524527_1525904_+	signal recognition particle	NA	NA	NA	NA	NA
AZU33925.1|1526643_1527714_+	2-nitropropane dioxygenase	NA	NA	NA	NA	NA
AZU33926.1|1527704_1528502_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33927.1|1528598_1528856_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AZU33928.1|1528899_1529412_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AZU33929.1|1529469_1530228_+|tRNA	tRNA (guanine-N1)-methyltransferase	tRNA	NA	NA	NA	NA
AZU33930.1|1530372_1530780_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZU33931.1|1531034_1532528_-	multidrug transporter MatE	NA	NA	NA	NA	NA
AZU33932.1|1532585_1532690_+	hypothetical protein	NA	NA	NA	NA	NA
AZU33933.1|1533053_1533749_+	DNA-binding protein	NA	NA	NA	NA	NA
AZU33934.1|1533807_1534464_+	glutathione S-transferase	NA	NA	NA	NA	NA
AZU33935.1|1534688_1535096_+|tRNA	tRNA synthetase RNA-binding protein	tRNA	NA	NA	NA	NA
AZU33936.1|1535217_1537464_-	hydroperoxidase	NA	NA	NA	NA	NA
AZU33937.1|1537892_1538507_-	calcium-binding protein	NA	NA	NA	NA	NA
AZU33938.1|1538806_1541428_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.3	2.0e-29
AZU33939.1|1541540_1542395_-|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU33940.1|1542412_1542685_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU33941.1|1544749_1545013_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU33942.1|1545006_1545852_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.7	1.5e-44
>prophage 9
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	1683068	1723576	5217177	transposase,protease,coat	Shigella_phage(33.33%)	31	NA	NA
AZU34061.1|1683068_1684415_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
AZU34062.1|1684441_1685632_-	1-deoxy-D-xylulose 5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AZU34063.1|1685634_1686462_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AZU34064.1|1686458_1687217_-	UDP diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	32.6	1.0e-15
AZU34065.1|1687234_1687792_-	ribosome recycling factor	NA	NA	NA	NA	NA
AZU34066.1|1687993_1688716_-	uridylate kinase	NA	NA	NA	NA	NA
AZU34067.1|1688821_1690345_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.0	3.1e-19
AZU34068.1|1690619_1691498_-	elongation factor Ts	NA	NA	NA	NA	NA
AZU34069.1|1691667_1692465_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AZU34070.1|1692920_1693634_-	pilus assembly protein	NA	NA	NA	NA	NA
AZU34071.1|1693636_1693969_-	hypothetical protein	NA	NA	NA	NA	NA
AZU34072.1|1694017_1695052_-|coat	spore coat protein U	coat	NA	NA	NA	NA
AZU34073.1|1695048_1697400_-	fimbriae usher protein	NA	NA	NA	NA	NA
AZU34074.1|1697416_1698187_-	pilus assembly protein	NA	NA	NA	NA	NA
AZU34075.1|1698195_1698720_-	sigma-fimbriae tip adhesin	NA	NA	NA	NA	NA
AZU34076.1|1699038_1699815_+	methionine aminopeptidase	NA	NA	NA	NA	NA
AZU34077.1|1699811_1702421_+	protein-PII uridylyltransferase	NA	NA	NA	NA	NA
AZU34078.1|1702442_1703639_+	2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AZU34079.1|1703829_1704186_+	arsenate reductase	NA	NA	NA	NA	NA
AZU34080.1|1704432_1705563_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AZU34081.1|1705855_1707550_+	asparagine synthetase B	NA	A0A0P0C1V4	Ostreococcus_lucimarinus_virus	39.0	1.2e-88
AZU34082.1|1707617_1708670_-	hypothetical protein	NA	NA	NA	NA	NA
AZU34083.1|1708942_1709089_-	hypothetical protein	NA	NA	NA	NA	NA
AZU34084.1|1709105_1711244_-	ligand-gated channel	NA	NA	NA	NA	NA
AZU34085.1|1711651_1714069_-	penicillin acylase	NA	NA	NA	NA	NA
AZU34086.1|1714215_1714701_+	bacterioferritin	NA	NA	NA	NA	NA
AZU34087.1|1714929_1715196_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU34088.1|1715189_1716017_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU34089.1|1717707_1719951_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
AZU34090.1|1722431_1722704_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU34091.1|1722721_1723576_+|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
>prophage 10
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	1901905	1971061	5217177	transposase,tRNA,protease,integrase	Catovirus(22.22%)	58	1930793:1930810	1957601:1957618
AZU34251.1|1901905_1903300_-|tRNA	asparaginyl-tRNA synthetase	tRNA	A0A2P1EMB4	Moumouvirus	39.0	1.1e-79
AZU34252.1|1903504_1903843_+	Fe-S cluster assembly protein HesB	NA	NA	NA	NA	NA
AZU34253.1|1904298_1904730_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AZU34254.1|1904741_1904972_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AZU34255.1|1905160_1905610_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AZU34256.1|1905819_1909323_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AZU34257.1|1909379_1910111_+	cell division protein ZipA	NA	NA	NA	NA	NA
AZU34258.1|1910117_1910501_+	membrane protein	NA	NA	NA	NA	NA
AZU34259.1|1910679_1911804_-	aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	24.7	4.5e-07
AZU34260.1|1912138_1914640_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	37.2	8.2e-118
AZU34261.1|1914636_1915599_+|tRNA	lysyl-tRNA synthetase	tRNA	A0A1V0SAC0	Catovirus	26.2	1.8e-20
AZU34262.1|1915707_1916394_+	hypothetical protein	NA	NA	NA	NA	NA
AZU34263.1|1916581_1917646_+	methylthioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
AZU34264.1|1917855_1920555_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.4	9.8e-109
AZU34265.1|1920859_1923280_+	glucose dehydrogenase	NA	NA	NA	NA	NA
AZU34266.1|1923658_1924387_-	hypothetical protein	NA	NA	NA	NA	NA
AZU34267.1|1924651_1926319_-	urocanate hydratase	NA	NA	NA	NA	NA
AZU34268.1|1926335_1927193_-	formimidoylglutamase	NA	NA	NA	NA	NA
AZU34269.1|1927189_1927378_-	hypothetical protein	NA	NA	NA	NA	NA
AZU34270.1|1927374_1928916_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.8	1.3e-78
AZU34271.1|1928929_1930135_-	imidazolonepropionase	NA	NA	NA	NA	NA
AZU34272.1|1930195_1931566_+	N-formimino-L-glutamate deiminase	NA	NA	NA	NA	NA
1930793:1930810	attL	GCGCTGCCGGATGCGGTG	NA	NA	NA	NA
AZU34273.1|1931626_1931854_+	hypothetical protein	NA	NA	NA	NA	NA
AZU34274.1|1931843_1932620_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZU34275.1|1932806_1933811_-	membrane protein	NA	NA	NA	NA	NA
AZU34276.1|1934347_1934908_-	poly(hydroxyalcanoate) granule associated protein	NA	NA	NA	NA	NA
AZU34277.1|1935070_1935346_-	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
AZU34278.1|1935583_1936393_+	hypothetical protein	NA	NA	NA	NA	NA
AZU34279.1|1936334_1936991_-	sulfite oxidase	NA	NA	NA	NA	NA
AZU34280.1|1937116_1938085_-	sulfoxide reductase catalytic subunit YedY	NA	NA	NA	NA	NA
AZU34281.1|1938261_1939347_+	MFS transporter	NA	M1Q1P2	Streptococcus_phage	43.6	1.5e-76
AZU34282.1|1939430_1940639_+	prephenate dehydratase	NA	NA	NA	NA	NA
AZU34283.1|1940762_1942085_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZU34284.1|1942426_1942894_-	energy transducer TonB	NA	NA	NA	NA	NA
AZU34285.1|1943250_1943922_-	energy transducer TonB	NA	NA	NA	NA	NA
AZU34286.1|1944033_1945314_+|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.4	3.3e-99
AZU34287.1|1945634_1946219_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AZU34288.1|1946319_1947336_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZU34289.1|1947882_1949352_+|integrase	integrase	integrase	NA	NA	NA	NA
AZU34290.1|1949868_1950696_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU34291.1|1950689_1950956_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU34292.1|1951423_1952251_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU34293.1|1952244_1952511_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU34294.1|1954804_1955995_-	FAD-binding monooxygenase	NA	NA	NA	NA	NA
AZU34295.1|1956031_1956496_-	transcriptional regulator	NA	NA	NA	NA	NA
AZU34296.1|1956535_1956706_-	hypothetical protein	NA	NA	NA	NA	NA
AZU34297.1|1956857_1956971_+	hypothetical protein	NA	NA	NA	NA	NA
AZU34298.1|1959930_1960275_-	chemotaxis protein CheY	NA	NA	NA	NA	NA
1957601:1957618	attR	GCGCTGCCGGATGCGGTG	NA	NA	NA	NA
AZU34299.1|1960573_1962091_+	circadian clock protein KaiC	NA	NA	NA	NA	NA
AZU34300.1|1962077_1964150_+	histidine kinase	NA	NA	NA	NA	NA
AZU34301.1|1964507_1965215_-	C-type cytochrome biogenesis protein	NA	NA	NA	NA	NA
AZU34302.1|1965208_1965706_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AZU34303.1|1965705_1966248_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AZU34304.1|1966244_1968233_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AZU34305.1|1968296_1968767_-	cytochrome C biogenesis protein CcmE	NA	NA	NA	NA	NA
AZU34306.1|1968763_1968970_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
AZU34307.1|1968966_1969725_-	heme ABC transporter permease	NA	NA	NA	NA	NA
AZU34308.1|1969735_1971061_-|protease	serine protease	protease	A0A217EQY2	Bacillus_phage	39.6	5.3e-23
>prophage 11
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	2029321	2040149	5217177	tRNA	Micromonas_pusilla_virus(16.67%)	7	NA	NA
AZU34365.1|2029321_2030998_+	ubiquinone biosynthesis protein UbiB	NA	G8DDN0	Micromonas_pusilla_virus	29.2	7.1e-41
AZU34366.1|2031085_2031727_+	LexA family transcriptional regulator	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
AZU34367.1|2031899_2032934_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.1e-113
AZU34368.1|2033227_2033716_+	recombinase RecX	NA	NA	NA	NA	NA
AZU34369.1|2033817_2036466_+|tRNA	alanyl-tRNA synthetase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.8e-84
AZU34370.1|2036605_2036818_+	carbon storage regulator	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
AZU34371.1|2038190_2040149_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.1	9.6e-13
>prophage 12
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	2221206	2233983	5217177	transposase,protease	uncultured_virus(100.0%)	10	NA	NA
AZU34503.1|2221206_2221473_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU34504.1|2221466_2222294_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU34505.1|2222318_2223113_+	hypothetical protein	NA	NA	NA	NA	NA
AZU34506.1|2223260_2225636_+	hypothetical protein	NA	NA	NA	NA	NA
AZU34507.1|2225996_2226215_-	hypothetical protein	NA	NA	NA	NA	NA
AZU34508.1|2226732_2227470_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU34509.1|2227553_2227820_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU34510.1|2229960_2230290_+	hypothetical protein	NA	NA	NA	NA	NA
AZU34511.1|2230280_2231507_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU34512.1|2233431_2233983_-|protease	CAAX protease	protease	NA	NA	NA	NA
>prophage 13
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	2393263	2441244	5217177	transposase	Ralstonia_phage(40.0%)	34	NA	NA
AZU34621.1|2393263_2393530_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU34622.1|2393523_2394351_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU34623.1|2395369_2397028_-	chemotaxis protein	NA	NA	NA	NA	NA
AZU34624.1|2397030_2397657_-	chemotaxis protein	NA	NA	NA	NA	NA
AZU34625.1|2397656_2398049_-	histidine kinase	NA	NA	NA	NA	NA
AZU34626.1|2398084_2398852_-	flagellar biosynthesis sigma factor	NA	NA	NA	NA	NA
AZU34627.1|2398848_2399733_-	cobyrinic acid a,c-diamide synthase	NA	NA	NA	NA	NA
AZU34628.1|2399719_2401411_-	flagellar biosynthesis regulator FlhF	NA	NA	NA	NA	NA
AZU34629.1|2402162_2404256_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AZU34630.1|2404252_2405383_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
AZU34631.1|2405737_2407825_-	membrane protein	NA	G3MA91	Bacillus_virus	34.9	6.6e-20
AZU34632.1|2411258_2412242_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU34633.1|2415708_2416500_-	flagellar biosynthesis protein FliR	NA	NA	NA	NA	NA
AZU34634.1|2416513_2416783_-	flagellar biogenesis protein	NA	NA	NA	NA	NA
AZU34635.1|2417233_2418217_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU34636.1|2418878_2419724_-	flagellar biosynthesis protein flip	NA	NA	NA	NA	NA
AZU34637.1|2419725_2420133_-	flagellar protein	NA	NA	NA	NA	NA
AZU34638.1|2420129_2420468_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AZU34639.1|2420464_2421478_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AZU34640.1|2421488_2422016_-	flagellar basal body protein FliL	NA	NA	NA	NA	NA
AZU34641.1|2422206_2423499_-	flagellar protein	NA	NA	NA	NA	NA
AZU34642.1|2423495_2423951_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
AZU34643.1|2423954_2425331_-	flagellar protein FliI	NA	NA	NA	NA	NA
AZU34644.1|2425327_2425948_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AZU34645.1|2425944_2426934_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AZU34646.1|2426944_2428669_-	flagellar MS-ring protein	NA	NA	NA	NA	NA
AZU34647.1|2428682_2429054_-	flagellar hook-basal body protein	NA	NA	NA	NA	NA
AZU34648.1|2429483_2432978_-	O-antigen biosynthesis protein	NA	K7QL84	Escherichia_phage	25.9	6.5e-12
AZU34649.1|2433424_2433670_+	hypothetical protein	NA	NA	NA	NA	NA
AZU34650.1|2436057_2436786_-	methyltransferase	NA	NA	NA	NA	NA
AZU34651.1|2436797_2437547_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AZU34652.1|2437590_2438874_-	hypothetical protein	NA	NA	NA	NA	NA
AZU34653.1|2439816_2441043_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU34654.1|2441127_2441244_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	2570237	2591834	5217177	transposase,protease	uncultured_virus(75.0%)	17	NA	NA
AZU34755.1|2570237_2572973_-|protease	serine protease	protease	NA	NA	NA	NA
AZU34756.1|2574096_2574372_+	hypothetical protein	NA	NA	NA	NA	NA
AZU34757.1|2574849_2575266_+	membrane protein	NA	NA	NA	NA	NA
AZU34758.1|2575262_2576576_+	sorbosone dehydrogenase	NA	NA	NA	NA	NA
AZU34759.1|2576814_2576997_+	hypothetical protein	NA	NA	NA	NA	NA
AZU34760.1|2577031_2578258_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU34761.1|2578300_2579329_-	hypothetical protein	NA	NA	NA	NA	NA
AZU34762.1|2580003_2580987_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU34763.1|2581067_2582294_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU34764.1|2584060_2584381_-	hypothetical protein	NA	NA	NA	NA	NA
AZU34765.1|2584824_2586051_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU34766.1|2586888_2588253_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZU34767.1|2588547_2589216_-	glycosyl transferase	NA	NA	NA	NA	NA
AZU34768.1|2589212_2589815_-	methyltransferase	NA	NA	NA	NA	NA
AZU34769.1|2589811_2590570_-	N- acetylglucosaminylphosphatidylinositol deacetylase	NA	NA	NA	NA	NA
AZU34770.1|2590557_2591076_-	dehydrogenase	NA	NA	NA	NA	NA
AZU34771.1|2591567_2591834_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	2822019	2872132	5217177	transposase,tRNA,protease	Moumouvirus(12.5%)	47	NA	NA
AZU34976.1|2822019_2823447_+|tRNA	cysteinyl-tRNA synthetase	tRNA	M1PG92	Moumouvirus	32.6	2.4e-37
AZU34977.1|2824011_2824449_+	Fe-S cluster assembly protein SufE	NA	NA	NA	NA	NA
AZU34978.1|2824445_2825696_+	multidrug transporter	NA	NA	NA	NA	NA
AZU34979.1|2825901_2826402_-	molecular chaperone DnaK	NA	NA	NA	NA	NA
AZU34980.1|2826448_2827027_+	hypothetical protein	NA	NA	NA	NA	NA
AZU34981.1|2827026_2827320_+	membrane protein	NA	NA	NA	NA	NA
AZU34982.1|2827316_2828666_+	dihydroorotase	NA	NA	NA	NA	NA
AZU34983.1|2828665_2829508_+	peptidase M23	NA	A0A075BS18	Microcystis_phage	43.0	1.3e-14
AZU34984.1|2829582_2830125_+	glyoxalase	NA	NA	NA	NA	NA
AZU34985.1|2830543_2831908_+	ethanolamine permease	NA	NA	NA	NA	NA
AZU34986.1|2831904_2833314_+	ethanolamine ammonia-lyase	NA	NA	NA	NA	NA
AZU34987.1|2833310_2834126_+	ethanolamine ammonia-lyase	NA	NA	NA	NA	NA
AZU34988.1|2834182_2834473_-	hypothetical protein	NA	NA	NA	NA	NA
AZU34989.1|2834566_2835448_-	beta-lactamase	NA	NA	NA	NA	NA
AZU34990.1|2835567_2836056_-	general stress protein	NA	NA	NA	NA	NA
AZU34991.1|2836666_2837512_+	hypothetical protein	NA	NA	NA	NA	NA
AZU34992.1|2838885_2839869_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU34993.1|2840607_2842278_+	polygalacturonase	NA	NA	NA	NA	NA
AZU34994.1|2842363_2842630_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU34995.1|2842623_2843451_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU34996.1|2843688_2844378_-	phytoene synthase	NA	NA	NA	NA	NA
AZU34997.1|2844406_2845099_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AZU34998.1|2845184_2845904_-	3-demethylubiquinone-9 3-methyltransferase	NA	NA	NA	NA	NA
AZU34999.1|2845935_2847273_-	N-ethylammeline chlorohydrolase	NA	NA	NA	NA	NA
AZU35000.1|2847290_2848103_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35001.1|2848297_2848864_-	elongation factor P	NA	NA	NA	NA	NA
AZU35002.1|2848966_2849995_+	lysine 2,3-aminomutase	NA	NA	NA	NA	NA
AZU35003.1|2850228_2852346_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AZU35004.1|2852342_2853272_-	metal-binding protein	NA	NA	NA	NA	NA
AZU35005.1|2853323_2854088_-	RNA methyltransferase	NA	NA	NA	NA	NA
AZU35006.1|2854205_2855039_+	inositol monophosphatase	NA	NA	NA	NA	NA
AZU35007.1|2855234_2855846_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
AZU35008.1|2856100_2856541_+	ribonuclease	NA	NA	NA	NA	NA
AZU35009.1|2856537_2856963_+	barnase inhibitor	NA	NA	NA	NA	NA
AZU35010.1|2857245_2859135_-	ABC transporter ATPase	NA	A0A2K9L3Z8	Tupanvirus	27.4	3.6e-49
AZU35011.1|2859245_2860622_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	1.2e-54
AZU35012.1|2860723_2861284_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	49.0	6.5e-31
AZU35013.1|2861378_2862935_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35014.1|2863216_2864092_+	carboxylesterase	NA	NA	NA	NA	NA
AZU35015.1|2864186_2865014_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35016.1|2865007_2865274_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35017.1|2865501_2866200_-	glutathione S-transferase	NA	NA	NA	NA	NA
AZU35018.1|2866370_2866580_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	63.9	5.7e-17
AZU35019.1|2867135_2867684_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35020.1|2867680_2868862_+	membrane protein	NA	NA	NA	NA	NA
AZU35021.1|2869083_2871153_+	membrane protein	NA	NA	NA	NA	NA
AZU35022.1|2871253_2872132_-|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 16
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	2985976	3015301	5217177	transposase,tRNA	uncultured_Mediterranean_phage(83.33%)	29	NA	NA
AZU35105.1|2985976_2987203_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU35106.1|2987856_2988825_-	preprotein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	29.9	8.9e-28
AZU35107.1|2988939_2990784_-	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
AZU35108.1|2990974_2991328_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AZU35109.1|2991459_2992605_-|tRNA	queuine tRNA-ribosyltransferase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.9	1.9e-85
AZU35110.1|2992686_2993757_-|tRNA	S-adenosylmethionine:tRNA ribosyltransferase-isomerase	tRNA	NA	NA	NA	NA
AZU35111.1|2993910_2994342_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZU35112.1|2994341_2994446_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35113.1|2994463_2995960_+	lysine 6-aminotransferase	NA	NA	NA	NA	NA
AZU35114.1|2996102_2996300_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35115.1|2996296_2997004_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35116.1|2997379_2998759_-	phosphoesterase	NA	NA	NA	NA	NA
AZU35117.1|2998755_2999877_-	phytase	NA	NA	NA	NA	NA
AZU35118.1|2999873_3002432_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU35119.1|3002583_3003216_+	Uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AZU35120.1|3003589_3005350_-	cellulase	NA	NA	NA	NA	NA
AZU35121.1|3005346_3005460_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35122.1|3005640_3007419_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AZU35123.1|3007415_3007700_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.1e-18
AZU35124.1|3007690_3007873_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35125.1|3007931_3008429_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35126.1|3008475_3008982_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
AZU35127.1|3008978_3009602_-	methyltransferase	NA	NA	NA	NA	NA
AZU35128.1|3009841_3011746_+	heat shock protein 90	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.4	2.3e-112
AZU35129.1|3012339_3013077_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35130.1|3013159_3013426_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU35131.1|3013419_3014247_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU35132.1|3014359_3014626_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35133.1|3015034_3015301_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	3018330	3069645	5217177	capsid,portal,plate,transposase,head,terminase,tail,integrase	Stenotrophomonas_phage(55.17%)	59	3018262:3018321	3077935:3078323
3018262:3018321	attL	GGTAATCCCCCCGCCCATTAGCAGACGCCAGAAGTGGAATTTTCTCGTATCCTTTCTCGA	NA	NA	NA	NA
AZU35135.1|3018330_3018597_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU35136.1|3018716_3019145_+	hypothetical protein	NA	A0A218MND5	uncultured_virus	58.5	1.5e-08
AZU35137.1|3019999_3020266_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35138.1|3020926_3021568_-	carboxypeptidase	NA	NA	NA	NA	NA
AZU35139.1|3023434_3024496_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35140.1|3024596_3025319_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35141.1|3025425_3027879_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35142.1|3027980_3028250_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35143.1|3028284_3028695_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35144.1|3028752_3029583_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35145.1|3029645_3030686_-	type IV secretion system energizing component VirB11	NA	NA	NA	NA	NA
AZU35146.1|3030700_3031870_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35147.1|3031866_3032634_-	Type IV secretory pathway, VirB9 component	NA	NA	NA	NA	NA
AZU35148.1|3032630_3033662_-	conjugative transfer protein	NA	NA	NA	NA	NA
AZU35149.1|3033787_3034198_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35150.1|3034530_3036204_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35151.1|3036240_3036483_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35152.1|3037361_3039383_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AZU35153.1|3040279_3041509_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.2	5.3e-118
AZU35154.1|3041508_3041727_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	55.9	3.3e-15
AZU35155.1|3041723_3041933_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35156.1|3041929_3042202_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35157.1|3042198_3042423_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35158.1|3042419_3042692_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35159.1|3042684_3042867_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35160.1|3042859_3043285_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35161.1|3043363_3043636_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35162.1|3043635_3043923_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35163.1|3043919_3044138_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35164.1|3044461_3046882_-	toprim domain protein	NA	V9IQW5	Stenotrophomonas_phage	68.8	4.0e-271
AZU35165.1|3046884_3047730_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.7	1.5e-44
AZU35166.1|3047723_3047987_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35167.1|3048216_3049203_-	phage late control protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	51.8	1.7e-90
AZU35168.1|3049199_3049598_-	oxidoreductase	NA	V9IQX3	Stenotrophomonas_phage	61.4	4.6e-39
AZU35169.1|3049610_3052481_-|tail	tail protein	tail	V9IQL1	Stenotrophomonas_phage	48.0	1.2e-194
AZU35170.1|3052510_3052624_-	P2 GpE family protein	NA	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
AZU35171.1|3052632_3052935_-|tail	tail protein	tail	V9IQM4	Stenotrophomonas_phage	67.4	4.9e-25
AZU35172.1|3052979_3053489_-|tail	major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	80.5	3.6e-73
AZU35173.1|3053519_3054686_-|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	63.2	5.9e-135
AZU35174.1|3054697_3055057_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.9	1.5e-36
AZU35175.1|3055053_3055617_-|plate	baseplate assembly protein	plate	Q9ZXL0	Pseudomonas_virus	47.0	1.4e-25
AZU35176.1|3055677_3056256_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
AZU35177.1|3056265_3057771_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	46.6	1.0e-51
AZU35178.1|3057780_3058326_-|tail	tail protein	tail	V9IQK7	Stenotrophomonas_phage	54.7	4.6e-50
AZU35179.1|3058318_3058762_-|plate	baseplate assembly protein	plate	R4JDM0	Burkholderia_phage	53.8	1.3e-34
AZU35180.1|3059027_3059828_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35181.1|3059848_3060115_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35182.1|3060714_3061161_-|tail	tail protein	tail	V9IQH0	Stenotrophomonas_phage	62.4	1.6e-40
AZU35183.1|3061148_3061568_-|tail	tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	63.7	8.2e-39
AZU35184.1|3061564_3062053_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	51.7	7.6e-28
AZU35185.1|3062052_3062691_-	lysozyme	NA	V9IQK6	Stenotrophomonas_phage	61.5	2.1e-49
AZU35186.1|3062690_3062966_-	hypothetical protein	NA	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
AZU35187.1|3062958_3063315_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
AZU35188.1|3063319_3063529_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
AZU35189.1|3063528_3063996_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.0	1.2e-30
AZU35190.1|3064094_3064814_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	62.9	2.2e-68
AZU35191.1|3064817_3065837_-|capsid	capsid protein	capsid	Q9ZXM3	Pseudomonas_virus	69.7	6.7e-135
AZU35192.1|3065883_3066726_-|capsid	phage capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.1	2.9e-67
AZU35193.1|3068631_3069645_+|portal	Presumed portal vertex protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.8	3.6e-141
3077935:3078323	attR	GGTAATCCCCCCGCCCATTAGCAGACGCCAGAAGTGGAATTTTCTCGTATCCTTTCTCGAGGAGGTTCCATGAAGAAGTCCCGCTTTACCGACAGCCAGATCATCGCCGTGCTCAAGCAGGCCCAGGCCGGTGCGCCCGTGCCGGAGCTGTGCCGCGAGCACGGCATCAGCTCGGCCACGTTCTACAAGTGGCGCAGCAAGTTCGGCGGCATGGACGTGTCCATGGTCGCGCGCATGAAGGAGCTGGAGGAGGAGAACCGCCGGCTCAAGAAGATGTACGCCGAGGCGCAGCTCAGTACCGACCTGCTGAAGGAAGCGCTCGCAAAAAAATGGTGAGGCCATCTCAGCGACGCGAGATGGCCCAATCGGCAGTCACGAGCGGGCGTACG	NA	NA	NA	NA
>prophage 18
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	3397539	3456114	5217177	transposase	Prochlorococcus_phage(25.0%)	57	NA	NA
AZU35473.1|3397539_3398766_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU35474.1|3398931_3399903_+	thiamine biosynthesis protein ApbE	NA	NA	NA	NA	NA
AZU35475.1|3399899_3401681_+	sulfite reductase	NA	NA	NA	NA	NA
AZU35476.1|3401924_3402782_-	HutD-family protein	NA	NA	NA	NA	NA
AZU35477.1|3403208_3403541_-	competence protein ComEA	NA	NA	NA	NA	NA
AZU35478.1|3403740_3405234_+	peptidase M20	NA	NA	NA	NA	NA
AZU35479.1|3405769_3406042_+	membrane protein	NA	NA	NA	NA	NA
AZU35480.1|3406099_3407119_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AZU35481.1|3407115_3407826_+	mannose-1-phosphate guanylyltransferase	NA	A0A1D7XFC1	Escherichia_phage	33.9	3.3e-08
AZU35482.1|3408046_3408748_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35483.1|3408744_3409911_-	membrane protein	NA	NA	NA	NA	NA
AZU35484.1|3409907_3411020_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35485.1|3411150_3412176_+	phosphoribosylaminoimidazole synthetase	NA	Q58MH8	Prochlorococcus_phage	44.1	2.1e-72
AZU35486.1|3412193_3412652_+	membrane protein	NA	NA	NA	NA	NA
AZU35487.1|3412674_3413292_+	membrane protein	NA	NA	NA	NA	NA
AZU35488.1|3413278_3413947_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.7	1.0e-19
AZU35489.1|3414013_3414841_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35490.1|3414844_3415528_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35491.1|3416088_3416412_-	membrane protein	NA	NA	NA	NA	NA
AZU35492.1|3416408_3417683_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZU35493.1|3417934_3418162_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AZU35494.1|3418215_3419217_+	D-arabinose 5-phosphate isomerase	NA	E3T535	Cafeteria_roenbergensis_virus	24.9	1.4e-12
AZU35495.1|3419265_3419814_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	NA	NA	NA	NA
AZU35496.1|3419810_3420386_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35497.1|3420372_3420945_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35498.1|3420944_3421664_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.3	5.6e-27
AZU35499.1|3421704_3423144_+	RNA polymerase sigma54 factor	NA	NA	NA	NA	NA
AZU35500.1|3423231_3423549_+	ribosome hibernation promoting factor HPF	NA	NA	NA	NA	NA
AZU35501.1|3423570_3424029_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
AZU35502.1|3424025_3424976_+	serine kinase	NA	NA	NA	NA	NA
AZU35503.1|3424972_3425845_+	nucleotide-binding protein	NA	A0A0R8VB27	Thermobifida_phage	30.5	7.8e-07
AZU35504.1|3426377_3426770_+	PTS system fructose IIA component family protein	NA	NA	NA	NA	NA
AZU35505.1|3426762_3427032_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AZU35506.1|3428779_3429133_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35507.1|3429447_3430809_+	magnesium transporter	NA	NA	NA	NA	NA
AZU35508.1|3430950_3431748_+	phospholipase	NA	NA	NA	NA	NA
AZU35509.1|3431782_3432799_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AZU35510.1|3432901_3433729_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35511.1|3433722_3433989_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35512.1|3434107_3434230_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU35513.1|3435518_3436229_+	type IV secretory pathway, TrbF protein	NA	NA	NA	NA	NA
AZU35514.1|3436255_3437248_+	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
AZU35515.1|3437334_3437547_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35516.1|3438790_3438997_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35517.1|3439007_3439247_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35518.1|3439319_3439568_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35519.1|3441409_3445018_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35520.1|3445907_3447185_-	murein transglycosylase	NA	NA	NA	NA	NA
AZU35521.1|3447316_3448063_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	35.7	9.2e-33
AZU35522.1|3448664_3449042_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35523.1|3449593_3449782_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35524.1|3449981_3450581_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35525.1|3451200_3451467_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU35526.1|3451723_3452029_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35527.1|3452627_3452957_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36938.1|3453449_3454292_-	outer protein AF, type III effector XopAF	NA	NA	NA	NA	NA
AZU35528.1|3455286_3456114_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	3543521	3629740	5217177	transposase,protease	uncultured_virus(27.27%)	58	NA	NA
AZU35594.1|3543521_3543788_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU35595.1|3543990_3545217_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU35596.1|3546086_3546542_-	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
AZU35597.1|3547319_3547547_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35598.1|3547547_3547943_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
AZU35599.1|3548090_3549200_-	glycine cleavage system protein T	NA	NA	NA	NA	NA
AZU35600.1|3549373_3549808_-	membrane protein	NA	NA	NA	NA	NA
AZU35601.1|3549811_3550774_-	membrane protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	33.5	1.5e-22
AZU35602.1|3550932_3551268_-	membrane protein	NA	A0A218MNG8	uncultured_virus	57.8	6.8e-28
AZU35603.1|3552509_3553310_-	3'-5'-bisphosphate nucleotidase	NA	NA	NA	NA	NA
AZU35604.1|3553306_3553855_-	ADP-ribose diphosphatase	NA	NA	NA	NA	NA
AZU35605.1|3553896_3555315_+	adenosylmethionine-8-amino-7-oxononanoate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	20.7	2.1e-09
AZU35606.1|3555305_3556040_+	16S rRNA methyltransferase	NA	NA	NA	NA	NA
AZU35607.1|3556351_3557368_-	glucokinase	NA	NA	NA	NA	NA
AZU35608.1|3559799_3560537_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35609.1|3560620_3560887_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35610.1|3562139_3563825_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
AZU35611.1|3563828_3564896_+	glycosyl hydrolase	NA	A0A2P1CFB9	Microbacterium_phage	23.4	1.1e-07
AZU35612.1|3565160_3567611_+	beta-hexosaminidase	NA	NA	NA	NA	NA
AZU35613.1|3567632_3570323_+	beta-mannosidase	NA	NA	NA	NA	NA
AZU35614.1|3570806_3573467_+	glycoside hydrolase family 3	NA	NA	NA	NA	NA
AZU35615.1|3574049_3575513_+	Tat pathway signal protein	NA	NA	NA	NA	NA
AZU35616.1|3575623_3577966_+	alpha-mannosidase	NA	NA	NA	NA	NA
AZU35617.1|3578280_3580116_+	beta-galactosidase	NA	NA	NA	NA	NA
AZU35618.1|3580165_3582604_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AZU35619.1|3583338_3583539_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35620.1|3583596_3583926_-	R body protein RebB-like protein	NA	NA	NA	NA	NA
AZU35621.1|3585894_3587610_+	leucine-rich repeat (LRR) protein	NA	NA	NA	NA	NA
AZU35622.1|3587714_3588446_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AZU35623.1|3588442_3589507_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
AZU35624.1|3590217_3590415_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35625.1|3590441_3591035_-	alanine acetyltransferase	NA	NA	NA	NA	NA
AZU35626.1|3591266_3591743_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AZU35627.1|3591776_3592964_-	chemotaxis protein	NA	NA	NA	NA	NA
AZU35628.1|3592971_3600177_-	chemotaxis protein CheY	NA	W8CYM9	Bacillus_phage	31.9	1.3e-11
AZU35629.1|3600290_3602327_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.2	3.6e-23
AZU35630.1|3602366_3602897_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AZU35631.1|3602896_3603259_-	chemotaxis protein CheY	NA	A0A220YL79	Alteromonas_virus	27.7	4.1e-10
AZU35632.1|3603276_3603678_-	pilus assembly protein PilG	NA	NA	NA	NA	NA
AZU35633.1|3603914_3604865_+	glutathione synthetase	NA	NA	NA	NA	NA
AZU35634.1|3604861_3605737_+	energy transducer TonB	NA	NA	NA	NA	NA
AZU35635.1|3606082_3607000_-	ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	47.1	2.0e-66
AZU35636.1|3606996_3607716_-|protease	glycoprotease	protease	NA	NA	NA	NA
AZU35637.1|3607934_3608030_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35638.1|3608077_3610069_-	helicase	NA	A0A127AW80	Bacillus_phage	33.0	1.9e-93
AZU35639.1|3610347_3610872_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35640.1|3610885_3613330_-	penicillin-binding protein	NA	NA	NA	NA	NA
AZU35641.1|3613567_3615652_+	glycosyl transferase	NA	NA	NA	NA	NA
AZU35642.1|3616012_3617455_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35643.1|3617726_3619913_-	(p)ppGpp synthetase	NA	NA	NA	NA	NA
AZU35644.1|3620366_3621266_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
AZU35645.1|3621262_3622015_+	pyrroloquinoline quinone biosynthesis protein PqqC	NA	NA	NA	NA	NA
AZU35646.1|3622011_3622290_+	pyrroloquinoline quinone biosynthesis protein PqqD	NA	NA	NA	NA	NA
AZU35647.1|3622286_3623405_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
AZU35648.1|3623467_3623980_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35649.1|3624405_3625920_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
AZU35650.1|3626222_3627257_+	glucokinase	NA	NA	NA	NA	NA
AZU35651.1|3628513_3629740_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
>prophage 20
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	3745168	3837123	5217177	transposase,integrase	uncultured_virus(21.05%)	82	3788355:3788414	3837100:3838429
AZU35742.1|3745168_3745969_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35743.1|3745989_3746256_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35744.1|3746285_3748127_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.6	7.3e-15
AZU35745.1|3748329_3748764_-	membrane protein	NA	NA	NA	NA	NA
AZU35746.1|3748750_3749275_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35747.1|3749277_3750099_-	laccase	NA	NA	NA	NA	NA
AZU35748.1|3750100_3751096_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AZU35749.1|3751216_3752098_+	competence protein	NA	NA	NA	NA	NA
AZU35750.1|3752412_3753390_+	hypothetical protein	NA	A0A0N9SJH5	Pseudomonas_phage	41.0	1.7e-55
AZU35751.1|3753408_3755049_-	NAD synthetase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	4.9e-95
AZU35752.1|3755071_3755443_-	DNA methyltransferase	NA	NA	NA	NA	NA
AZU35753.1|3756109_3756985_-	succinyl-CoA synthetase subunit alpha	NA	NA	NA	NA	NA
AZU35754.1|3757009_3758179_-	succinyl-CoA synthetase subunit beta	NA	NA	NA	NA	NA
AZU35755.1|3758410_3760024_+	ATPase	NA	NA	NA	NA	NA
AZU35756.1|3760354_3761749_+	chemotaxis protein CheY	NA	NA	NA	NA	NA
AZU35757.1|3762153_3762273_-	pilus assembly protein	NA	NA	NA	NA	NA
AZU35758.1|3762517_3764254_-	general secretion pathway protein GspE	NA	NA	NA	NA	NA
AZU35759.1|3764318_3764774_-	fimbrial protein	NA	NA	NA	NA	NA
AZU35760.1|3764883_3765324_-	fimbrial protein	NA	NA	NA	NA	NA
AZU35761.1|3765617_3766844_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU35762.1|3767015_3768272_+	type II secretory pathway protein	NA	NA	NA	NA	NA
AZU35763.1|3768278_3769142_+	methyltransferase	NA	NA	NA	NA	NA
AZU35764.1|3769152_3769764_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
AZU35765.1|3771064_3771331_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU35766.1|3771351_3772152_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU35767.1|3772534_3773869_-	histidine kinase	NA	NA	NA	NA	NA
AZU35768.1|3773861_3774539_-	XRE family transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
AZU35769.1|3775214_3776102_-	ribosomal protein S6 modification protein	NA	A0A1D7SR78	Cyanophage	32.0	3.5e-31
AZU35770.1|3776593_3778726_+	glycogen debranching protein	NA	NA	NA	NA	NA
AZU35771.1|3779184_3779577_-	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AZU35772.1|3779667_3780060_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35773.1|3780168_3780828_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35774.1|3781584_3781857_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU35775.1|3781874_3782729_+|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU35776.1|3783486_3783678_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35777.1|3783748_3784228_-	RadC family protein	NA	NA	NA	NA	NA
AZU35778.1|3784583_3785411_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35779.1|3785404_3785671_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35780.1|3785825_3786050_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35781.1|3786813_3787797_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
3788355:3788414	attL	GAGCGTGTGCAGAATTTTGTGTAACCGTGGTTTGGGTTACCGCTGAGGAAGTCGCCCCTC	NA	NA	NA	NA
AZU35782.1|3788390_3789617_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU35783.1|3791008_3792235_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU35784.1|3792271_3793054_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	33.1	7.9e-11
AZU35785.1|3793846_3794647_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35786.1|3794667_3794934_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35787.1|3796632_3797913_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	49.3	5.7e-107
AZU35788.1|3797899_3798331_-	peptidase S24	NA	A0A2H4J538	uncultured_Caudovirales_phage	42.0	2.6e-19
AZU35789.1|3798883_3799828_-	membrane protein	NA	NA	NA	NA	NA
AZU35790.1|3799907_3800636_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZU35791.1|3801402_3802191_+	protein kinase	NA	NA	NA	NA	NA
AZU35792.1|3802573_3803443_+	hypothetical protein	NA	A0A142K541	Mycobacterium_phage	27.2	1.5e-05
AZU35793.1|3803623_3804424_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35794.1|3804444_3804711_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35795.1|3804878_3806579_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35796.1|3806595_3807156_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AZU35797.1|3807672_3808071_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35798.1|3808436_3809648_-	nuclease	NA	NA	NA	NA	NA
AZU35799.1|3809860_3810640_+	conjugal transfer protein	NA	NA	NA	NA	NA
AZU35800.1|3810636_3811182_+|integrase	integrase	integrase	NA	NA	NA	NA
AZU35801.1|3811250_3811652_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AZU35802.1|3811773_3813780_+	DNA mismatch repair protein MutL	NA	NA	NA	NA	NA
AZU35803.1|3813819_3817134_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35804.1|3817601_3817799_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35805.1|3817813_3819835_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	26.4	5.0e-33
AZU35806.1|3820377_3821883_+	DNA methyltransferase	NA	Q6V7R9	Burkholderia_virus	44.9	1.4e-101
AZU35807.1|3822320_3823121_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35808.1|3823141_3823408_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35809.1|3823569_3823956_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35810.1|3824051_3824495_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35811.1|3824622_3825336_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZU35812.1|3825632_3826430_+	GTPase	NA	NA	NA	NA	NA
AZU35813.1|3827441_3828179_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35814.1|3828262_3828529_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35815.1|3828593_3829067_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35816.1|3829154_3829355_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35817.1|3829462_3830290_+	hypothetical protein	NA	A0A2C9CYF8	Yersinia_phage	36.1	1.1e-42
AZU35818.1|3830366_3831038_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36941.1|3831154_3831334_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35819.1|3831484_3831745_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35820.1|3831823_3832474_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35821.1|3832547_3833657_+	methyltransferase	NA	NA	NA	NA	NA
AZU35822.1|3835896_3837123_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
3837100:3838429	attR	GAGGGGCGACTTCCTCAGCGGTAACCCAAACCACGGTTACACAAAATTCTGCACACGCTCAACAGGGCTTGATCTGCTGGAGTTCCCCACAATTGTCTTCATGCAATCAGGGTGGAACATCTACACGCTTCAGCAGGCCGCACGTCGCTCATGGCGTATAGGCCAGAAGTTGCGTGTGAGGGTGATCTACTTGGGGTACATGGCCACGTCGCAGATGACGTGCCTTGCTCTGATGGCCAAAAAGATCCTGGTGTCTCAAAGCACGTCGGGCGACGTCCCGGAATCGGGGCTTGACGTGCTCAATCAGGATGGCGACTCAATTGAGGTCGCTTTGGCGCGGCAGCTTGTTGCTGCTTGATGTCCAGAATCAGCCGGCACCCTTCGGGGCGCCGGCTTTTTTTTCTAATGCATACTTCTGCTACCGATGGTTTGACAATCAGCACGCCAGAACATGGATGAGCGCTAATTCGCATTCTTTACTGACCGGGGTTGCTGTCTGCAGGGATGGTATCGGCTTACTGCAACAGGAAGCCGGTTCATGCAAAACATCTGCTGCTCCTCACTCCTGGCTGGCTGTGGTCTGGTAGTCGCTGCCATTTTTACTGGTGGTTGCGCCACTACGTCTTCAGAAGTTCAGCCGCCCCCTACTGAAGAGGTAATCGCTCCCCGCGACCAGACCGATCCGGAGTTGATTCCAGTGATCCGCTATGGGCGCTACACCCTGGTTGAACTGTCTCCTGGCTCAGCACAGCGCGACCTACTGCTGCAGGTCATCGATGTGCGGATGCCAGACGAAGCGAGAGCTAGTGTTGGCGATGGCCTACGCCACGTTCTCAACCGCAGTGGCTACCAAATGTGTGAGACGGGATCAGCCGCCCTTGAACTCTACCCGCTGCCAATGCCCGCCGCCCATCTGCAACTGGGCCCTATGACTCTGCGCGATGCGCTACTCACTCTGGCAGGCCCTGCTTGGGATGTTGAGGTCAATGACAGCACACGGCAGGTGTGCTTTGTCCGTCCTGGAACTCATGTTGACCTTCAATCTCAGGATCTTCGAAGCTCCGAGCCGGCTCAGGTGTTTCCGCAAGATGGAGCCCAGCAATGACTAGATCCAAGATCATCTTCGGCGCGAAACATTCACGAGCCTACTCAATCATCCAGATATTGCTGTGGGTGTGGCTTGTCGGGCTTATGGCCTTAGTGATGATCGCGTTGCTCGCTGTGCAGTCGCAACGCGAAAAGACCCTCAATCGTTTGCACGCGCTGGAGGTAGGTCAGGCGCAAATCGCTGACGCAAATCGGGCGCTACAGGCCCGGCCGGAATCGGCCA	NA	NA	NA	NA
>prophage 21
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	3855360	3902371	5217177	transposase,tRNA,integrase	Bacillus_virus(50.0%)	35	3848699:3848714	3899147:3899162
3848699:3848714	attL	CGACGCCGATGGCATG	NA	NA	NA	NA
AZU35838.1|3855360_3856161_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35839.1|3856181_3856448_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35840.1|3856499_3857444_+	conjugal transfer protein	NA	NA	NA	NA	NA
AZU35841.1|3857517_3858855_+	conjugal transfer protein	NA	NA	NA	NA	NA
AZU35842.1|3858851_3859199_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35843.1|3859214_3860738_+	membrane protein	NA	NA	NA	NA	NA
AZU35844.1|3860749_3861109_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35845.1|3861334_3862093_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35846.1|3862085_3863012_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35847.1|3863041_3863332_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35848.1|3863430_3864453_-	hypothetical protein	NA	G3MA91	Bacillus_virus	34.1	9.1e-23
AZU35849.1|3864841_3866764_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35850.1|3869262_3870639_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35851.1|3870635_3871295_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35852.1|3871291_3871822_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35853.1|3872761_3873898_-	Type IV secretion system protein virB6	NA	NA	NA	NA	NA
AZU35854.1|3873929_3874577_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35855.1|3875596_3877144_-	histidine kinase	NA	NA	NA	NA	NA
AZU35856.1|3878326_3881590_+	DNA helicase	NA	NA	NA	NA	NA
AZU35857.1|3881846_3882113_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU35858.1|3882387_3883125_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35859.1|3883208_3883475_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU35860.1|3884254_3888286_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35861.1|3888300_3888708_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35862.1|3888704_3889622_-	radical SAM protein	NA	NA	NA	NA	NA
AZU35863.1|3890037_3890934_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35864.1|3891137_3891923_+	hypothetical protein	NA	NA	NA	NA	NA
AZU35865.1|3892366_3893251_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AZU35866.1|3894394_3895396_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35867.1|3895428_3895848_-	hypothetical protein	NA	NA	NA	NA	NA
AZU35868.1|3896032_3897913_-|integrase	integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	50.8	2.8e-102
AZU35869.1|3898345_3900130_-	esterase	NA	NA	NA	NA	NA
3899147:3899162	attR	CATGCCATCGGCGTCG	NA	NA	NA	NA
AZU35870.1|3900317_3900518_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AZU35871.1|3900567_3901362_+	thiazole synthase	NA	NA	NA	NA	NA
AZU35872.1|3901612_3902371_+|tRNA	tRNA (guanine-N7)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 22
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	4163948	4186267	5217177	transposase,holin	Shigella_phage(28.57%)	24	NA	NA
AZU36070.1|4163948_4164215_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU36071.1|4164262_4165489_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU36072.1|4165572_4166373_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU36073.1|4166770_4167724_+	DegV domain-containing protein	NA	NA	NA	NA	NA
AZU36074.1|4168274_4168613_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36075.1|4168843_4169116_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU36076.1|4169133_4169988_+|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU36077.1|4170018_4170849_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZU36078.1|4170907_4171483_-	glutathione-dependent formaldehyde-activating protein	NA	NA	NA	NA	NA
AZU36079.1|4171551_4172661_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	1.1e-34
AZU36080.1|4172727_4173003_-	regulator	NA	NA	NA	NA	NA
AZU36081.1|4173332_4173680_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36082.1|4174133_4175234_-	glycosyltransferase	NA	A0A142BZU7	Faustovirus	29.4	5.2e-16
AZU36083.1|4175311_4176091_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU36084.1|4176087_4177590_+	histidine kinase	NA	W8CYF6	Bacillus_phage	24.4	8.7e-14
AZU36085.1|4177601_4177784_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36086.1|4177777_4179160_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AZU36087.1|4179267_4180056_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36088.1|4180147_4180771_-	GTP-binding protein	NA	NA	NA	NA	NA
AZU36089.1|4180914_4181712_+	cytochrome C	NA	NA	NA	NA	NA
AZU36090.1|4181806_4182457_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AZU36091.1|4182548_4183364_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AZU36092.1|4183413_4184151_+	endonuclease	NA	NA	NA	NA	NA
AZU36093.1|4184287_4186267_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	26.1	5.3e-19
>prophage 23
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	4206192	4214243	5217177	coat	Enterobacteria_phage(42.86%)	7	NA	NA
AZU36113.1|4206192_4207539_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.2	4.8e-32
AZU36114.1|4207585_4208989_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.8	1.9e-47
AZU36115.1|4209291_4210458_-	UDP-glucose 6-dehydrogenase	NA	M1HV26	Paramecium_bursaria_Chlorella_virus	57.8	1.6e-116
AZU36116.1|4210798_4211698_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.6e-26
AZU36117.1|4211694_4212252_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	49.4	3.0e-44
AZU36118.1|4212248_4213136_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	57.8	1.7e-94
AZU36119.1|4213187_4214243_-|coat	spore coat protein	coat	I7HTA3	Enterobacteria_phage	45.0	2.4e-79
>prophage 24
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	4635334	4704410	5217177	transposase,tRNA,protease	Listeria_phage(27.27%)	58	NA	NA
AZU36504.1|4635334_4636339_-|tRNA	tRNA-dihydrouridine synthase A	tRNA	NA	NA	NA	NA
AZU36505.1|4636795_4637020_-	membrane protein	NA	NA	NA	NA	NA
AZU36506.1|4637595_4638201_-	ankyrin	NA	NA	NA	NA	NA
AZU36507.1|4638260_4639784_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.3	9.8e-98
AZU36508.1|4640158_4640770_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36509.1|4640766_4641900_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36510.1|4641920_4642088_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36511.1|4643818_4645045_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU36512.1|4645025_4645631_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36513.1|4645627_4646767_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36514.1|4647054_4649187_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
AZU36515.1|4649483_4649720_-	membrane protein	NA	NA	NA	NA	NA
AZU36516.1|4649716_4650091_-	membrane protein	NA	NA	NA	NA	NA
AZU36517.1|4650080_4650932_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
AZU36518.1|4650996_4651878_+	TolB-like protein	NA	NA	NA	NA	NA
AZU36519.1|4652526_4655061_-	iron-uptake factor	NA	NA	NA	NA	NA
AZU36520.1|4655291_4656044_+	endonuclease	NA	H6X497	Enterobacteria_phage	33.8	3.0e-23
AZU36521.1|4656415_4657408_-	delta-aminolevulinic acid dehydratase	NA	NA	NA	NA	NA
AZU36522.1|4657432_4657594_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36523.1|4657617_4657866_-	membrane protein	NA	NA	NA	NA	NA
AZU36524.1|4658082_4658553_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36525.1|4658651_4660442_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36526.1|4661344_4663594_-	peptidase S9	NA	NA	NA	NA	NA
AZU36527.1|4664821_4665013_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36528.1|4665179_4668194_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU36529.1|4668380_4669082_+	peptidase	NA	NA	NA	NA	NA
AZU36530.1|4669071_4670085_+	cupin	NA	NA	NA	NA	NA
AZU36531.1|4670095_4671661_+	tryptophan halogenase	NA	E3SL43	Synechococcus_phage	28.5	2.5e-40
AZU36532.1|4671800_4672811_+	energy transducer TonB	NA	NA	NA	NA	NA
AZU36533.1|4673057_4674251_-	sodium ABC transporter permease	NA	NA	NA	NA	NA
AZU36534.1|4674247_4674994_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.2e-19
AZU36535.1|4675025_4676627_-|protease	cysteine protease	protease	NA	NA	NA	NA
AZU36536.1|4676687_4676888_-	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
AZU36537.1|4676884_4677472_-	membrane protein	NA	NA	NA	NA	NA
AZU36538.1|4677912_4679475_+	beta-xylosidase	NA	NA	NA	NA	NA
AZU36539.1|4679564_4679837_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36540.1|4679901_4680915_+	cation transporter	NA	NA	NA	NA	NA
AZU36541.1|4681006_4681729_-	phenol hydroxylase	NA	NA	NA	NA	NA
AZU36542.1|4681870_4682866_+	ABC transporter	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.1	1.0e-23
AZU36543.1|4682883_4683675_+	membrane protein	NA	NA	NA	NA	NA
AZU36544.1|4683680_4684619_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AZU36545.1|4685398_4685665_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU36546.1|4685685_4686486_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU36547.1|4686776_4687181_-	thioesterase	NA	NA	NA	NA	NA
AZU36548.1|4687217_4687670_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36549.1|4687707_4688034_-	thioredoxin	NA	NA	NA	NA	NA
AZU36550.1|4688005_4688500_-	flavodoxin	NA	A0A068CFW0	Listeria_phage	36.1	6.1e-17
AZU36551.1|4688725_4689196_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36552.1|4689195_4689894_-	hypothetical protein	NA	I3NLD4	Bifidobacterium_phage	28.1	1.6e-15
AZU36553.1|4689936_4690980_-	ribonucleotide-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	76.0	8.6e-154
AZU36554.1|4691157_4693656_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A088FNW1	Listeria_phage	67.1	6.4e-304
AZU36555.1|4694258_4695302_-	hypothetical protein	NA	A0A172Q0Y5	Acinetobacter_phage	50.7	1.1e-79
AZU36556.1|4695407_4698116_-	GCN5 family acetyltransferase	NA	NA	NA	NA	NA
AZU36557.1|4698230_4699598_-	magnesium transporter	NA	NA	NA	NA	NA
AZU36558.1|4700180_4701008_+	carbonic anhydrase	NA	NA	NA	NA	NA
AZU36559.1|4701225_4703031_+	potassium transporter KefB	NA	NA	NA	NA	NA
AZU36560.1|4703322_4703589_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU36561.1|4703672_4704410_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	4961767	5032976	5217177	transposase	Bacillus_phage(33.33%)	49	NA	NA
AZU36747.1|4961767_4962034_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU36748.1|4962117_4962855_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU36749.1|4963127_4963370_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36750.1|4963650_4964169_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36751.1|4966482_4967322_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36752.1|4969222_4969795_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36753.1|4969947_4970151_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36754.1|4970585_4971566_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZU36755.1|4971903_4974573_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZU36756.1|4974572_4975544_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36757.1|4975954_4977007_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZU36758.1|4977174_4980213_+	membrane protein	NA	NA	NA	NA	NA
AZU36759.1|4980264_4980387_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36760.1|4980538_4983574_+	membrane protein	NA	NA	NA	NA	NA
AZU36761.1|4983597_4985199_+	tryptophan halogenase	NA	M4T1E3	Cyanophage	29.2	6.3e-47
AZU36762.1|4985583_4986312_-	orotidine 5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AZU36763.1|4986308_4987274_-	acid phosphatase	NA	NA	NA	NA	NA
AZU36764.1|4987623_4988280_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36765.1|4988443_4989295_-	radical SAM protein	NA	NA	NA	NA	NA
AZU36766.1|4989302_4990664_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AZU36767.1|4990660_4991503_-	metalloenzyme domain-containing protein	NA	NA	NA	NA	NA
AZU36768.1|4991471_4992566_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36769.1|4992585_4993497_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36770.1|4993639_4994761_+	ATPase AAA	NA	A0A2H4PB07	Aphanizomenon_phage	28.9	4.3e-18
AZU36771.1|4994757_4995171_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36772.1|4995167_4997015_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36773.1|4999813_5000848_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36774.1|5000899_5001436_-	acetyltransferase	NA	NA	NA	NA	NA
AZU36775.1|5001998_5003975_-	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	8.2e-113
AZU36776.1|5004183_5004813_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.6	6.7e-53
AZU36777.1|5005241_5006486_+	histidine kinase	NA	NA	NA	NA	NA
AZU36778.1|5006648_5008250_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AZU36779.1|5008318_5009296_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36780.1|5009954_5010692_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU36781.1|5010775_5011042_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU36782.1|5011187_5012003_-	5-hydroxymethyluracil DNA glycosylase	NA	A0A127AWE5	Bacillus_phage	27.4	8.3e-19
AZU36783.1|5018762_5019944_+	membrane protein	NA	NA	NA	NA	NA
AZU36784.1|5020018_5021923_-	phytochrome	NA	Q6XLU9	Feldmannia_irregularis_virus	27.4	1.1e-18
AZU36785.1|5021919_5022513_-	heme oxygenase	NA	NA	NA	NA	NA
AZU36786.1|5022612_5023878_-	MFS transporter	NA	NA	NA	NA	NA
AZU36787.1|5024474_5026637_-	epimerase	NA	NA	NA	NA	NA
AZU36788.1|5026815_5027022_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36789.1|5027238_5027517_-	zinc chelation protein SecC	NA	NA	NA	NA	NA
AZU36790.1|5028815_5029175_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36791.1|5029186_5029501_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36792.1|5029581_5030352_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36793.1|5030454_5030796_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU36794.1|5031888_5032155_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU36795.1|5032238_5032976_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 26
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	5052636	5113063	5217177	transposase,integrase	uncultured_virus(66.67%)	41	5042190:5042204	5120351:5120365
5042190:5042204	attL	GCTGCAGGGCTTTGC	NA	NA	NA	NA
AZU36812.1|5052636_5053863_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU36813.1|5054034_5058057_+	ATP-binding protein	NA	NA	NA	NA	NA
AZU36814.1|5058131_5058935_-	membrane protein	NA	NA	NA	NA	NA
AZU36815.1|5059212_5060766_+|integrase	integrase	integrase	NA	NA	NA	NA
AZU36816.1|5061170_5062397_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU36817.1|5062905_5064525_+	enterochelin esterase	NA	NA	NA	NA	NA
AZU36818.1|5064628_5065027_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36819.1|5065790_5066483_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36820.1|5066513_5067416_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AZU36821.1|5067748_5069326_+	chlamydia polymorphic membrane family protein	NA	NA	NA	NA	NA
AZU36822.1|5070250_5070517_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU36823.1|5070773_5071079_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36824.1|5075644_5077696_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36825.1|5077789_5078809_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36826.1|5079949_5082535_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36827.1|5083473_5084451_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36828.1|5084581_5086225_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36829.1|5086644_5087823_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36830.1|5087899_5089543_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36831.1|5089831_5090356_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36832.1|5090536_5091616_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36833.1|5091612_5092374_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36834.1|5092382_5092649_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36835.1|5092651_5093344_-	type III secretion system protein	NA	NA	NA	NA	NA
AZU36836.1|5093343_5094396_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36837.1|5094620_5095085_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36838.1|5095584_5096022_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36839.1|5096023_5097373_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36840.1|5097375_5097735_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36841.1|5097795_5099892_-	type III secretion system protein InvA	NA	NA	NA	NA	NA
AZU36842.1|5100141_5101257_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36843.1|5104308_5105421_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36844.1|5105453_5105723_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36845.1|5105788_5106073_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36846.1|5107525_5108200_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36847.1|5108196_5108430_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36848.1|5108611_5108926_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU36849.1|5108925_5109741_+|integrase	integrase	integrase	NA	NA	NA	NA
AZU36850.1|5110731_5111034_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36851.1|5111577_5111838_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36852.1|5111887_5113063_+|integrase	integrase	integrase	Q5QBN6	Enterobacteria_phage	25.4	8.5e-17
5120351:5120365	attR	GCTGCAGGGCTTTGC	NA	NA	NA	NA
>prophage 27
CP012063	Xanthomonas axonopodis pv. phaseoli strain ISO18C8, complete genome	5217177	5122909	5179541	5217177	transposase,tail	Shigella_phage(16.67%)	51	NA	NA
AZU36858.1|5122909_5123893_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU36859.1|5123996_5124407_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36860.1|5125931_5126237_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36861.1|5126368_5127169_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU36862.1|5127189_5127456_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU36863.1|5127520_5128450_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36864.1|5128443_5128899_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36865.1|5128961_5129246_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36866.1|5129235_5129508_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU36867.1|5129525_5130380_+|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU36868.1|5130510_5132895_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36869.1|5132961_5133330_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36870.1|5133348_5133906_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36871.1|5135334_5135601_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU36872.1|5135684_5136422_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU36873.1|5136418_5136607_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36874.1|5136736_5137582_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.7	1.5e-44
AZU36875.1|5137575_5137839_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU36876.1|5138504_5139236_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36877.1|5139227_5139554_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36878.1|5139703_5139907_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36879.1|5139903_5143551_-	urea carboxylase	NA	NA	NA	NA	NA
AZU36880.1|5143634_5145434_-	allophanate hydrolase	NA	NA	NA	NA	NA
AZU36881.1|5145559_5145748_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36882.1|5145783_5146260_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AZU36883.1|5146323_5146893_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU36884.1|5147009_5147582_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU36885.1|5147666_5148410_+	oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.8	5.0e-15
AZU36886.1|5148775_5149294_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36887.1|5150286_5150619_+	lipoprotein	NA	NA	NA	NA	NA
AZU36888.1|5150933_5152859_+	aminopeptidase precursor	NA	NA	NA	NA	NA
AZU36889.1|5152926_5153106_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36890.1|5153208_5154597_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AZU36891.1|5154951_5155242_-	XRE family transcriptional regulator	NA	M9MUN2	Rhodococcus_phage	52.5	2.8e-14
AZU36892.1|5155259_5155373_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36893.1|5155637_5158145_-	exodeoxyribonuclease V subunit alpha	NA	A0A0N9S864	Staphylococcus_phage	44.9	3.7e-09
AZU36894.1|5158332_5162319_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	21.9	2.4e-10
AZU36895.1|5162315_5165720_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
AZU36896.1|5166072_5170848_-	hemagglutinin	NA	F5B3Z3	Synechococcus_phage	50.5	9.4e-22
AZU36897.1|5171109_5171661_+	microcystin-dependent protein	NA	A0A0U4JQ24	Arthrobacter_phage	32.6	1.1e-11
AZU36898.1|5171708_5172236_+|tail	tail collar protein	tail	A0A0U4JYA4	Arthrobacter_phage	34.3	4.5e-18
AZU36899.1|5172840_5173389_+	acetyltransferase	NA	NA	NA	NA	NA
AZU36900.1|5173407_5173695_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36901.1|5174076_5174871_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
AZU36902.1|5174870_5175620_+	ABC transporter permease	NA	NA	NA	NA	NA
AZU36903.1|5175631_5176177_+	mammalian cell entry protein	NA	NA	NA	NA	NA
AZU36904.1|5176173_5176836_+	organic solvent ABC transporter	NA	NA	NA	NA	NA
AZU36905.1|5176825_5177116_+	anti-sigma B factor antagonist	NA	NA	NA	NA	NA
AZU36906.1|5177126_5178182_+	lipoprotein	NA	NA	NA	NA	NA
AZU36907.1|5178453_5179191_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU36908.1|5179274_5179541_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
CP012064	Xanthomonas axonopodis pv. phaseoli strain ISO18C8 plasmid pXap59, complete sequence	58947	7557	24085	58947	transposase	Leptospira_phage(50.0%)	17	NA	NA
AZU36952.1|7557_7824_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU36953.1|7817_8645_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.2	9.8e-44
AZU36954.1|9463_9643_-	hypothetical protein	NA	A0A218MNI4	uncultured_virus	47.2	3.8e-09
AZU36955.1|9836_10574_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.7	5.7e-43
AZU36956.1|10657_10924_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU36957.1|12160_13201_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	27.5	1.9e-07
AZU36958.1|13360_13681_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36959.1|13724_13955_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36960.1|13951_14263_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36961.1|14404_14926_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36962.1|14947_16174_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU36963.1|16154_16382_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36964.1|16378_16720_-	hypothetical protein	NA	NA	NA	NA	NA
AZU36965.1|18343_18820_+	hypothetical protein	NA	NA	NA	NA	NA
AZU36966.1|19481_20309_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.2	9.8e-44
AZU36967.1|20302_20569_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU36968.1|21055_24085_-|transposase	transposase	transposase	NA	NA	NA	NA
