The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	14361	78240	5219277	transposase	Synechococcus_phage(12.5%)	53	NA	NA
AZU23915.1|14361_15189_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU23916.1|15182_15449_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU23917.1|15909_16677_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AZU23918.1|16684_16954_-	membrane protein	NA	NA	NA	NA	NA
AZU23919.1|17028_18489_-	cardiolipin synthetase	NA	NA	NA	NA	NA
AZU23920.1|18813_19539_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU23921.1|19588_19954_+	hypothetical protein	NA	NA	NA	NA	NA
AZU23922.1|20078_21206_-	DNA repair photolyase	NA	NA	NA	NA	NA
AZU23923.1|21391_22093_-	2OG-Fe(II) oxygenase	NA	A0A1D8KQ73	Synechococcus_phage	44.7	5.1e-17
AZU23924.1|22372_23713_-	membrane protein	NA	NA	NA	NA	NA
AZU23925.1|23936_24629_+	membrane protein	NA	NA	NA	NA	NA
AZU23926.1|24735_25056_+	hypothetical protein	NA	NA	NA	NA	NA
AZU23927.1|25055_26063_+	3-phosphoglycerate dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.6	2.5e-09
AZU23928.1|26210_27743_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	29.5	4.5e-26
AZU23929.1|27846_29082_-	peptidase M23	NA	A0A2H4J5G2	uncultured_Caudovirales_phage	32.0	4.6e-05
AZU23930.1|29242_29899_+	hypothetical protein	NA	NA	NA	NA	NA
AZU23931.1|30060_31857_+	aminopeptidase	NA	NA	NA	NA	NA
AZU23932.1|32169_32613_-	peptidase propeptide and ypeb domain-containing protein	NA	NA	NA	NA	NA
AZU23933.1|32910_34044_-	cellulase	NA	NA	NA	NA	NA
AZU23934.1|34665_35718_-	cellulase	NA	NA	NA	NA	NA
AZU23935.1|35847_36255_-	hypothetical protein	NA	NA	NA	NA	NA
AZU23936.1|36492_37566_-	cellulase	NA	NA	NA	NA	NA
AZU23937.1|37873_38932_+	hydroxyacid dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.4	3.0e-77
AZU23938.1|39039_39615_-	hypothetical protein	NA	NA	NA	NA	NA
AZU23939.1|40026_41508_-	glutamate synthase	NA	NA	NA	NA	NA
AZU23940.1|41638_46111_-	glutamate synthase	NA	NA	NA	NA	NA
AZU23941.1|46313_46694_-	Elastase inhibitor AFLEI Flags: Precursor	NA	NA	NA	NA	NA
AZU23942.1|46750_48028_+	DNA topoisomerase	NA	A0A0U2TSJ7	Niemeyer_virus	35.5	2.4e-41
AZU23943.1|48245_48590_-	hypothetical protein	NA	NA	NA	NA	NA
AZU23944.1|48968_49838_-	NmrA family transcriptional regulator	NA	NA	NA	NA	NA
AZU23945.1|50001_50877_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZU23946.1|51079_51466_+	methicillin resistance protein	NA	NA	NA	NA	NA
AZU23947.1|51469_53215_+	ankyrin	NA	NA	NA	NA	NA
AZU23948.1|54186_54366_-	hypothetical protein	NA	NA	NA	NA	NA
AZU23949.1|54356_54923_+	hypothetical protein	NA	NA	NA	NA	NA
AZU23950.1|54959_56141_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
AZU23951.1|56279_57065_-	Tat pathway signal protein	NA	NA	NA	NA	NA
AZU23952.1|57075_59691_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU23953.1|59835_60993_+	XylR family transcriptional regulator	NA	NA	NA	NA	NA
AZU23954.1|61137_63327_+	avirulence protein	NA	NA	NA	NA	NA
AZU23955.1|63814_65272_-	exonuclease	NA	NA	NA	NA	NA
AZU23956.1|65268_67764_-	helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	35.1	9.0e-08
AZU23957.1|67941_68604_+	hemolysin III	NA	NA	NA	NA	NA
AZU23958.1|68670_68928_+	prevent-host-death protein	NA	NA	NA	NA	NA
AZU23959.1|69387_70287_-	oxidoreductase	NA	NA	NA	NA	NA
AZU23960.1|70346_71084_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AZU23961.1|71209_72121_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU23962.1|72334_73414_-	hypothetical protein	NA	NA	NA	NA	NA
AZU23963.1|74729_74996_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU23964.1|75016_75817_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU23965.1|76159_76777_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
AZU23966.1|76852_76987_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU23967.1|77259_78240_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	62.3	4.7e-101
>prophage 2
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	358598	424045	5219277	tRNA,transposase	uncultured_virus(20.0%)	58	NA	NA
AZU24203.1|358598_358865_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU24204.1|359522_360749_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU24205.1|360765_361023_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24206.1|361130_361493_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24207.1|361479_361722_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24208.1|361694_362129_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24209.1|362230_362575_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24210.1|362606_363023_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24211.1|363350_363614_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU24212.1|363607_364453_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.7	1.5e-44
AZU24213.1|365525_367364_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AZU24214.1|367747_369109_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU24215.1|369105_369237_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24216.1|369235_369424_+	proteinase inhibitor	NA	NA	NA	NA	NA
AZU24217.1|369481_370027_-	carbonic anhydrase	NA	NA	NA	NA	NA
AZU24218.1|370023_370248_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24219.1|370488_371799_+	MFS transporter	NA	NA	NA	NA	NA
AZU24220.1|371947_373207_+	phosphodiesterase	NA	NA	NA	NA	NA
AZU24221.1|373648_374179_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZU24222.1|375371_376139_+	3-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
AZU24223.1|376169_377651_+	benzaldehyde dehydrogenase	NA	NA	NA	NA	NA
AZU24224.1|378193_379078_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZU24225.1|379174_380359_+	4-hydroxybenzoate 3-monooxygenase	NA	NA	NA	NA	NA
AZU24226.1|380809_381322_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24227.1|381437_382937_-	glycerol kinase	NA	NA	NA	NA	NA
AZU24228.1|383076_383898_-	glycerol transporter	NA	NA	NA	NA	NA
AZU24229.1|384072_385587_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZU24230.1|385809_386637_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AZU24231.1|387042_388026_-	diguanylate cyclase	NA	NA	NA	NA	NA
AZU24232.1|388126_389203_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AZU24233.1|389453_390317_+	3-oxoadipate:succinyl-CoA transferase	NA	NA	NA	NA	NA
AZU24234.1|391094_392303_+	beta-ketoadipyl CoA thiolase	NA	NA	NA	NA	NA
AZU24235.1|392381_393119_+	protocatechuate 3,4-dioxygenase	NA	NA	NA	NA	NA
AZU24236.1|393123_393687_+	protocatechuate 3,4-dioxygenase	NA	NA	NA	NA	NA
AZU24237.1|394041_395394_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
AZU24238.1|395404_396187_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AZU24239.1|396213_396627_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AZU24240.1|396806_397733_+	hydrolase	NA	NA	NA	NA	NA
AZU24241.1|398070_398931_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZU24242.1|399079_399940_+	kinase	NA	NA	NA	NA	NA
AZU24243.1|400215_401184_+	lipase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	28.3	1.9e-22
AZU24244.1|401482_402193_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24245.1|402401_404306_-|tRNA	tRNA uridine 5-carboxymethylaminomethyl modification protein	tRNA	NA	NA	NA	NA
AZU24246.1|404876_405350_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24247.1|405507_406467_+	serine dehydratase	NA	NA	NA	NA	NA
AZU24248.1|406451_407069_+	protein sanA-like protein	NA	NA	NA	NA	NA
AZU24249.1|407112_407532_+	isopropylmalate/homocitrate/citramalate synthase	NA	NA	NA	NA	NA
AZU24250.1|407736_408642_-	aspartyl beta-hydroxylase	NA	S4VR59	Pandoravirus	39.5	1.2e-37
AZU24251.1|408889_409774_-	malonyl-CoA O-methyltransferase	NA	NA	NA	NA	NA
AZU24252.1|410680_411442_-	pimelyl-ACP methyl ester esterase	NA	NA	NA	NA	NA
AZU24253.1|411544_411919_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24254.1|412110_413316_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AZU24255.1|413407_414442_-	biotin synthase	NA	NA	NA	NA	NA
AZU24256.1|414485_415217_+	competence protein ComF	NA	NA	NA	NA	NA
AZU24257.1|415484_416390_-	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AZU24258.1|417349_418801_-	HpaF protein	NA	NA	NA	NA	NA
AZU24259.1|419850_422280_-	serine kinase	NA	NA	NA	NA	NA
AZU24260.1|423061_424045_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
>prophage 3
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	651167	717933	5219277	transposase	uncultured_virus(16.67%)	46	NA	NA
AZU24448.1|651167_652394_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU24449.1|653513_654248_-	oxidoreductase	NA	NA	NA	NA	NA
AZU24450.1|654298_655243_+	cupin	NA	NA	NA	NA	NA
AZU24451.1|655797_657294_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24452.1|657596_657908_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24453.1|657980_659567_-	oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
AZU24454.1|659925_660705_+	hypothetical protein	NA	A0A2D2W2L0	Stenotrophomonas_phage	66.9	2.4e-92
AZU24455.1|660864_661839_+	glutathionyl-hydroquinone reductase YqjG	NA	NA	NA	NA	NA
AZU24456.1|661912_662308_+	glyoxalase	NA	NA	NA	NA	NA
AZU24457.1|662454_662916_-	membrane protein	NA	NA	NA	NA	NA
AZU24458.1|663416_664244_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU24459.1|664237_664504_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU24460.1|664701_665337_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24461.1|665784_666024_+	membrane protein	NA	NA	NA	NA	NA
AZU24462.1|666425_668753_-	peptidase S9	NA	NA	NA	NA	NA
AZU24463.1|669152_670586_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24464.1|670627_671719_-	lipoprotein	NA	NA	NA	NA	NA
AZU24465.1|672221_674096_+	histidine kinase	NA	A0A127AWB9	Bacillus_phage	31.5	2.2e-14
AZU24466.1|674157_674679_+	BadM/Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AZU24467.1|674781_675681_+	thioredoxin reductase	NA	NA	NA	NA	NA
AZU24468.1|676041_676233_+	membrane protein	NA	NA	NA	NA	NA
AZU24469.1|676457_677009_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24470.1|677214_678099_-	methyltransferase	NA	NA	NA	NA	NA
AZU24471.1|678297_679173_+	membrane protein	NA	NA	NA	NA	NA
AZU24472.1|679448_681221_-	cellulase	NA	NA	NA	NA	NA
AZU24473.1|681414_681522_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24474.1|681628_683329_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
AZU24475.1|683476_683770_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24476.1|684230_684464_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24477.1|684482_685859_+	amino acid permease	NA	NA	NA	NA	NA
AZU24478.1|685944_687066_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AZU24479.1|687309_688221_+	magnesium transporter	NA	NA	NA	NA	NA
AZU24480.1|688423_689119_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24481.1|689700_691374_-	trehalase	NA	NA	NA	NA	NA
AZU24482.1|691647_692418_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24483.1|692522_693275_+	endonuclease	NA	NA	NA	NA	NA
AZU24484.1|693804_694797_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24485.1|695153_696083_-	histidine kinase	NA	NA	NA	NA	NA
AZU24486.1|696649_699529_-	peptidase M16	NA	NA	NA	NA	NA
AZU24487.1|702607_703705_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU24488.1|704049_707340_+	ATPase	NA	A0A1V0SGX0	Hokovirus	36.8	1.4e-32
AZU24489.1|707366_708005_-	chemotaxis protein CheY	NA	NA	NA	NA	NA
AZU24490.1|710297_716336_+	hypothetical protein	NA	A0A2L1IV18	Escherichia_phage	25.6	2.6e-53
AZU24491.1|716449_716797_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24492.1|716845_717583_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU24493.1|717666_717933_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	852278	937680	5219277	tRNA,transposase,protease	Staphylococcus_phage(20.0%)	58	NA	NA
AZU24599.1|852278_855113_-|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0S951	Catovirus	34.3	3.9e-132
AZU24600.1|855320_855746_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AZU24601.1|855745_856117_-	membrane protein	NA	NA	NA	NA	NA
AZU24602.1|856116_857589_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	9.0e-48
AZU24603.1|857696_858779_+	membrane protein	NA	NA	NA	NA	NA
AZU24604.1|858775_859882_+	membrane protein	NA	NA	NA	NA	NA
AZU24605.1|859983_860181_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24606.1|860440_860902_-	membrane protein	NA	NA	NA	NA	NA
AZU24607.1|861289_862261_+	recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.5	3.5e-16
AZU24608.1|862743_863541_+	chitinase	NA	NA	NA	NA	NA
AZU24609.1|864058_868111_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	9.8e-121
AZU24610.1|868780_871927_+	adhesin	NA	NA	NA	NA	NA
AZU24611.1|872029_873913_+|protease	protease	protease	A0A217EQY2	Bacillus_phage	31.7	3.6e-17
AZU24612.1|874452_881523_+	membrane protein	NA	NA	NA	NA	NA
AZU24613.1|881746_883627_+|protease	protease	protease	A0A1B0T6A2	Bacillus_phage	33.2	2.3e-24
AZU24614.1|883756_885484_+	general secretion pathway protein GspE	NA	NA	NA	NA	NA
AZU24615.1|885659_886877_+	general secretion pathway protein GspF	NA	NA	NA	NA	NA
AZU24616.1|887147_887579_+	general secretion pathway protein GspG	NA	NA	NA	NA	NA
AZU24617.1|887588_888098_+	general secretion pathway protein GspH	NA	NA	NA	NA	NA
AZU24618.1|888094_888511_+	general secretion pathway protein GspI	NA	NA	NA	NA	NA
AZU24619.1|888507_889143_+	general secretion pathway protein GspJ	NA	NA	NA	NA	NA
AZU24620.1|889139_889991_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
AZU24621.1|889987_891109_+	general secretion pathway protein GspL	NA	NA	NA	NA	NA
AZU24622.1|891092_891746_+	general secretion pathway protein GspM	NA	NA	NA	NA	NA
AZU24623.1|891735_892527_+	general secretion pathway protein GspN	NA	NA	NA	NA	NA
AZU24624.1|892523_894824_+	general secretion pathway protein GspD	NA	A7BJX1	Enterobacteria_phage	24.5	3.4e-09
AZU24625.1|894820_895660_+	glycosyltransferase	NA	NA	NA	NA	NA
AZU24626.1|896073_896802_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZU24627.1|896907_897483_-	aminotransferase	NA	NA	NA	NA	NA
AZU24628.1|897706_899869_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU24629.1|899900_901058_-	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AZU24630.1|901658_902498_+	glycosyl transferase	NA	NA	NA	NA	NA
AZU24631.1|903672_905580_+	glycosyltransferase	NA	NA	NA	NA	NA
AZU24632.1|905629_906925_+	membrane protein	NA	NA	NA	NA	NA
AZU24633.1|906906_907875_+	glycosidase-like protein	NA	NA	NA	NA	NA
AZU24634.1|909238_909505_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU24635.1|909525_910326_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU24636.1|910375_910648_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24637.1|910853_911309_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24638.1|911337_911814_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24639.1|911899_914044_+	cellulose synthase	NA	NA	NA	NA	NA
AZU24640.1|914088_916416_+	cation tolerance protein CutA	NA	NA	NA	NA	NA
AZU24641.1|916412_917594_+	1,4-D-glucanase	NA	NA	NA	NA	NA
AZU24642.1|922386_924045_-|protease	serine protease	protease	NA	NA	NA	NA
AZU24643.1|924037_924463_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24644.1|924827_925250_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	63.0	3.0e-41
AZU24645.1|925586_926102_+	peptide deformylase	NA	NA	NA	NA	NA
AZU24646.1|926334_927996_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	28.8	5.4e-41
AZU24647.1|928220_928715_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24648.1|928912_930166_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	3.5e-101
AZU24649.1|930268_930793_+	NrdR family transcriptional regulator	NA	NA	NA	NA	NA
AZU24650.1|930789_931278_+	acetyltransferase	NA	NA	NA	NA	NA
AZU24651.1|931270_932386_+	riboflavin biosynthesis protein RibD	NA	A0A1V0SE20	Indivirus	35.3	4.1e-45
AZU24652.1|933154_934381_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU24653.1|934562_934970_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24654.1|935139_935742_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	38.0	6.1e-27
AZU24655.1|935738_936878_+	3,4-dihydroxy-2-butanone 4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	34.3	2.1e-52
AZU24656.1|937215_937680_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	40.9	1.7e-24
>prophage 5
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	1193025	1248017	5219277	transposase,protease	uncultured_virus(25.0%)	43	NA	NA
AZU24886.1|1193025_1194252_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU24887.1|1194331_1195315_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU24888.1|1195630_1196728_+	membrane protein	NA	NA	NA	NA	NA
AZU24889.1|1196919_1197435_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24890.1|1197454_1198315_+	pseudouridylate synthase	NA	NA	NA	NA	NA
AZU24891.1|1198265_1198658_-	HNH endonuclease	NA	NA	NA	NA	NA
AZU24892.1|1198660_1199869_-	2-amino-3-ketobutyrate CoA ligase	NA	V5LQ39	Emiliania_huxleyi_virus	26.2	1.3e-20
AZU24893.1|1199959_1201057_+	sulfate transporter subunit	NA	NA	NA	NA	NA
AZU24894.1|1201060_1201921_+	sulfate/thiosulfate transporter subunit	NA	NA	NA	NA	NA
AZU24895.1|1201917_1202871_+	sulfate/thiosulfate transporter permease subunit	NA	NA	NA	NA	NA
AZU24896.1|1202878_1203925_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	1.2e-25
AZU24897.1|1204191_1204908_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24898.1|1205708_1206935_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU24899.1|1206996_1208019_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
AZU24900.1|1208583_1210917_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU24901.1|1211116_1213198_+	phospholipase C	NA	NA	NA	NA	NA
AZU24902.1|1213358_1215518_+	dipeptidyl-peptidase 7	NA	NA	NA	NA	NA
AZU24903.1|1215609_1216254_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
AZU24904.1|1216470_1217019_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24905.1|1217247_1218567_+	folylpolyglutamate synthase	NA	NA	NA	NA	NA
AZU24906.1|1218634_1219717_+	sporulation protein	NA	NA	NA	NA	NA
AZU24907.1|1219930_1220677_+	colicin V synthesis protein	NA	NA	NA	NA	NA
AZU24908.1|1220707_1222174_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.9	4.1e-85
AZU24909.1|1222369_1223194_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24910.1|1225158_1225578_+	lipoprotein	NA	NA	NA	NA	NA
AZU24911.1|1225766_1226510_-	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AZU24912.1|1227070_1227613_-	phosphoesterase	NA	NA	NA	NA	NA
AZU24913.1|1227593_1228730_-	glycosyl transferase	NA	NA	NA	NA	NA
AZU24914.1|1228974_1230501_-	exopolyphosphatase	NA	NA	NA	NA	NA
AZU24915.1|1230673_1232776_-	polyphosphate kinase	NA	NA	NA	NA	NA
AZU24916.1|1232888_1234217_-	histidine kinase	NA	W8CYF6	Bacillus_phage	33.3	6.4e-29
AZU24917.1|1234289_1234979_-	transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
AZU24918.1|1235161_1236868_-	peptidase	NA	NA	NA	NA	NA
AZU24919.1|1236957_1237266_+	glutaredoxin	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	2.1e-07
AZU24920.1|1237262_1237658_+	alkylhydroperoxidase	NA	NA	NA	NA	NA
AZU24921.1|1238019_1239027_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
AZU24922.1|1239165_1239927_-	membrane protein	NA	NA	NA	NA	NA
AZU24923.1|1241106_1241751_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24924.1|1242097_1243324_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU24925.1|1243812_1244073_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24926.1|1244593_1245886_+	trigger factor	NA	NA	NA	NA	NA
AZU24927.1|1245978_1246605_+|protease	Clp protease ClpP	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
AZU24928.1|1246730_1248017_+|protease	Clp protease ATP-binding protein	protease	G3M9Z9	Bacillus_virus	59.9	5.3e-137
>prophage 6
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	1321779	1390272	5219277	transposase,protease	Brazilian_cedratvirus(16.67%)	50	NA	NA
AZU24991.1|1321779_1322643_+|protease	membrane protease HflC	protease	NA	NA	NA	NA
AZU24992.1|1323267_1323732_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU24993.1|1324211_1325504_+	adenylosuccinate synthetase	NA	A0A2R8FF47	Brazilian_cedratvirus	38.2	2.9e-74
AZU24994.1|1325871_1328544_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	28.6	8.6e-81
AZU24995.1|1328796_1328982_-	hypothetical protein	NA	NA	NA	NA	NA
AZU24996.1|1329236_1329950_-	oxidoreductase	NA	NA	NA	NA	NA
AZU24997.1|1330021_1330612_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU24998.1|1331388_1332024_+	hypothetical protein	NA	NA	NA	NA	NA
AZU24999.1|1333329_1333713_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25000.1|1334356_1335931_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AZU25001.1|1336339_1337092_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25002.1|1337442_1338198_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25003.1|1338264_1338894_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU25004.1|1339888_1340758_+	ADP-dependent (S)-NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AZU25005.1|1341177_1342656_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AZU25006.1|1342787_1344593_-	glycoside hydrolase family 15	NA	NA	NA	NA	NA
AZU25007.1|1345914_1348269_-	sugar hydrolase	NA	NA	NA	NA	NA
AZU25008.1|1348343_1348472_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25009.1|1348688_1348868_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25010.1|1348899_1349529_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AZU25011.1|1349873_1351583_+	thioredoxin reductase	NA	NA	NA	NA	NA
AZU25012.1|1351579_1351885_+	zinc finger UbP-type protein	NA	NA	NA	NA	NA
AZU25013.1|1352081_1352828_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AZU25014.1|1352976_1353615_+	guanosine polyphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AZU25015.1|1353698_1353806_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25016.1|1353872_1356395_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.5	1.0e-152
AZU25017.1|1357080_1363086_+	transducer protein car	NA	NA	NA	NA	NA
AZU25018.1|1364178_1366476_-	aldehyde oxidase	NA	NA	NA	NA	NA
AZU25019.1|1366472_1367561_-	FAD-binding molybdopterin dehydrogenase	NA	NA	NA	NA	NA
AZU25020.1|1367533_1368112_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AZU25021.1|1368409_1369741_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25022.1|1369737_1370331_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25023.1|1370393_1370738_+	cupin	NA	NA	NA	NA	NA
AZU25024.1|1370897_1371401_+	DNA-binding protein	NA	NA	NA	NA	NA
AZU25025.1|1371509_1371935_-	death-on-curing protein	NA	A0A1B3AYM0	Gordonia_phage	54.7	3.1e-09
AZU25026.1|1371943_1372165_-	transcriptional regulator	NA	NA	NA	NA	NA
AZU25027.1|1372315_1372921_+	LexA family transcriptional regulator	NA	A0A1W6JNS2	Morganella_phage	38.5	2.5e-12
AZU25028.1|1372922_1373576_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AZU25029.1|1373585_1375004_+	DNA repair nucleotidyltransferase	NA	NA	NA	NA	NA
AZU25030.1|1375049_1375193_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25031.1|1375179_1378431_+	DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.9	2.7e-81
AZU25032.1|1378863_1380456_+	peptidase S9	NA	NA	NA	NA	NA
AZU25033.1|1380665_1381484_+	histidine kinase	NA	NA	NA	NA	NA
AZU25034.1|1381911_1383864_+	peptide transporter	NA	NA	NA	NA	NA
AZU25035.1|1384740_1385007_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU25036.1|1385000_1385828_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU25037.1|1385852_1386611_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25038.1|1386905_1389026_+	peptidase S9	NA	NA	NA	NA	NA
AZU25039.1|1389184_1390012_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU25040.1|1390005_1390272_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	1394353	1457188	5219277	tRNA,transposase	Bacillus_phage(20.0%)	56	NA	NA
AZU25043.1|1394353_1395091_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU25044.1|1395174_1395441_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU25045.1|1395864_1397091_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU25046.1|1397071_1398778_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25047.1|1399184_1401293_-	catalase	NA	A0A2K9L0T1	Tupanvirus	47.9	7.3e-136
AZU25048.1|1401497_1402352_-	hypothetical protein	NA	A0A2H4PQR8	Staphylococcus_phage	30.0	5.8e-23
AZU25049.1|1402409_1404044_-	carboxylesterase	NA	A0A0M4JT58	Mollivirus	29.7	3.6e-37
AZU25050.1|1404211_1407076_-	glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.9	1.5e-261
AZU25051.1|1407542_1407722_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25052.1|1408144_1408948_+	sulfotransferase	NA	NA	NA	NA	NA
AZU25053.1|1409033_1410272_+	hemolysin D	NA	NA	NA	NA	NA
AZU25054.1|1410268_1412425_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	4.5e-32
AZU25055.1|1412703_1413957_+	MFS transporter	NA	NA	NA	NA	NA
AZU25056.1|1413973_1414336_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25057.1|1414340_1415195_-|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU25058.1|1415423_1416161_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU25059.1|1416244_1416511_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU25060.1|1418807_1420475_-	membrane protein	NA	NA	NA	NA	NA
AZU25061.1|1420471_1421236_-	membrane protein	NA	NA	NA	NA	NA
AZU25062.1|1421335_1423069_-	membrane protein	NA	NA	NA	NA	NA
AZU25063.1|1423285_1424002_+	chemotaxis protein CheY	NA	W8CYM9	Bacillus_phage	34.8	1.3e-23
AZU25064.1|1423967_1425284_+	histidine kinase	NA	NA	NA	NA	NA
AZU25065.1|1425468_1425960_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25066.1|1426028_1426286_-	cell division topological specificity factor	NA	NA	NA	NA	NA
AZU25067.1|1426288_1427098_-	cell division inhibitor MinD	NA	NA	NA	NA	NA
AZU25068.1|1427133_1427877_-	septum formation inhibitor	NA	NA	NA	NA	NA
AZU25069.1|1427880_1428480_-	acetyltransferase	NA	NA	NA	NA	NA
AZU25070.1|1428714_1429911_+	histidine kinase	NA	NA	NA	NA	NA
AZU25071.1|1429910_1430552_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AZU25072.1|1430460_1430826_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25073.1|1430902_1432084_+	polyketide cyclase	NA	NA	NA	NA	NA
AZU25074.1|1432165_1432552_+	membrane protein	NA	NA	NA	NA	NA
AZU25075.1|1432554_1433229_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AZU25076.1|1433304_1434102_-	peptidase	NA	NA	NA	NA	NA
AZU25077.1|1434229_1434412_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25078.1|1434408_1434693_-	membrane protein	NA	NA	NA	NA	NA
AZU25079.1|1434844_1435714_-	membrane protein	NA	NA	NA	NA	NA
AZU25080.1|1435838_1437041_+	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AZU25081.1|1437316_1438645_-	endonuclease	NA	NA	NA	NA	NA
AZU25082.1|1438598_1439513_-|tRNA	arginyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
AZU25083.1|1439553_1440162_+	calcium-binding protein	NA	NA	NA	NA	NA
AZU25084.1|1440328_1440784_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25085.1|1441094_1442288_-	RNA polymerase sigma70	NA	NA	NA	NA	NA
AZU25086.1|1442397_1442910_-	pathogenicity-like protein	NA	NA	NA	NA	NA
AZU25087.1|1443141_1444047_-	palmitoyl-CoA hydrolase	NA	NA	NA	NA	NA
AZU25088.1|1444117_1444888_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AZU25089.1|1444953_1445382_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25090.1|1445498_1445903_-	thioesterase	NA	NA	NA	NA	NA
AZU25091.1|1445902_1448869_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	4.3e-307
AZU25092.1|1449161_1449482_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
AZU25093.1|1449494_1449755_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
AZU25094.1|1449987_1451040_+	GTPase CgtA	NA	NA	NA	NA	NA
AZU25095.1|1451131_1451401_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AZU25096.1|1451517_1453110_+	membrane protein	NA	NA	NA	NA	NA
AZU25097.1|1453297_1454350_+	riboflavin kinase	NA	NA	NA	NA	NA
AZU25098.1|1454356_1457188_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.3	7.5e-43
>prophage 8
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	1473447	1545844	5219277	tRNA,transposase	Hokovirus(20.0%)	59	NA	NA
AZU25116.1|1473447_1474185_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU25117.1|1474268_1474535_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU25118.1|1474669_1475587_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25119.1|1475812_1479325_-	phospholipase	NA	NA	NA	NA	NA
AZU25120.1|1479339_1479600_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25121.1|1479930_1480170_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25122.1|1480260_1480506_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25123.1|1481159_1481747_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25124.1|1482082_1482646_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25125.1|1482656_1483763_-	recombinase	NA	A0A0A1I5U0	Burkholderia_phage	35.4	2.4e-45
AZU25126.1|1484324_1485260_+	cytochrome C oxidase subunit II	NA	NA	NA	NA	NA
AZU25127.1|1485259_1487260_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AZU25128.1|1487262_1487889_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AZU25129.1|1487888_1488224_+	cytochrome C oxidase	NA	NA	NA	NA	NA
AZU25130.1|1488575_1490273_+	peptidase M61	NA	NA	NA	NA	NA
AZU25131.1|1490514_1491906_+	DNA repair protein RadA	NA	NA	NA	NA	NA
AZU25132.1|1492319_1492706_+	membrane protein	NA	NA	NA	NA	NA
AZU25133.1|1493233_1494025_-	transcriptional regulator	NA	NA	NA	NA	NA
AZU25134.1|1494825_1496256_+	DNA-binding protein	NA	NA	NA	NA	NA
AZU25135.1|1496464_1498333_+	histidine kinase	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.0	4.0e-16
AZU25136.1|1498358_1500683_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25137.1|1501338_1502181_+	polyvinylalcohol dehydrogenase	NA	NA	NA	NA	NA
AZU25138.1|1502182_1502545_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
AZU25139.1|1502929_1503940_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU25140.1|1503936_1504812_+	histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	29.1	4.1e-24
AZU25141.1|1504801_1506757_+	histidine kinase	NA	NA	NA	NA	NA
AZU25142.1|1506850_1508557_-	glycosyl hydrolase family 43	NA	NA	NA	NA	NA
AZU25143.1|1508793_1511163_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU25144.1|1511269_1511716_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	38.4	9.4e-09
AZU25145.1|1511889_1512255_-	RNA signal recognition particle 4.5S RNA	NA	NA	NA	NA	NA
AZU25146.1|1512616_1513747_-	histidine kinase	NA	W8CYM9	Bacillus_phage	32.0	9.7e-10
AZU25147.1|1513743_1514328_-	chemotaxis protein CheB	NA	NA	NA	NA	NA
AZU25148.1|1514324_1515149_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
AZU25149.1|1515145_1518319_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	41.3	4.6e-33
AZU25150.1|1518478_1519642_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU25151.1|1519634_1520003_+	chemotaxis protein CheY	NA	NA	NA	NA	NA
AZU25152.1|1520230_1521814_-	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AZU25153.1|1521877_1522006_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25154.1|1522051_1523101_+	aldose epimerase	NA	NA	NA	NA	NA
AZU25155.1|1523376_1524168_-	membrane protein	NA	NA	NA	NA	NA
AZU25156.1|1524519_1525896_+	signal recognition particle	NA	NA	NA	NA	NA
AZU25157.1|1526635_1527706_+	2-nitropropane dioxygenase	NA	NA	NA	NA	NA
AZU25158.1|1527696_1528494_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25159.1|1528590_1528848_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AZU25160.1|1528891_1529404_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AZU25161.1|1529461_1530220_+|tRNA	tRNA (guanine-N1)-methyltransferase	tRNA	NA	NA	NA	NA
AZU25162.1|1530364_1530772_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZU25163.1|1531026_1532520_-	multidrug transporter MatE	NA	NA	NA	NA	NA
AZU25164.1|1532577_1532682_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25165.1|1533045_1533741_+	DNA-binding protein	NA	NA	NA	NA	NA
AZU25166.1|1533799_1534456_+	glutathione S-transferase	NA	NA	NA	NA	NA
AZU25167.1|1534680_1535088_+|tRNA	tRNA synthetase RNA-binding protein	tRNA	NA	NA	NA	NA
AZU25168.1|1535209_1537456_-	hydroperoxidase	NA	NA	NA	NA	NA
AZU25169.1|1537884_1538499_-	calcium-binding protein	NA	NA	NA	NA	NA
AZU25170.1|1538798_1541420_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.3	2.0e-29
AZU25171.1|1541532_1542387_-|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU25172.1|1542404_1542677_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU25173.1|1544741_1545005_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU25174.1|1544998_1545844_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.7	1.5e-44
>prophage 9
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	1683060	1723568	5219277	transposase,protease,coat	Shigella_phage(33.33%)	31	NA	NA
AZU25293.1|1683060_1684407_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
AZU25294.1|1684433_1685624_-	1-deoxy-D-xylulose 5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AZU25295.1|1685626_1686454_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AZU25296.1|1686450_1687209_-	UDP diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	32.6	1.0e-15
AZU25297.1|1687226_1687784_-	ribosome recycling factor	NA	NA	NA	NA	NA
AZU25298.1|1687985_1688708_-	uridylate kinase	NA	NA	NA	NA	NA
AZU25299.1|1688813_1690337_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.0	3.1e-19
AZU25300.1|1690611_1691490_-	elongation factor Ts	NA	NA	NA	NA	NA
AZU25301.1|1691659_1692457_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AZU25302.1|1692912_1693626_-	pilus assembly protein	NA	NA	NA	NA	NA
AZU25303.1|1693628_1693961_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25304.1|1694009_1695044_-|coat	spore coat protein U	coat	NA	NA	NA	NA
AZU25305.1|1695040_1697392_-	fimbriae usher protein	NA	NA	NA	NA	NA
AZU25306.1|1697408_1698179_-	pilus assembly protein	NA	NA	NA	NA	NA
AZU25307.1|1698187_1698712_-	sigma-fimbriae tip adhesin	NA	NA	NA	NA	NA
AZU25308.1|1699030_1699807_+	methionine aminopeptidase	NA	NA	NA	NA	NA
AZU25309.1|1699803_1702413_+	protein-PII uridylyltransferase	NA	NA	NA	NA	NA
AZU25310.1|1702434_1703631_+	2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AZU25311.1|1703821_1704178_+	arsenate reductase	NA	NA	NA	NA	NA
AZU25312.1|1704424_1705555_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AZU25313.1|1705847_1707542_+	asparagine synthetase B	NA	A0A0P0C1V4	Ostreococcus_lucimarinus_virus	39.0	1.2e-88
AZU25314.1|1707609_1708662_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25315.1|1708934_1709081_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25316.1|1709097_1711236_-	ligand-gated channel	NA	NA	NA	NA	NA
AZU25317.1|1711643_1714061_-	penicillin acylase	NA	NA	NA	NA	NA
AZU25318.1|1714207_1714693_+	bacterioferritin	NA	NA	NA	NA	NA
AZU25319.1|1714921_1715188_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU25320.1|1715181_1716009_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU25321.1|1717699_1719943_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
AZU25322.1|1722423_1722696_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU25323.1|1722713_1723568_+|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
>prophage 10
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	1901897	1971046	5219277	tRNA,transposase,protease,integrase	Catovirus(22.22%)	58	1930778:1930795	1957586:1957603
AZU25483.1|1901897_1903292_-|tRNA	asparaginyl-tRNA synthetase	tRNA	A0A2P1EMB4	Moumouvirus	39.0	1.1e-79
AZU25484.1|1903496_1903835_+	Fe-S cluster assembly protein HesB	NA	NA	NA	NA	NA
AZU25485.1|1904290_1904722_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AZU25486.1|1904733_1904964_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AZU25487.1|1905152_1905602_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AZU25488.1|1905811_1909315_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AZU25489.1|1909371_1910103_+	cell division protein ZipA	NA	NA	NA	NA	NA
AZU25490.1|1910109_1910493_+	membrane protein	NA	NA	NA	NA	NA
AZU25491.1|1910671_1911796_-	aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	24.7	4.5e-07
AZU25492.1|1912130_1914632_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	37.2	8.2e-118
AZU25493.1|1914628_1915591_+|tRNA	lysyl-tRNA synthetase	tRNA	A0A1V0SAC0	Catovirus	26.2	1.8e-20
AZU25494.1|1915699_1916386_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25495.1|1916573_1917638_+	methylthioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
AZU25496.1|1917847_1920547_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.4	9.8e-109
AZU25497.1|1920851_1923272_+	glucose dehydrogenase	NA	NA	NA	NA	NA
AZU25498.1|1923643_1924372_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25499.1|1924636_1926304_-	urocanate hydratase	NA	NA	NA	NA	NA
AZU25500.1|1926320_1927178_-	formimidoylglutamase	NA	NA	NA	NA	NA
AZU25501.1|1927174_1927363_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25502.1|1927359_1928901_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.8	1.3e-78
AZU25503.1|1928914_1930120_-	imidazolonepropionase	NA	NA	NA	NA	NA
AZU25504.1|1930180_1931551_+	N-formimino-L-glutamate deiminase	NA	NA	NA	NA	NA
1930778:1930795	attL	GCGCTGCCGGATGCGGTG	NA	NA	NA	NA
AZU25505.1|1931611_1931839_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25506.1|1931828_1932605_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZU25507.1|1932791_1933796_-	membrane protein	NA	NA	NA	NA	NA
AZU25508.1|1934332_1934893_-	poly(hydroxyalcanoate) granule associated protein	NA	NA	NA	NA	NA
AZU25509.1|1935055_1935331_-	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
AZU25510.1|1935568_1936378_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25511.1|1936319_1936976_-	sulfite oxidase	NA	NA	NA	NA	NA
AZU25512.1|1937101_1938070_-	sulfoxide reductase catalytic subunit YedY	NA	NA	NA	NA	NA
AZU25513.1|1938246_1939332_+	MFS transporter	NA	M1Q1P2	Streptococcus_phage	43.6	1.5e-76
AZU25514.1|1939415_1940624_+	prephenate dehydratase	NA	NA	NA	NA	NA
AZU25515.1|1940747_1942070_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZU25516.1|1942411_1942879_-	energy transducer TonB	NA	NA	NA	NA	NA
AZU25517.1|1943235_1943907_-	energy transducer TonB	NA	NA	NA	NA	NA
AZU25518.1|1944018_1945299_+|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.4	3.3e-99
AZU25519.1|1945619_1946204_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AZU25520.1|1946304_1947321_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZU25521.1|1947867_1949337_+|integrase	integrase	integrase	NA	NA	NA	NA
AZU25522.1|1949853_1950681_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU25523.1|1950674_1950941_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU25524.1|1951408_1952236_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU25525.1|1952229_1952496_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU25526.1|1954789_1955980_-	FAD-binding monooxygenase	NA	NA	NA	NA	NA
AZU25527.1|1956016_1956481_-	transcriptional regulator	NA	NA	NA	NA	NA
AZU25528.1|1956520_1956691_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25529.1|1956842_1956956_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25530.1|1959915_1960260_-	chemotaxis protein CheY	NA	NA	NA	NA	NA
1957586:1957603	attR	GCGCTGCCGGATGCGGTG	NA	NA	NA	NA
AZU25531.1|1960558_1962076_+	circadian clock protein KaiC	NA	NA	NA	NA	NA
AZU25532.1|1962062_1964135_+	histidine kinase	NA	NA	NA	NA	NA
AZU25533.1|1964492_1965200_-	C-type cytochrome biogenesis protein	NA	NA	NA	NA	NA
AZU25534.1|1965193_1965691_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AZU25535.1|1965690_1966233_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AZU25536.1|1966229_1968218_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AZU25537.1|1968281_1968752_-	cytochrome C biogenesis protein CcmE	NA	NA	NA	NA	NA
AZU25538.1|1968748_1968955_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
AZU25539.1|1968951_1969710_-	heme ABC transporter permease	NA	NA	NA	NA	NA
AZU25540.1|1969720_1971046_-|protease	serine protease	protease	A0A217EQY2	Bacillus_phage	39.6	5.3e-23
>prophage 11
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	2221191	2233968	5219277	transposase,protease	uncultured_virus(100.0%)	10	NA	NA
AZU25735.1|2221191_2221458_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU25736.1|2221451_2222279_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU25737.1|2222303_2223098_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25738.1|2223245_2225621_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25739.1|2225981_2226200_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25740.1|2226717_2227455_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU25741.1|2227538_2227805_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU25742.1|2229945_2230275_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25743.1|2230265_2231492_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU25744.1|2233416_2233968_-|protease	CAAX protease	protease	NA	NA	NA	NA
>prophage 12
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	2393248	2441234	5219277	transposase	Ralstonia_phage(40.0%)	34	NA	NA
AZU25852.1|2393248_2393515_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU25853.1|2393508_2394336_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU25854.1|2395354_2397013_-	chemotaxis protein	NA	NA	NA	NA	NA
AZU25855.1|2397015_2397642_-	chemotaxis protein	NA	NA	NA	NA	NA
AZU25856.1|2397641_2398034_-	histidine kinase	NA	NA	NA	NA	NA
AZU25857.1|2398069_2398837_-	flagellar biosynthesis sigma factor	NA	NA	NA	NA	NA
AZU25858.1|2398833_2399718_-	cobyrinic acid a,c-diamide synthase	NA	NA	NA	NA	NA
AZU25859.1|2399704_2401396_-	flagellar biosynthesis regulator FlhF	NA	NA	NA	NA	NA
AZU25860.1|2402147_2404241_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AZU25861.1|2404237_2405368_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
AZU25862.1|2405715_2407803_-	membrane protein	NA	G3MA91	Bacillus_virus	34.9	6.6e-20
AZU25863.1|2411236_2412220_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU25864.1|2415686_2416478_-	flagellar biosynthesis protein FliR	NA	NA	NA	NA	NA
AZU25865.1|2416491_2416761_-	flagellar biogenesis protein	NA	NA	NA	NA	NA
AZU25866.1|2417223_2418207_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU25867.1|2418868_2419714_-	flagellar biosynthesis protein flip	NA	NA	NA	NA	NA
AZU25868.1|2419715_2420123_-	flagellar protein	NA	NA	NA	NA	NA
AZU25869.1|2420119_2420458_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AZU25870.1|2420454_2421468_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AZU25871.1|2421478_2422006_-	flagellar basal body protein FliL	NA	NA	NA	NA	NA
AZU25872.1|2422196_2423489_-	flagellar protein	NA	NA	NA	NA	NA
AZU25873.1|2423485_2423941_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
AZU25874.1|2423944_2425321_-	flagellar protein FliI	NA	NA	NA	NA	NA
AZU25875.1|2425317_2425938_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AZU25876.1|2425934_2426924_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AZU25877.1|2426934_2428659_-	flagellar MS-ring protein	NA	NA	NA	NA	NA
AZU25878.1|2428672_2429044_-	flagellar hook-basal body protein	NA	NA	NA	NA	NA
AZU25879.1|2429473_2432968_-	O-antigen biosynthesis protein	NA	K7QL84	Escherichia_phage	25.9	6.5e-12
AZU25880.1|2433414_2433660_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25881.1|2436047_2436776_-	methyltransferase	NA	NA	NA	NA	NA
AZU25882.1|2436787_2437537_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AZU25883.1|2437580_2438864_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25884.1|2439806_2441033_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU25885.1|2441117_2441234_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	2570241	2598809	5219277	transposase,protease	Xanthomonas_phage(63.64%)	26	NA	NA
AZU25986.1|2570241_2572977_-|protease	serine protease	protease	NA	NA	NA	NA
AZU25987.1|2574100_2574376_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25988.1|2574853_2575270_+	membrane protein	NA	NA	NA	NA	NA
AZU25989.1|2575266_2576580_+	sorbosone dehydrogenase	NA	NA	NA	NA	NA
AZU25990.1|2576818_2577001_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25991.1|2577035_2578262_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU25992.1|2578304_2579333_-	hypothetical protein	NA	NA	NA	NA	NA
AZU25993.1|2580007_2580991_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU25994.1|2581071_2582298_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU25995.1|2583939_2584125_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	82.0	4.9e-20
AZU25996.1|2584124_2584310_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25997.1|2585486_2585783_+	hypothetical protein	NA	NA	NA	NA	NA
AZU25998.1|2585808_2586009_+	hypothetical protein	NA	A0A077JGA5	Xanthomonas_phage	98.5	6.7e-31
AZU25999.1|2586011_2586278_+	hypothetical protein	NA	A0A077JBM7	Xanthomonas_phage	75.0	1.8e-23
AZU26000.1|2586384_2587884_+	hypothetical protein	NA	A0A077JDC5	Xanthomonas_phage	86.2	2.9e-211
AZU26001.1|2587883_2588201_+	hypothetical protein	NA	A0A077JCZ2	Xanthomonas_phage	98.1	3.4e-53
AZU26002.1|2588197_2589364_+	zonular occludens toxin	NA	A0A077JGB2	Xanthomonas_phage	92.0	9.8e-207
AZU26003.1|2589363_2590020_+	conjugal transfer protein	NA	A0A077JBM8	Xanthomonas_phage	85.4	2.4e-101
AZU26004.1|2591035_2591356_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26005.1|2591799_2593026_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU26006.1|2593863_2595228_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZU26007.1|2595522_2596191_-	glycosyl transferase	NA	NA	NA	NA	NA
AZU26008.1|2596187_2596790_-	methyltransferase	NA	NA	NA	NA	NA
AZU26009.1|2596786_2597545_-	N- acetylglucosaminylphosphatidylinositol deacetylase	NA	NA	NA	NA	NA
AZU26010.1|2597532_2598051_-	dehydrogenase	NA	NA	NA	NA	NA
AZU26011.1|2598542_2598809_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	2829002	2879115	5219277	tRNA,transposase,protease	Moumouvirus(12.5%)	47	NA	NA
AZU26216.1|2829002_2830430_+|tRNA	cysteinyl-tRNA synthetase	tRNA	M1PG92	Moumouvirus	32.6	2.4e-37
AZU26217.1|2830994_2831432_+	Fe-S cluster assembly protein SufE	NA	NA	NA	NA	NA
AZU26218.1|2831428_2832679_+	multidrug transporter	NA	NA	NA	NA	NA
AZU26219.1|2832884_2833385_-	molecular chaperone DnaK	NA	NA	NA	NA	NA
AZU26220.1|2833431_2834010_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26221.1|2834009_2834303_+	membrane protein	NA	NA	NA	NA	NA
AZU26222.1|2834299_2835649_+	dihydroorotase	NA	NA	NA	NA	NA
AZU26223.1|2835648_2836491_+	peptidase M23	NA	A0A075BS18	Microcystis_phage	43.0	1.3e-14
AZU26224.1|2836565_2837108_+	glyoxalase	NA	NA	NA	NA	NA
AZU26225.1|2837526_2838891_+	ethanolamine permease	NA	NA	NA	NA	NA
AZU26226.1|2838887_2840297_+	ethanolamine ammonia-lyase	NA	NA	NA	NA	NA
AZU26227.1|2840293_2841109_+	ethanolamine ammonia-lyase	NA	NA	NA	NA	NA
AZU26228.1|2841165_2841456_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26229.1|2841549_2842431_-	beta-lactamase	NA	NA	NA	NA	NA
AZU26230.1|2842550_2843039_-	general stress protein	NA	NA	NA	NA	NA
AZU26231.1|2843649_2844495_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26232.1|2845868_2846852_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU26233.1|2847590_2849261_+	polygalacturonase	NA	NA	NA	NA	NA
AZU26234.1|2849346_2849613_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU26235.1|2849606_2850434_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU26236.1|2850671_2851361_-	phytoene synthase	NA	NA	NA	NA	NA
AZU26237.1|2851389_2852082_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AZU26238.1|2852167_2852887_-	3-demethylubiquinone-9 3-methyltransferase	NA	NA	NA	NA	NA
AZU26239.1|2852918_2854256_-	N-ethylammeline chlorohydrolase	NA	NA	NA	NA	NA
AZU26240.1|2854273_2855086_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26241.1|2855280_2855847_-	elongation factor P	NA	NA	NA	NA	NA
AZU26242.1|2855949_2856978_+	lysine 2,3-aminomutase	NA	NA	NA	NA	NA
AZU26243.1|2857211_2859329_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AZU26244.1|2859325_2860255_-	metal-binding protein	NA	NA	NA	NA	NA
AZU26245.1|2860306_2861071_-	RNA methyltransferase	NA	NA	NA	NA	NA
AZU26246.1|2861188_2862022_+	inositol monophosphatase	NA	NA	NA	NA	NA
AZU26247.1|2862217_2862829_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
AZU26248.1|2863083_2863524_+	ribonuclease	NA	NA	NA	NA	NA
AZU26249.1|2863520_2863946_+	barnase inhibitor	NA	NA	NA	NA	NA
AZU26250.1|2864228_2866118_-	ABC transporter ATPase	NA	A0A2K9L3Z8	Tupanvirus	27.4	3.6e-49
AZU26251.1|2866228_2867605_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	1.2e-54
AZU26252.1|2867706_2868267_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	49.0	6.5e-31
AZU26253.1|2868361_2869918_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26254.1|2870199_2871075_+	carboxylesterase	NA	NA	NA	NA	NA
AZU26255.1|2871169_2871997_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU26256.1|2871990_2872257_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU26257.1|2872484_2873183_-	glutathione S-transferase	NA	NA	NA	NA	NA
AZU26258.1|2873353_2873563_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	63.9	5.7e-17
AZU26259.1|2874118_2874667_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26260.1|2874663_2875845_+	membrane protein	NA	NA	NA	NA	NA
AZU26261.1|2876066_2878136_+	membrane protein	NA	NA	NA	NA	NA
AZU26262.1|2878236_2879115_-|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 15
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	2992959	3022284	5219277	tRNA,transposase	uncultured_Mediterranean_phage(83.33%)	29	NA	NA
AZU26346.1|2992959_2994186_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU26347.1|2994839_2995808_-	preprotein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	29.9	8.9e-28
AZU26348.1|2995922_2997767_-	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
AZU26349.1|2997957_2998311_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AZU26350.1|2998442_2999588_-|tRNA	queuine tRNA-ribosyltransferase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.9	1.9e-85
AZU26351.1|2999669_3000740_-|tRNA	S-adenosylmethionine:tRNA ribosyltransferase-isomerase	tRNA	NA	NA	NA	NA
AZU26352.1|3000893_3001325_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZU26353.1|3001324_3001429_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26354.1|3001446_3002943_+	lysine 6-aminotransferase	NA	NA	NA	NA	NA
AZU26355.1|3003085_3003283_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26356.1|3003279_3003987_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26357.1|3004362_3005742_-	phosphoesterase	NA	NA	NA	NA	NA
AZU26358.1|3005738_3006860_-	phytase	NA	NA	NA	NA	NA
AZU26359.1|3006856_3009415_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU26360.1|3009566_3010199_+	Uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AZU26361.1|3010572_3012333_-	cellulase	NA	NA	NA	NA	NA
AZU26362.1|3012329_3012443_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26363.1|3012623_3014402_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AZU26364.1|3014398_3014683_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.1e-18
AZU26365.1|3014673_3014856_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26366.1|3014914_3015412_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26367.1|3015458_3015965_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
AZU26368.1|3015961_3016585_-	methyltransferase	NA	NA	NA	NA	NA
AZU26369.1|3016824_3018729_+	heat shock protein 90	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.4	2.3e-112
AZU26370.1|3019322_3020060_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU26371.1|3020142_3020409_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU26372.1|3020402_3021230_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU26373.1|3021342_3021609_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU26374.1|3022017_3022284_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	3025313	3076628	5219277	transposase,integrase,portal,capsid,terminase,plate,head,tail	Stenotrophomonas_phage(55.17%)	59	3025245:3025304	3084918:3085306
3025245:3025304	attL	GGTAATCCCCCCGCCCATTAGCAGACGCCAGAAGTGGAATTTTCTCGTATCCTTTCTCGA	NA	NA	NA	NA
AZU26376.1|3025313_3025580_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU26377.1|3025699_3026128_+	hypothetical protein	NA	A0A218MND5	uncultured_virus	58.5	1.5e-08
AZU26378.1|3026982_3027249_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU26379.1|3027909_3028551_-	carboxypeptidase	NA	NA	NA	NA	NA
AZU26380.1|3030417_3031479_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26381.1|3031579_3032302_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26382.1|3032408_3034862_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26383.1|3034963_3035233_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26384.1|3035267_3035678_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26385.1|3035735_3036566_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26386.1|3036628_3037669_-	type IV secretion system energizing component VirB11	NA	NA	NA	NA	NA
AZU26387.1|3037683_3038853_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26388.1|3038849_3039617_-	Type IV secretory pathway, VirB9 component	NA	NA	NA	NA	NA
AZU26389.1|3039613_3040645_-	conjugative transfer protein	NA	NA	NA	NA	NA
AZU26390.1|3040770_3041181_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26391.1|3041513_3043187_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26392.1|3043223_3043466_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26393.1|3044344_3046366_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AZU26394.1|3047262_3048492_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.2	5.3e-118
AZU26395.1|3048491_3048710_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	55.9	3.3e-15
AZU26396.1|3048706_3048916_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26397.1|3048912_3049185_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26398.1|3049181_3049406_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26399.1|3049402_3049675_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26400.1|3049667_3049850_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26401.1|3049842_3050268_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26402.1|3050346_3050619_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26403.1|3050618_3050906_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26404.1|3050902_3051121_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26405.1|3051444_3053865_-	toprim domain protein	NA	V9IQW5	Stenotrophomonas_phage	68.8	4.0e-271
AZU26406.1|3053867_3054713_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.7	1.5e-44
AZU26407.1|3054706_3054970_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU26408.1|3055199_3056186_-	phage late control protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	51.8	1.7e-90
AZU26409.1|3056182_3056581_-	oxidoreductase	NA	V9IQX3	Stenotrophomonas_phage	61.4	4.6e-39
AZU26410.1|3056593_3059464_-|tail	tail protein	tail	V9IQL1	Stenotrophomonas_phage	48.0	1.2e-194
AZU26411.1|3059493_3059607_-	P2 GpE family protein	NA	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
AZU26412.1|3059615_3059918_-|tail	tail protein	tail	V9IQM4	Stenotrophomonas_phage	67.4	4.9e-25
AZU26413.1|3059962_3060472_-|tail	major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	80.5	3.6e-73
AZU26414.1|3060502_3061669_-|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	63.2	5.9e-135
AZU26415.1|3061680_3062040_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.9	1.5e-36
AZU26416.1|3062036_3062600_-|plate	baseplate assembly protein	plate	Q9ZXL0	Pseudomonas_virus	47.0	1.4e-25
AZU26417.1|3062660_3063239_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
AZU26418.1|3063248_3064754_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	46.6	1.0e-51
AZU26419.1|3064763_3065309_-|tail	tail protein	tail	V9IQK7	Stenotrophomonas_phage	54.7	4.6e-50
AZU26420.1|3065301_3065745_-|plate	baseplate assembly protein	plate	R4JDM0	Burkholderia_phage	53.8	1.3e-34
AZU26421.1|3066010_3066811_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU26422.1|3066831_3067098_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU26423.1|3067697_3068144_-|tail	tail protein	tail	V9IQH0	Stenotrophomonas_phage	62.4	1.6e-40
AZU26424.1|3068131_3068551_-|tail	tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	63.7	8.2e-39
AZU26425.1|3068547_3069036_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	51.7	7.6e-28
AZU26426.1|3069035_3069674_-	lysozyme	NA	V9IQK6	Stenotrophomonas_phage	61.5	2.1e-49
AZU26427.1|3069673_3069949_-	hypothetical protein	NA	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
AZU26428.1|3069941_3070298_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
AZU26429.1|3070302_3070512_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
AZU26430.1|3070511_3070979_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.0	1.2e-30
AZU26431.1|3071077_3071797_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	62.9	2.2e-68
AZU26432.1|3071800_3072820_-|capsid	capsid protein	capsid	Q9ZXM3	Pseudomonas_virus	69.7	6.7e-135
AZU26433.1|3072866_3073709_-|capsid	phage capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.1	2.9e-67
AZU26434.1|3075614_3076628_+|portal	Presumed portal vertex protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.8	3.6e-141
3084918:3085306	attR	GGTAATCCCCCCGCCCATTAGCAGACGCCAGAAGTGGAATTTTCTCGTATCCTTTCTCGAGGAGGTTCCATGAAGAAGTCCCGCTTTACCGACAGCCAGATCATCGCCGTGCTCAAGCAGGCCCAGGCCGGTGCGCCCGTGCCGGAGCTGTGCCGCGAGCACGGCATCAGCTCGGCCACGTTCTACAAGTGGCGCAGCAAGTTCGGCGGCATGGACGTGTCCATGGTCGCGCGCATGAAGGAGCTGGAGGAGGAGAACCGCCGGCTCAAGAAGATGTACGCCGAGGCGCAGCTCAGTACCGACCTGCTGAAGGAAGCGCTCGCAAAAAAATGGTGAGGCCATCTCAGCGACGCGAGATGGCCCAATCGGCAGTCACGAGCGGGCGTACG	NA	NA	NA	NA
>prophage 17
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	3405865	3464431	5219277	transposase	Prochlorococcus_phage(25.0%)	57	NA	NA
AZU26712.1|3405865_3407092_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU26713.1|3407257_3408229_+	thiamine biosynthesis protein ApbE	NA	NA	NA	NA	NA
AZU26714.1|3408225_3410007_+	sulfite reductase	NA	NA	NA	NA	NA
AZU26715.1|3410250_3411108_-	HutD-family protein	NA	NA	NA	NA	NA
AZU26716.1|3411534_3411867_-	competence protein ComEA	NA	NA	NA	NA	NA
AZU26717.1|3412066_3413560_+	peptidase M20	NA	NA	NA	NA	NA
AZU26718.1|3414095_3414368_+	membrane protein	NA	NA	NA	NA	NA
AZU26719.1|3414425_3415445_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AZU26720.1|3415441_3416152_+	mannose-1-phosphate guanylyltransferase	NA	A0A1D7XFC1	Escherichia_phage	33.9	3.3e-08
AZU26721.1|3416372_3417074_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26722.1|3417070_3418237_-	membrane protein	NA	NA	NA	NA	NA
AZU26723.1|3418233_3419346_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26724.1|3419476_3420502_+	phosphoribosylaminoimidazole synthetase	NA	Q58MH8	Prochlorococcus_phage	44.1	2.1e-72
AZU26725.1|3420519_3420978_+	membrane protein	NA	NA	NA	NA	NA
AZU26726.1|3421000_3421618_+	membrane protein	NA	NA	NA	NA	NA
AZU26727.1|3421604_3422273_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.7	1.0e-19
AZU26728.1|3422339_3423167_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26729.1|3423170_3423854_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26730.1|3424414_3424738_-	membrane protein	NA	NA	NA	NA	NA
AZU26731.1|3424734_3426009_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZU26732.1|3426260_3426488_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AZU26733.1|3426541_3427543_+	D-arabinose 5-phosphate isomerase	NA	E3T535	Cafeteria_roenbergensis_virus	24.9	1.4e-12
AZU26734.1|3427591_3428140_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	NA	NA	NA	NA
AZU26735.1|3428136_3428712_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26736.1|3428698_3429271_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26737.1|3429270_3429990_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.3	5.6e-27
AZU26738.1|3430030_3431470_+	RNA polymerase sigma54 factor	NA	NA	NA	NA	NA
AZU26739.1|3431557_3431875_+	ribosome hibernation promoting factor HPF	NA	NA	NA	NA	NA
AZU26740.1|3431896_3432355_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
AZU26741.1|3432351_3433302_+	serine kinase	NA	NA	NA	NA	NA
AZU26742.1|3433298_3434171_+	nucleotide-binding protein	NA	A0A0R8VB27	Thermobifida_phage	30.5	7.8e-07
AZU26743.1|3434703_3435096_+	PTS system fructose IIA component family protein	NA	NA	NA	NA	NA
AZU26744.1|3435088_3435358_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AZU26745.1|3437105_3437459_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26746.1|3437773_3439135_+	magnesium transporter	NA	NA	NA	NA	NA
AZU26747.1|3439276_3440074_+	phospholipase	NA	NA	NA	NA	NA
AZU26748.1|3440108_3441125_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AZU26749.1|3441227_3442055_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU26750.1|3442048_3442315_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU26751.1|3442433_3442556_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU26752.1|3443844_3444555_+	type IV secretory pathway, TrbF protein	NA	NA	NA	NA	NA
AZU26753.1|3444581_3445574_+	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
AZU26754.1|3445589_3446942_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
AZU26755.1|3447114_3447321_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26756.1|3447331_3447571_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26757.1|3447643_3447892_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26758.1|3449731_3453340_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26759.1|3454226_3455504_-	murein transglycosylase	NA	NA	NA	NA	NA
AZU26760.1|3455635_3456382_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	35.7	9.2e-33
AZU26761.1|3456981_3457359_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26762.1|3457910_3458099_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26763.1|3458298_3458898_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26764.1|3459517_3459784_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU26765.1|3460040_3460346_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26766.1|3460944_3461274_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28173.1|3461766_3462609_-	outer protein AF, type III effector XopAF	NA	NA	NA	NA	NA
AZU26767.1|3463603_3464431_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	3551838	3638057	5219277	transposase,protease	uncultured_virus(27.27%)	58	NA	NA
AZU26833.1|3551838_3552105_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU26834.1|3552307_3553534_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU26835.1|3554403_3554859_-	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
AZU26836.1|3555636_3555864_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26837.1|3555864_3556260_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
AZU26838.1|3556407_3557517_-	glycine cleavage system protein T	NA	NA	NA	NA	NA
AZU26839.1|3557690_3558125_-	membrane protein	NA	NA	NA	NA	NA
AZU26840.1|3558128_3559091_-	membrane protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	32.9	2.5e-22
AZU26841.1|3559249_3559585_-	membrane protein	NA	A0A218MNG8	uncultured_virus	57.8	6.8e-28
AZU26842.1|3560826_3561627_-	3'-5'-bisphosphate nucleotidase	NA	NA	NA	NA	NA
AZU26843.1|3561623_3562172_-	ADP-ribose diphosphatase	NA	NA	NA	NA	NA
AZU26844.1|3562213_3563632_+	adenosylmethionine-8-amino-7-oxononanoate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	20.7	2.1e-09
AZU26845.1|3563622_3564357_+	16S rRNA methyltransferase	NA	NA	NA	NA	NA
AZU26846.1|3564668_3565685_-	glucokinase	NA	NA	NA	NA	NA
AZU26847.1|3568116_3568854_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU26848.1|3568937_3569204_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU26849.1|3570456_3572142_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
AZU26850.1|3572145_3573213_+	glycosyl hydrolase	NA	A0A2P1CFB9	Microbacterium_phage	23.4	1.1e-07
AZU26851.1|3573477_3575928_+	beta-hexosaminidase	NA	NA	NA	NA	NA
AZU26852.1|3575949_3578640_+	beta-mannosidase	NA	NA	NA	NA	NA
AZU26853.1|3579123_3581784_+	glycoside hydrolase family 3	NA	NA	NA	NA	NA
AZU26854.1|3582366_3583830_+	Tat pathway signal protein	NA	NA	NA	NA	NA
AZU26855.1|3583940_3586283_+	alpha-mannosidase	NA	NA	NA	NA	NA
AZU26856.1|3586597_3588433_+	beta-galactosidase	NA	NA	NA	NA	NA
AZU26857.1|3588482_3590921_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AZU26858.1|3591655_3591856_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26859.1|3591913_3592243_-	R body protein RebB-like protein	NA	NA	NA	NA	NA
AZU26860.1|3594211_3595927_+	leucine-rich repeat (LRR) protein	NA	NA	NA	NA	NA
AZU26861.1|3596031_3596763_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AZU26862.1|3596759_3597824_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
AZU26863.1|3598534_3598732_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26864.1|3598758_3599352_-	alanine acetyltransferase	NA	NA	NA	NA	NA
AZU26865.1|3599583_3600060_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AZU26866.1|3600093_3601281_-	chemotaxis protein	NA	NA	NA	NA	NA
AZU26867.1|3601288_3608494_-	chemotaxis protein CheY	NA	W8CYM9	Bacillus_phage	31.9	1.3e-11
AZU26868.1|3608607_3610644_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.2	3.6e-23
AZU26869.1|3610683_3611214_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AZU26870.1|3611213_3611576_-	chemotaxis protein CheY	NA	A0A220YL79	Alteromonas_virus	27.7	4.1e-10
AZU26871.1|3611593_3611995_-	pilus assembly protein PilG	NA	NA	NA	NA	NA
AZU26872.1|3612231_3613182_+	glutathione synthetase	NA	NA	NA	NA	NA
AZU26873.1|3613178_3614054_+	energy transducer TonB	NA	NA	NA	NA	NA
AZU26874.1|3614399_3615317_-	ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	47.1	2.0e-66
AZU26875.1|3615313_3616033_-|protease	glycoprotease	protease	NA	NA	NA	NA
AZU26876.1|3616251_3616347_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26877.1|3616394_3618386_-	helicase	NA	A0A127AW80	Bacillus_phage	33.0	1.9e-93
AZU26878.1|3618664_3619189_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26879.1|3619202_3621647_-	penicillin-binding protein	NA	NA	NA	NA	NA
AZU26880.1|3621884_3623969_+	glycosyl transferase	NA	NA	NA	NA	NA
AZU26881.1|3624329_3625772_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26882.1|3626043_3628230_-	(p)ppGpp synthetase	NA	NA	NA	NA	NA
AZU26883.1|3628683_3629583_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
AZU26884.1|3629579_3630332_+	pyrroloquinoline quinone biosynthesis protein PqqC	NA	NA	NA	NA	NA
AZU26885.1|3630328_3630607_+	pyrroloquinoline quinone biosynthesis protein PqqD	NA	NA	NA	NA	NA
AZU26886.1|3630603_3631722_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
AZU26887.1|3631784_3632297_+	hypothetical protein	NA	NA	NA	NA	NA
AZU26888.1|3632722_3634237_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
AZU26889.1|3634539_3635574_+	glucokinase	NA	NA	NA	NA	NA
AZU26890.1|3636830_3638057_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
>prophage 19
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	3753485	3845441	5219277	transposase,integrase	uncultured_virus(21.05%)	82	3796672:3796731	3845418:3846747
AZU26981.1|3753485_3754286_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU26982.1|3754306_3754573_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU26983.1|3754602_3756444_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.6	7.3e-15
AZU26984.1|3756646_3757081_-	membrane protein	NA	NA	NA	NA	NA
AZU26985.1|3757067_3757592_-	hypothetical protein	NA	NA	NA	NA	NA
AZU26986.1|3757594_3758416_-	laccase	NA	NA	NA	NA	NA
AZU26987.1|3758417_3759413_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AZU26988.1|3759533_3760415_+	competence protein	NA	NA	NA	NA	NA
AZU26989.1|3760729_3761707_+	hypothetical protein	NA	A0A0N9SJH5	Pseudomonas_phage	41.0	1.7e-55
AZU26990.1|3761725_3763366_-	NAD synthetase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	4.9e-95
AZU26991.1|3763388_3763760_-	DNA methyltransferase	NA	NA	NA	NA	NA
AZU26992.1|3764426_3765302_-	succinyl-CoA synthetase subunit alpha	NA	NA	NA	NA	NA
AZU26993.1|3765326_3766496_-	succinyl-CoA synthetase subunit beta	NA	NA	NA	NA	NA
AZU26994.1|3766727_3768341_+	ATPase	NA	NA	NA	NA	NA
AZU26995.1|3768671_3770066_+	chemotaxis protein CheY	NA	NA	NA	NA	NA
AZU26996.1|3770470_3770590_-	pilus assembly protein	NA	NA	NA	NA	NA
AZU26997.1|3770834_3772571_-	general secretion pathway protein GspE	NA	NA	NA	NA	NA
AZU26998.1|3772635_3773091_-	fimbrial protein	NA	NA	NA	NA	NA
AZU26999.1|3773200_3773641_-	fimbrial protein	NA	NA	NA	NA	NA
AZU27000.1|3773934_3775161_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU27001.1|3775332_3776589_+	type II secretory pathway protein	NA	NA	NA	NA	NA
AZU27002.1|3776595_3777459_+	methyltransferase	NA	NA	NA	NA	NA
AZU27003.1|3777469_3778081_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
AZU27004.1|3779381_3779648_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU27005.1|3779668_3780469_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU27006.1|3780851_3782186_-	histidine kinase	NA	NA	NA	NA	NA
AZU27007.1|3782178_3782856_-	XRE family transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
AZU27008.1|3783531_3784419_-	ribosomal protein S6 modification protein	NA	A0A1D7SR78	Cyanophage	32.0	3.5e-31
AZU27009.1|3784910_3787043_+	glycogen debranching protein	NA	NA	NA	NA	NA
AZU27010.1|3787501_3787894_-	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AZU27011.1|3787984_3788377_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27012.1|3788485_3789145_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27013.1|3789901_3790174_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU27014.1|3790191_3791046_+|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU27015.1|3791803_3791995_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27016.1|3792065_3792545_-	RadC family protein	NA	NA	NA	NA	NA
AZU27017.1|3792900_3793638_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU27018.1|3793721_3793988_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU27019.1|3794142_3794367_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27020.1|3795130_3796114_-|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
3796672:3796731	attL	GAGCGTGTGCAGAATTTTGTGTAACCGTGGTTTGGGTTACCGCTGAGGAAGTCGCCCCTC	NA	NA	NA	NA
AZU27021.1|3796707_3797934_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU27022.1|3799325_3800552_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU27023.1|3800588_3801371_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	33.1	7.9e-11
AZU27024.1|3802163_3802964_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU27025.1|3802984_3803251_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU27026.1|3804949_3806230_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	49.3	5.7e-107
AZU27027.1|3806216_3806648_-	peptidase S24	NA	A0A2H4J538	uncultured_Caudovirales_phage	42.0	2.6e-19
AZU27028.1|3807200_3808145_-	membrane protein	NA	NA	NA	NA	NA
AZU27029.1|3808224_3808953_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZU27030.1|3809719_3810508_+	protein kinase	NA	NA	NA	NA	NA
AZU27031.1|3810890_3811760_+	hypothetical protein	NA	A0A142K541	Mycobacterium_phage	27.2	1.5e-05
AZU27032.1|3811940_3812741_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU27033.1|3812761_3813028_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU27034.1|3813195_3814896_+	hypothetical protein	NA	NA	NA	NA	NA
AZU27035.1|3814912_3815473_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AZU27036.1|3815989_3816388_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27037.1|3816753_3817965_-	nuclease	NA	NA	NA	NA	NA
AZU27038.1|3818177_3818957_+	conjugal transfer protein	NA	NA	NA	NA	NA
AZU27039.1|3818953_3819499_+|integrase	integrase	integrase	NA	NA	NA	NA
AZU27040.1|3819567_3819969_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AZU27041.1|3820090_3822097_+	DNA mismatch repair protein MutL	NA	NA	NA	NA	NA
AZU27042.1|3822136_3825451_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27043.1|3825918_3826116_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27044.1|3826130_3828152_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	26.4	5.0e-33
AZU27045.1|3828694_3830200_+	DNA methyltransferase	NA	Q6V7R9	Burkholderia_virus	44.9	1.4e-101
AZU27046.1|3830637_3831438_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU27047.1|3831458_3831725_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU27048.1|3831886_3832273_+	hypothetical protein	NA	NA	NA	NA	NA
AZU27049.1|3832368_3832812_+	hypothetical protein	NA	NA	NA	NA	NA
AZU27050.1|3832939_3833653_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZU27051.1|3833949_3834747_+	GTPase	NA	NA	NA	NA	NA
AZU27052.1|3835758_3836496_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU27053.1|3836579_3836846_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU27054.1|3836911_3837385_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27055.1|3837472_3837673_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27056.1|3837780_3838608_+	hypothetical protein	NA	A0A2C9CYF8	Yersinia_phage	36.1	1.1e-42
AZU27057.1|3838684_3839356_+	hypothetical protein	NA	NA	NA	NA	NA
AZU27058.1|3839472_3839652_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27059.1|3839802_3840063_+	hypothetical protein	NA	NA	NA	NA	NA
AZU27060.1|3840141_3840792_+	hypothetical protein	NA	NA	NA	NA	NA
AZU27061.1|3840865_3841975_+	methyltransferase	NA	NA	NA	NA	NA
AZU27062.1|3844214_3845441_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
3845418:3846747	attR	GAGGGGCGACTTCCTCAGCGGTAACCCAAACCACGGTTACACAAAATTCTGCACACGCTCATTCCTGGTGAGAAGTTACCGATCAACATCCATGCTGACGAATTCAACGAGCTTATGGGCGATGAGTTCATTCCAATGATCAACAAGGGCGGTGGTGCTGGCATCCAAGTCACCGCGTACACCCAGACGCTCAGCGACATTGAGGCGCGCATCGGAAATCGGGCCAAAGCCGGTCAGGTAGTGGGCAACTTCAACAACCTGTTCATGCTGCGCGTGCGGGAGACAGCCACGGCGGAACTGCTCACCCGCCAGCTACCGAAAGTCGAGATTTATTCCACAACCATCGTCAGTGGAGCCACCGACAGCTCGGACATCCGAGGTACCACGGACTTCACCTCCAACACTCAAGATCGCATCAGCATGTCCAGCGTACCGATGATCGAGCCTTCGCAAGTAGTGGGGCTGCCTAAGGGGCAGTGTTTTGCGCTTCTGCAAGGTGGAAATCTGTGGAAGATCCGCATGCCGCTGCCGGCGCCCGATCCCGATGAGGTCATGCCAAAGGATCTGCAGCAGTTAGCAGGCTACATGCGCCAGAGCTACAGCGACTCCGCCCAATGGTGGGAAAACTCTGGATCACCTACCCTGCAGAGTCAGGGGTTGCCCGACAGTCTGGTAGAGGATGTAACAGAGCCTGCATCGGTAGTTCGCGAGCCGCTGTCATGAGCGACGTGGCAAGTACCGCAAAGCGCCAGGAGGTTCGTCGTGACGGGCTGCTGGTTGGTCTGATTACGTTGCCGTTCCGGCTCTTTGGTGTGCTGGTTGGGTCATTGCTGATTTCGGTTGTGATCGAATGCGTGGGCATGCATTTTTTCTGGAAGGAGCAAGGCTGGCGGCACTCTCAAGAGATGCTGCAGTACGAACTCACTCACCTGTCCAAGCATTTCACCCGTAGTGCGGTCATCCATGAACCTGGGCGTTCCGCGCACCAACTGGTAGAGACGGGCTATCGCTGGATATTCCTTCGCACCGGCTTACTCTCGCGTATGGAGCAAACTGCCGAGCGAGCCCGCGCGCCTAGCAAGGTTGGGACACGCGATTTTCGCTACTACATCAGCCAGGTGTATGTGTGGGCGGCGAATTACTTGATCGCCGCAGCGTTTACAGCGCTCACTTTTTTGGTCCGGCTATTGGTGTTGGTGCTGACGCTGCCACTATTCGTCATGGCGGCTTTCGTCGGCTTCGTGGACGGCTTGGTGCGTCGCGATGTACGCAAGTTCGGCGCTGGCCGGGAGTCGGGCTTCATTTACCACCGCGCCAAGGCTTCGCTCAT	NA	NA	NA	NA
>prophage 20
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	4166030	4188349	5219277	transposase,holin	Shigella_phage(28.57%)	24	NA	NA
AZU27305.1|4166030_4166297_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU27306.1|4166344_4167571_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU27307.1|4167654_4168455_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU27308.1|4168852_4169806_+	DegV domain-containing protein	NA	NA	NA	NA	NA
AZU27309.1|4170356_4170695_+	hypothetical protein	NA	NA	NA	NA	NA
AZU27310.1|4170925_4171198_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU27311.1|4171215_4172070_+|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU27312.1|4172100_4172931_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZU27313.1|4172989_4173565_-	glutathione-dependent formaldehyde-activating protein	NA	NA	NA	NA	NA
AZU27314.1|4173633_4174743_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	1.1e-34
AZU27315.1|4174809_4175085_-	regulator	NA	NA	NA	NA	NA
AZU27316.1|4175414_4175762_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27317.1|4176215_4177316_-	glycosyltransferase	NA	A0A142BZU7	Faustovirus	29.4	5.2e-16
AZU27318.1|4177393_4178173_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU27319.1|4178169_4179672_+	histidine kinase	NA	W8CYF6	Bacillus_phage	24.4	8.7e-14
AZU27320.1|4179683_4179866_+	hypothetical protein	NA	NA	NA	NA	NA
AZU27321.1|4179859_4181242_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AZU27322.1|4181349_4182138_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27323.1|4182229_4182853_-	GTP-binding protein	NA	NA	NA	NA	NA
AZU27324.1|4182996_4183794_+	cytochrome C	NA	NA	NA	NA	NA
AZU27325.1|4183888_4184539_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AZU27326.1|4184630_4185446_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AZU27327.1|4185495_4186233_+	endonuclease	NA	NA	NA	NA	NA
AZU27328.1|4186369_4188349_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	26.1	5.3e-19
>prophage 21
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	4208274	4216325	5219277	coat	Enterobacteria_phage(42.86%)	7	NA	NA
AZU27348.1|4208274_4209621_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.2	4.8e-32
AZU27349.1|4209667_4211071_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.8	1.9e-47
AZU27350.1|4211373_4212540_-	UDP-glucose 6-dehydrogenase	NA	M1HV26	Paramecium_bursaria_Chlorella_virus	57.8	1.6e-116
AZU27351.1|4212880_4213780_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.6e-26
AZU27352.1|4213776_4214334_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	49.4	3.0e-44
AZU27353.1|4214330_4215218_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	57.8	1.7e-94
AZU27354.1|4215269_4216325_-|coat	spore coat protein	coat	I7HTA3	Enterobacteria_phage	45.0	2.4e-79
>prophage 22
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	4637416	4706492	5219277	tRNA,transposase,protease	Listeria_phage(27.27%)	58	NA	NA
AZU27739.1|4637416_4638421_-|tRNA	tRNA-dihydrouridine synthase A	tRNA	NA	NA	NA	NA
AZU27740.1|4638877_4639102_-	membrane protein	NA	NA	NA	NA	NA
AZU27741.1|4639677_4640283_-	ankyrin	NA	NA	NA	NA	NA
AZU27742.1|4640342_4641866_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.3	9.8e-98
AZU27743.1|4642240_4642852_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27744.1|4642848_4643982_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27745.1|4644002_4644170_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27746.1|4645900_4647127_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU27747.1|4647107_4647713_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27748.1|4647709_4648849_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27749.1|4649136_4651269_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
AZU27750.1|4651565_4651802_-	membrane protein	NA	NA	NA	NA	NA
AZU27751.1|4651798_4652173_-	membrane protein	NA	NA	NA	NA	NA
AZU27752.1|4652162_4653014_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
AZU27753.1|4653078_4653960_+	TolB-like protein	NA	NA	NA	NA	NA
AZU27754.1|4654608_4657143_-	iron-uptake factor	NA	NA	NA	NA	NA
AZU27755.1|4657373_4658126_+	endonuclease	NA	H6X497	Enterobacteria_phage	33.8	3.0e-23
AZU27756.1|4658497_4659490_-	delta-aminolevulinic acid dehydratase	NA	NA	NA	NA	NA
AZU27757.1|4659514_4659676_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27758.1|4659699_4659948_-	membrane protein	NA	NA	NA	NA	NA
AZU27759.1|4660164_4660635_+	hypothetical protein	NA	NA	NA	NA	NA
AZU27760.1|4660733_4662524_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27761.1|4663426_4665676_-	peptidase S9	NA	NA	NA	NA	NA
AZU27762.1|4666903_4667095_+	hypothetical protein	NA	NA	NA	NA	NA
AZU27763.1|4667261_4670276_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZU27764.1|4670462_4671164_+	peptidase	NA	NA	NA	NA	NA
AZU27765.1|4671153_4672167_+	cupin	NA	NA	NA	NA	NA
AZU27766.1|4672177_4673743_+	tryptophan halogenase	NA	E3SL43	Synechococcus_phage	28.5	2.5e-40
AZU27767.1|4673882_4674893_+	energy transducer TonB	NA	NA	NA	NA	NA
AZU27768.1|4675139_4676333_-	sodium ABC transporter permease	NA	NA	NA	NA	NA
AZU27769.1|4676329_4677076_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.2e-19
AZU27770.1|4677107_4678709_-|protease	cysteine protease	protease	NA	NA	NA	NA
AZU27771.1|4678769_4678970_-	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
AZU27772.1|4678966_4679554_-	membrane protein	NA	NA	NA	NA	NA
AZU27773.1|4679994_4681557_+	beta-xylosidase	NA	NA	NA	NA	NA
AZU27774.1|4681646_4681919_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27775.1|4681983_4682997_+	cation transporter	NA	NA	NA	NA	NA
AZU27776.1|4683088_4683811_-	phenol hydroxylase	NA	NA	NA	NA	NA
AZU27777.1|4683952_4684948_+	ABC transporter	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.1	1.0e-23
AZU27778.1|4684965_4685757_+	membrane protein	NA	NA	NA	NA	NA
AZU27779.1|4685762_4686701_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AZU27780.1|4687480_4687747_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU27781.1|4687767_4688568_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU27782.1|4688858_4689263_-	thioesterase	NA	NA	NA	NA	NA
AZU27783.1|4689299_4689752_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27784.1|4689789_4690116_-	thioredoxin	NA	NA	NA	NA	NA
AZU27785.1|4690087_4690582_-	flavodoxin	NA	A0A068CFW0	Listeria_phage	36.1	6.1e-17
AZU27786.1|4690807_4691278_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27787.1|4691277_4691976_-	hypothetical protein	NA	I3NLD4	Bifidobacterium_phage	28.1	1.6e-15
AZU27788.1|4692018_4693062_-	ribonucleotide-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	76.0	8.6e-154
AZU27789.1|4693239_4695738_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A088FNW1	Listeria_phage	67.1	6.4e-304
AZU27790.1|4696340_4697384_-	hypothetical protein	NA	A0A172Q0Y5	Acinetobacter_phage	50.7	1.1e-79
AZU27791.1|4697489_4700198_-	GCN5 family acetyltransferase	NA	NA	NA	NA	NA
AZU27792.1|4700312_4701680_-	magnesium transporter	NA	NA	NA	NA	NA
AZU27793.1|4702262_4703090_+	carbonic anhydrase	NA	NA	NA	NA	NA
AZU27794.1|4703307_4705113_+	potassium transporter KefB	NA	NA	NA	NA	NA
AZU27795.1|4705404_4705671_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU27796.1|4705754_4706492_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	4963855	5035064	5219277	transposase	Bacillus_phage(33.33%)	49	NA	NA
AZU27983.1|4963855_4964122_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU27984.1|4964205_4964943_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU27985.1|4965215_4965458_+	hypothetical protein	NA	NA	NA	NA	NA
AZU27986.1|4965738_4966257_+	hypothetical protein	NA	NA	NA	NA	NA
AZU27987.1|4968570_4969410_+	hypothetical protein	NA	NA	NA	NA	NA
AZU27988.1|4971310_4971883_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27989.1|4972035_4972239_+	hypothetical protein	NA	NA	NA	NA	NA
AZU27990.1|4972673_4973654_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZU27991.1|4973991_4976661_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZU27992.1|4976660_4977632_-	hypothetical protein	NA	NA	NA	NA	NA
AZU27993.1|4978042_4979095_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZU27994.1|4979262_4982301_+	membrane protein	NA	NA	NA	NA	NA
AZU27995.1|4982352_4982475_+	hypothetical protein	NA	NA	NA	NA	NA
AZU27996.1|4982626_4985662_+	membrane protein	NA	NA	NA	NA	NA
AZU27997.1|4985685_4987287_+	tryptophan halogenase	NA	M4T1E3	Cyanophage	29.2	6.3e-47
AZU27998.1|4987671_4988400_-	orotidine 5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AZU27999.1|4988396_4989362_-	acid phosphatase	NA	NA	NA	NA	NA
AZU28000.1|4989711_4990368_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28001.1|4990531_4991383_-	radical SAM protein	NA	NA	NA	NA	NA
AZU28002.1|4991390_4992752_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AZU28003.1|4992748_4993591_-	metalloenzyme domain-containing protein	NA	NA	NA	NA	NA
AZU28004.1|4993559_4994654_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28005.1|4994673_4995585_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28006.1|4995727_4996849_+	ATPase AAA	NA	A0A2H4PB07	Aphanizomenon_phage	28.9	4.3e-18
AZU28007.1|4996845_4997259_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28008.1|4997255_4999103_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28009.1|5001901_5002936_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28010.1|5002987_5003524_-	acetyltransferase	NA	NA	NA	NA	NA
AZU28011.1|5004086_5006063_-	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	8.2e-113
AZU28012.1|5006271_5006901_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.6	6.7e-53
AZU28013.1|5007329_5008574_+	histidine kinase	NA	NA	NA	NA	NA
AZU28014.1|5008736_5010338_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AZU28015.1|5010406_5011384_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28016.1|5012042_5012780_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU28017.1|5012863_5013130_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU28018.1|5013275_5014091_-	5-hydroxymethyluracil DNA glycosylase	NA	A0A127AWE5	Bacillus_phage	27.4	8.3e-19
AZU28019.1|5020850_5022032_+	membrane protein	NA	NA	NA	NA	NA
AZU28020.1|5022106_5024011_-	phytochrome	NA	Q6XLU9	Feldmannia_irregularis_virus	27.4	1.1e-18
AZU28021.1|5024007_5024601_-	heme oxygenase	NA	NA	NA	NA	NA
AZU28022.1|5024700_5025966_-	MFS transporter	NA	NA	NA	NA	NA
AZU28023.1|5026562_5028725_-	epimerase	NA	NA	NA	NA	NA
AZU28024.1|5028903_5029110_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28025.1|5029326_5029605_-	zinc chelation protein SecC	NA	NA	NA	NA	NA
AZU28026.1|5030903_5031263_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28027.1|5031274_5031589_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28028.1|5031669_5032440_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28029.1|5032542_5032884_+	transcriptional regulator	NA	NA	NA	NA	NA
AZU28030.1|5033976_5034243_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU28031.1|5034326_5035064_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	5054736	5115163	5219277	transposase,integrase	uncultured_virus(66.67%)	41	5044278:5044292	5122451:5122465
5044278:5044292	attL	GCTGCAGGGCTTTGC	NA	NA	NA	NA
AZU28048.1|5054736_5055963_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU28049.1|5056134_5060157_+	ATP-binding protein	NA	NA	NA	NA	NA
AZU28050.1|5060231_5061035_-	membrane protein	NA	NA	NA	NA	NA
AZU28051.1|5061312_5062866_+|integrase	integrase	integrase	NA	NA	NA	NA
AZU28052.1|5063270_5064497_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU28053.1|5065005_5066625_+	enterochelin esterase	NA	NA	NA	NA	NA
AZU28054.1|5066728_5067127_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28055.1|5067890_5068583_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28056.1|5068613_5069516_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AZU28057.1|5069848_5071426_+	chlamydia polymorphic membrane family protein	NA	NA	NA	NA	NA
AZU28058.1|5072350_5072617_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU28059.1|5072873_5073179_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28060.1|5077744_5079796_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28061.1|5079889_5080909_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28062.1|5082049_5084635_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28063.1|5085573_5086551_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28064.1|5086681_5088325_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28065.1|5088744_5089923_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28066.1|5089999_5091643_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28067.1|5091931_5092456_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28068.1|5092636_5093716_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28069.1|5093712_5094474_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28070.1|5094482_5094749_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28071.1|5094751_5095444_-	type III secretion system protein	NA	NA	NA	NA	NA
AZU28072.1|5095443_5096496_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28073.1|5096720_5097185_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28074.1|5097684_5098122_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28075.1|5098123_5099473_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28076.1|5099475_5099835_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28077.1|5099895_5101992_-	type III secretion system protein InvA	NA	NA	NA	NA	NA
AZU28078.1|5102241_5103357_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28079.1|5106408_5107521_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28080.1|5107553_5107823_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28081.1|5107888_5108173_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28082.1|5109625_5110300_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28083.1|5110296_5110530_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28084.1|5110711_5111026_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU28085.1|5111025_5111841_+|integrase	integrase	integrase	NA	NA	NA	NA
AZU28086.1|5112831_5113134_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28087.1|5113677_5113938_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28088.1|5113987_5115163_+|integrase	integrase	integrase	Q5QBN6	Enterobacteria_phage	25.4	8.5e-17
5122451:5122465	attR	GCTGCAGGGCTTTGC	NA	NA	NA	NA
>prophage 25
CP012057	Xanthomonas axonopodis pv. phaseoli strain ISO98C12, complete genome	5219277	5125009	5181641	5219277	transposase,tail	Shigella_phage(16.67%)	51	NA	NA
AZU28094.1|5125009_5125993_+|transposase	transposase	transposase	A0A077K814	Ralstonia_phage	59.9	8.2e-98
AZU28095.1|5126096_5126507_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28096.1|5128031_5128337_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28097.1|5128468_5129269_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU28098.1|5129289_5129556_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU28099.1|5129620_5130550_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28100.1|5130543_5130999_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28101.1|5131061_5131298_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28102.1|5131335_5131608_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	60.0	1.5e-20
AZU28103.1|5131625_5132480_+|transposase	transposase	transposase	U5P429	Shigella_phage	59.9	1.9e-90
AZU28104.1|5132610_5134995_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28105.1|5135061_5135430_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28106.1|5135448_5136006_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28107.1|5137434_5137701_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU28108.1|5137784_5138522_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU28109.1|5138518_5138719_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28110.1|5138836_5139682_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.7	1.5e-44
AZU28111.1|5139675_5139939_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU28112.1|5140604_5141336_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28113.1|5141327_5141654_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28177.1|5141803_5142007_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28114.1|5142003_5145651_-	urea carboxylase	NA	NA	NA	NA	NA
AZU28115.1|5145734_5147534_-	allophanate hydrolase	NA	NA	NA	NA	NA
AZU28116.1|5147659_5147848_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28117.1|5147883_5148360_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AZU28118.1|5148423_5148993_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU28119.1|5149109_5149682_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZU28120.1|5149766_5150510_+	oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.8	5.0e-15
AZU28121.1|5150875_5151394_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28122.1|5152386_5152719_+	lipoprotein	NA	NA	NA	NA	NA
AZU28123.1|5153033_5154959_+	aminopeptidase precursor	NA	NA	NA	NA	NA
AZU28124.1|5155026_5155206_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28125.1|5155308_5156697_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AZU28126.1|5157051_5157342_-	XRE family transcriptional regulator	NA	M9MUN2	Rhodococcus_phage	52.5	2.8e-14
AZU28127.1|5157359_5157473_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28128.1|5157737_5160245_-	exodeoxyribonuclease V subunit alpha	NA	A0A0N9S864	Staphylococcus_phage	44.9	3.7e-09
AZU28129.1|5160432_5164419_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	21.9	2.4e-10
AZU28130.1|5164415_5167820_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
AZU28131.1|5168172_5172948_-	hemagglutinin	NA	F5B3Z3	Synechococcus_phage	50.5	9.4e-22
AZU28132.1|5173209_5173761_+	microcystin-dependent protein	NA	A0A0U4JQ24	Arthrobacter_phage	32.6	1.1e-11
AZU28133.1|5173808_5174336_+|tail	tail collar protein	tail	A0A0U4JYA4	Arthrobacter_phage	34.3	4.5e-18
AZU28134.1|5174940_5175489_+	acetyltransferase	NA	NA	NA	NA	NA
AZU28135.1|5175507_5175795_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28136.1|5176176_5176971_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
AZU28137.1|5176970_5177720_+	ABC transporter permease	NA	NA	NA	NA	NA
AZU28138.1|5177731_5178277_+	mammalian cell entry protein	NA	NA	NA	NA	NA
AZU28139.1|5178273_5178936_+	organic solvent ABC transporter	NA	NA	NA	NA	NA
AZU28140.1|5178925_5179216_+	anti-sigma B factor antagonist	NA	NA	NA	NA	NA
AZU28141.1|5179226_5180282_+	lipoprotein	NA	NA	NA	NA	NA
AZU28142.1|5180553_5181291_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU28143.1|5181374_5181641_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
CP012058	Xanthomonas axonopodis pv. phaseoli strain ISO98C12 plasmid pXap59, complete sequence	58946	7556	24084	58946	transposase	Leptospira_phage(50.0%)	17	NA	NA
AZU28187.1|7556_7823_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU28188.1|7816_8644_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.2	9.8e-44
AZU28189.1|9462_9642_-	hypothetical protein	NA	A0A218MNI4	uncultured_virus	47.2	3.8e-09
AZU28190.1|9835_10573_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.7	5.7e-43
AZU28191.1|10656_10923_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU28192.1|12159_13200_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	27.5	1.9e-07
AZU28193.1|13359_13680_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28194.1|13723_13954_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28195.1|13950_14262_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28196.1|14403_14925_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28197.1|14946_16173_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.2e-52
AZU28198.1|16153_16381_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28199.1|16377_16719_-	hypothetical protein	NA	NA	NA	NA	NA
AZU28200.1|18342_18819_+	hypothetical protein	NA	NA	NA	NA	NA
AZU28201.1|19480_20308_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	37.2	9.8e-44
AZU28202.1|20301_20568_-|transposase	transposase	transposase	NA	NA	NA	NA
AZU28203.1|21054_24084_-|transposase	transposase	transposase	NA	NA	NA	NA
