The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026734	Brevibacterium linens strain ATCC 19391 chromosome, complete genome	3806710	622264	702361	3806710	transposase,holin	Bacillus_phage(23.08%)	55	NA	NA
AZU02257.1|622264_624352_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.8	2.0e-16
AZT99732.1|624348_625959_+|holin	choline-sulfatase	holin	A0A2K9L727	Tupanvirus	24.7	1.5e-19
AZT99733.1|626200_627601_+	TIGR01777 family protein	NA	NA	NA	NA	NA
AZT99734.1|627679_628909_-	methionine synthase	NA	NA	NA	NA	NA
AZT99735.1|629370_629967_+	hypothetical protein	NA	NA	NA	NA	NA
AZT99736.1|630237_630909_+	hypothetical protein	NA	NA	NA	NA	NA
AZT99737.1|630957_631503_+	hypothetical protein	NA	NA	NA	NA	NA
AZT99738.1|631635_634020_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	67.6	7.6e-307
AZT99739.1|634183_635095_+	rhodanese domain-containing protein	NA	NA	NA	NA	NA
AZT99740.1|635146_636163_-	NAD-dependent epimerase	NA	NA	NA	NA	NA
AZT99741.1|642295_643717_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AZT99742.1|644091_644385_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZT99743.1|644381_645854_+	hypothetical protein	NA	NA	NA	NA	NA
AZT99744.1|651892_652828_+	hypothetical protein	NA	NA	NA	NA	NA
AZT99745.1|652909_654022_-	hypothetical protein	NA	NA	NA	NA	NA
AZT99746.1|654237_655971_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	6.6e-42
AZU02258.1|656047_658099_+	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	3.7e-60
AZT99747.1|658515_660207_+	hypothetical protein	NA	NA	NA	NA	NA
AZT99748.1|660382_661117_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AZT99749.1|661113_661371_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AZT99750.1|661486_662908_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AZT99751.1|662944_663808_-	ABC transporter permease	NA	NA	NA	NA	NA
AZT99752.1|663809_664745_-	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	24.8	6.2e-10
AZT99753.1|664741_665914_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZT99754.1|665906_667094_-	spermidine/putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.9	6.0e-26
AZT99755.1|667109_668822_-	amidohydrolase	NA	NA	NA	NA	NA
AZT99756.1|669169_671410_-	phosphoribosylamine--glycine ligase	NA	A0A0M4JBD3	Mollivirus	35.1	1.0e-39
AZT99757.1|671443_672568_+	L-asparaginase II	NA	NA	NA	NA	NA
AZT99758.1|672567_672969_+	hypothetical protein	NA	NA	NA	NA	NA
AZT99759.1|672965_674408_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AZT99760.1|674433_675330_+	hypothetical protein	NA	NA	NA	NA	NA
AZT99761.1|675342_676320_-	universal stress protein	NA	NA	NA	NA	NA
AZT99762.1|677033_678515_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.0	8.2e-49
AZT99763.1|678516_679614_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	38.7	6.7e-56
AZT99764.1|679916_680126_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
AZT99765.1|680253_681069_+	hypothetical protein	NA	NA	NA	NA	NA
AZT99766.1|681198_681783_+	hypothetical protein	NA	NA	NA	NA	NA
AZT99767.1|681767_682664_+	hypothetical protein	NA	NA	NA	NA	NA
AZU02259.1|682660_683560_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZT99768.1|683638_684601_+	EamA family transporter	NA	NA	NA	NA	NA
AZT99769.1|684625_685939_+	hypothetical protein	NA	NA	NA	NA	NA
AZT99770.1|685963_686275_-	hypothetical protein	NA	NA	NA	NA	NA
AZT99771.1|686936_687872_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AZT99772.1|687873_689355_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AZU02260.1|689409_690075_-	transcriptional regulator, TENA/THI-4 family protein	NA	NA	NA	NA	NA
AZT99773.1|690228_690930_-	uridine kinase	NA	NA	NA	NA	NA
AZT99774.1|690902_691928_-	alpha-L-glutamate ligase	NA	NA	NA	NA	NA
AZT99775.1|692051_692414_+	VOC family protein	NA	NA	NA	NA	NA
AZT99776.1|692461_693049_+	hypothetical protein	NA	NA	NA	NA	NA
AZT99777.1|693382_694684_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	66.2	4.2e-166
AZT99778.1|694809_695988_+	hypothetical protein	NA	NA	NA	NA	NA
AZT99779.1|696221_697700_+	catalase	NA	A0A2K9L572	Tupanvirus	41.2	7.5e-95
AZT99780.1|697872_699807_-	aconitate hydratase	NA	NA	NA	NA	NA
AZT99781.1|699999_700947_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	38.9	1.0e-52
AZU02261.1|701065_702361_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP026734	Brevibacterium linens strain ATCC 19391 chromosome, complete genome	3806710	1079477	1145132	3806710	transposase,integrase,tRNA	Gordonia_phage(57.14%)	59	1118043:1118102	1142439:1143091
AZU00092.1|1079477_1081955_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AZU00093.1|1081951_1083556_+	bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AZU00094.1|1083557_1084586_+	porphobilinogen synthase	NA	NA	NA	NA	NA
AZU00095.1|1084585_1085053_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZU00096.1|1085122_1086484_+	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AZU00097.1|1086480_1087122_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AZU00098.1|1087118_1087718_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AZU02287.1|1087768_1088479_+	cytochrome C biogenesis protein ResC	NA	NA	NA	NA	NA
AZU02288.1|1088547_1090089_+	cytochrome c biogenesis protein ResB	NA	NA	NA	NA	NA
AZU00099.1|1090237_1091242_+	c-type cytochrome biogenesis protein CcsB	NA	NA	NA	NA	NA
AZU00100.1|1091567_1092011_-	hypothetical protein	NA	NA	NA	NA	NA
AZU00101.1|1092095_1092386_+	DUF4229 domain-containing protein	NA	NA	NA	NA	NA
AZU00102.1|1092523_1093456_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AZU00103.1|1093494_1094733_-	AMP-dependent synthetase	NA	NA	NA	NA	NA
AZU00104.1|1094746_1095667_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
AZU00105.1|1095778_1096939_+	O-succinylbenzoate synthase	NA	NA	NA	NA	NA
AZU02289.1|1099411_1101160_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
AZU00106.1|1101269_1101530_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AZU00107.1|1101530_1101785_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AZU00108.1|1101896_1103261_-	isochorismate synthase	NA	NA	NA	NA	NA
AZU02290.1|1103343_1104072_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
AZU00109.1|1104074_1105376_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AZU00110.1|1105470_1106481_+	geranylgeranyl pyrophosphate synthase	NA	NA	NA	NA	NA
AZU00111.1|1106550_1107618_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00112.1|1107774_1108686_-	EamA family transporter RarD	NA	NA	NA	NA	NA
AZU00113.1|1108865_1110284_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AZU00114.1|1110619_1111546_+	(p)ppGpp synthetase	NA	NA	NA	NA	NA
AZU00115.1|1112512_1113043_+	DUF1992 domain-containing protein	NA	NA	NA	NA	NA
AZU00116.1|1112957_1113488_-	hypothetical protein	NA	NA	NA	NA	NA
AZU00117.1|1113726_1114527_+	glycerophosphodiester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	27.0	1.4e-15
AZU00118.1|1115235_1115496_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00119.1|1115840_1116347_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00120.1|1116748_1117066_+	hypothetical protein	NA	A0A1B3AZF8	Gordonia_phage	60.8	9.3e-27
AZU00121.1|1117140_1117983_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	54.8	1.8e-77
1118043:1118102	attL	AGCGCTGCCAATAGACCGCCGCTCATCGAAGCATCTTGCAGGCAATAAGAGTACGATTCG	NA	NA	NA	NA
AZU00122.1|1121527_1121848_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00123.1|1121825_1122368_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00124.1|1124017_1124329_+	hypothetical protein	NA	A0A1B3AZF8	Gordonia_phage	46.1	2.1e-15
AZU00125.1|1124379_1124988_+	hypothetical protein	NA	A0A1B3AZE5	Gordonia_phage	47.9	8.5e-37
AZU00126.1|1125087_1125453_+	hypothetical protein	NA	NA	NA	NA	NA
AZU02291.1|1125492_1126684_+|transposase	transposase	transposase	U5P429	Shigella_phage	35.8	1.5e-29
AZU00127.1|1126926_1127589_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00128.1|1127585_1128542_+|integrase	integrase	integrase	NA	NA	NA	NA
AZU00129.1|1128538_1129090_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00130.1|1129193_1129940_-	ATP-binding protein	NA	NA	NA	NA	NA
AZU00131.1|1129936_1131487_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AZU00132.1|1131543_1132137_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00133.1|1132361_1132568_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00134.1|1132623_1133052_-	hypothetical protein	NA	NA	NA	NA	NA
AZU00135.1|1133080_1133689_-	hypothetical protein	NA	NA	NA	NA	NA
AZU00136.1|1134624_1134831_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00137.1|1134827_1135274_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00138.1|1135442_1136834_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
AZU00139.1|1137507_1138155_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00140.1|1138357_1138960_+	copper resistance protein CopC	NA	NA	NA	NA	NA
AZU00141.1|1139015_1139603_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
AZU00142.1|1139599_1140820_+	peroxidase	NA	NA	NA	NA	NA
AZU00143.1|1140842_1142276_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AZU00144.1|1142960_1143782_-	hypothetical protein	NA	G3M9Y6	Bacillus_virus	27.7	1.2e-06
1142439:1143091	attR	AGCGCTGCCAATAGACCGCCGCTCATCGAAGCATCTTGCAGGCAATAAGAGTACGATTCGTTGTCGGTCAAGATCGATCGATTTTGACCCACACACAAGGTTGAGGGTGATTTAAAGGCTGGAGCGCCAGTGTTTCTGGTTCCAGAAACAAAGAAATGCGGAACATGGTGGAATTCGATCCACAGCAGTGCCCTACTGAGCGCCACAACCCCAGCGACGATCCCTGTTCCCAACACAGCTGCAAGAGCGCCGACGAGGATCTGACCAAGATATCCGCGCGTTTCTGCCATGGGACTGGTTAAAGCATCGATCGATCGGGGTATGGCCAACGTGTTCACGAAATTTATCGGCAAGTGGCATAGTGACTGACCACTTCACGCACGCCGATCCGCGCCGGCACCGAAGCTCCGGAAAAGCAAAGCTCCTGCGCAGCGGCCCCGATGCTTCCGTTTTTCACCACGGCAAGATAGGCCTCAAGATCGATCCTCGTGGCCGGCACCAGATCCATGTCACCATCGTCAGTCAATCGAGCGCACATAACGTGAGTTCGGCATCAGCGGCCAGGGCGAGCCGGTACTCATCGTCGCTGATGAGCAGGACCACCGCACCGGCGGCGACTGCGCGGATCTCCTCGGCGATGGAAGTAAGGTGGC	NA	NA	NA	NA
AZU00145.1|1144040_1145132_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP026734	Brevibacterium linens strain ATCC 19391 chromosome, complete genome	3806710	1726994	1741670	3806710	transposase,integrase,protease	Gordonia_phage(57.14%)	15	1726597:1726641	1735617:1735661
1726597:1726641	attL	TCTTCCAAACTGATGGTGCGGGTTCGATTCCCGTCATCCCCTCCA	NA	NA	NA	NA
AZU00617.1|1726994_1728455_+|integrase	site-specific integrase	integrase	A0A142K8S6	Gordonia_phage	31.3	6.0e-12
AZU00618.1|1728743_1729235_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00619.1|1729423_1730194_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00620.1|1730275_1730737_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00621.1|1730792_1731185_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00622.1|1731338_1732262_-|transposase	IS3 family transposase	transposase	A0A160DCU2	Gordonia_phage	49.7	7.3e-72
AZU00623.1|1732258_1732621_-	hypothetical protein	NA	A0A1B3AZF8	Gordonia_phage	46.1	8.4e-16
AZU00624.1|1733311_1734793_+|integrase	site-specific integrase	integrase	A0A142K8S6	Gordonia_phage	31.3	6.1e-12
AZU00625.1|1734830_1735130_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00626.1|1735199_1735475_+	hypothetical protein	NA	NA	NA	NA	NA
AZU00627.1|1735724_1737131_+	hypothetical protein	NA	NA	NA	NA	NA
1735617:1735661	attR	TCTTCCAAACTGATGGTGCGGGTTCGATTCCCGTCATCCCCTCCA	NA	NA	NA	NA
AZU00628.1|1737343_1738720_+	trigger factor	NA	NA	NA	NA	NA
AZU02348.1|1738958_1739519_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.8	1.1e-46
AZU00629.1|1739545_1740190_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	42.9	1.2e-36
AZU00630.1|1740386_1741670_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.9	9.0e-137
>prophage 4
CP026734	Brevibacterium linens strain ATCC 19391 chromosome, complete genome	3806710	2366486	2426782	3806710	transposase,holin,tRNA	Synechococcus_phage(14.29%)	37	NA	NA
AZU01126.1|2366486_2368049_+|holin	choline oxidase	holin	A0A1V0SI18	Klosneuvirus	46.3	8.4e-121
AZU01127.1|2368172_2369978_-	multidrug DMT transporter permease	NA	A0A2I7QNT1	Vibrio_phage	26.6	2.6e-20
AZU01128.1|2370273_2370867_-	hypothetical protein	NA	NA	NA	NA	NA
AZU01129.1|2371126_2371519_-	hypothetical protein	NA	NA	NA	NA	NA
AZU01130.1|2377582_2378425_+	formate transporter	NA	NA	NA	NA	NA
AZU01131.1|2378434_2378836_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AZU01132.1|2379150_2380437_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	40.8	4.9e-66
AZU01133.1|2380591_2382238_-	hypothetical protein	NA	NA	NA	NA	NA
AZU01134.1|2382465_2383557_+	alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.3	3.4e-28
AZU01135.1|2383647_2385153_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AZU01136.1|2385276_2386983_+	AMP-dependent synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	32.6	6.3e-53
AZU01137.1|2386996_2387236_-	hypothetical protein	NA	NA	NA	NA	NA
AZU01138.1|2387348_2388770_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AZU01139.1|2388928_2389447_-	arginine repressor	NA	NA	NA	NA	NA
AZU01140.1|2389446_2390367_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AZU01141.1|2390396_2391665_-	acetylornithine transaminase	NA	A0A249XSK4	Mycobacterium_phage	26.2	1.2e-11
AZU01142.1|2391657_2392641_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AZU01143.1|2392637_2393816_-	bifunctional ornithine acetyltransferase/N-acetylglutamate synthase	NA	NA	NA	NA	NA
AZU01144.1|2393812_2394922_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AZU01145.1|2394966_2395941_+	NADPH:quinone reductase	NA	E3SJ82	Synechococcus_phage	28.1	2.7e-08
AZU01146.1|2396781_2397516_+	hypothetical protein	NA	A0A1X9I669	Streptococcus_phage	34.9	2.2e-34
AZU01147.1|2398169_2398745_+	hypothetical protein	NA	NA	NA	NA	NA
AZU01148.1|2398741_2400043_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	66.0	4.2e-166
AZU02397.1|2400139_2401225_+|transposase	transposase	transposase	NA	NA	NA	NA
AZU01149.1|2401221_2401992_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	35.2	1.5e-25
AZU01150.1|2402257_2405131_-	DNA helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	37.2	1.5e-171
AZU01151.1|2405139_2407719_-	type III restriction endonuclease subunit R	NA	NA	NA	NA	NA
AZU01152.1|2407718_2409857_-	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	23.8	1.2e-11
AZU01153.1|2409860_2410049_-	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	53.4	8.2e-15
AZU01154.1|2410503_2411895_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
AZU01155.1|2412101_2413193_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AZU01156.1|2413357_2416768_-	exonuclease V subunit beta	NA	NA	NA	NA	NA
AZU01157.1|2416764_2419641_-	hypothetical protein	NA	NA	NA	NA	NA
AZU02398.1|2420401_2422291_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AZU01158.1|2422632_2423529_-	patatin family protein	NA	NA	NA	NA	NA
AZU02399.1|2423534_2425550_-	ABC transporter	NA	A0A0R6PKQ6	Moraxella_phage	27.2	2.6e-29
AZU01159.1|2425690_2426782_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
CP026734	Brevibacterium linens strain ATCC 19391 chromosome, complete genome	3806710	3079158	3144548	3806710	transposase,holin	Corynebacterium_phage(16.67%)	52	NA	NA
AZU01667.1|3079158_3080550_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
AZU01668.1|3080715_3081969_-	hypothetical protein	NA	NA	NA	NA	NA
AZU01669.1|3082037_3083312_-|transposase	IS256-like element ISBli2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	70.5	8.9e-169
AZU01670.1|3083955_3085572_-	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	28.0	3.1e-41
AZU01671.1|3085775_3086870_-	calcium-binding protein	NA	NA	NA	NA	NA
AZU01672.1|3087159_3087831_+	hypothetical protein	NA	NA	NA	NA	NA
AZU01673.1|3087861_3088662_-	hypothetical protein	NA	NA	NA	NA	NA
AZU02462.1|3088674_3089376_-	thioesterase family protein	NA	NA	NA	NA	NA
AZU02463.1|3089649_3090231_+	hypothetical protein	NA	NA	NA	NA	NA
AZU01674.1|3090416_3091265_+	aldo/keto reductase	NA	NA	NA	NA	NA
AZU01675.1|3091598_3093050_+	MFS transporter	NA	NA	NA	NA	NA
AZU01676.1|3093165_3094398_-	hypothetical protein	NA	NA	NA	NA	NA
AZU01677.1|3094508_3095060_+	hypothetical protein	NA	NA	NA	NA	NA
AZU01678.1|3095028_3095511_-	DNA mismatch repair protein MutT	NA	NA	NA	NA	NA
AZU01679.1|3095507_3096128_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AZU01680.1|3096278_3098360_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	24.1	9.5e-11
AZU01681.1|3098592_3099972_-	serine--pyruvate aminotransferase	NA	NA	NA	NA	NA
AZU01682.1|3100125_3101505_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZU02464.1|3101733_3102993_-	hypothetical protein	NA	NA	NA	NA	NA
AZU01683.1|3103178_3103532_+	ketosteroid isomerase	NA	NA	NA	NA	NA
AZU01684.1|3103621_3104542_-	hydroxylacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZU01685.1|3104717_3105581_+	hypothetical protein	NA	NA	NA	NA	NA
AZU01686.1|3105625_3106849_+	chromate transporter	NA	NA	NA	NA	NA
AZU01687.1|3106922_3108554_-	AMP-dependent synthetase	NA	NA	NA	NA	NA
AZU01688.1|3108817_3109579_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AZU01689.1|3109862_3110435_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZU01690.1|3110434_3111682_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AZU01691.1|3111831_3112749_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZU01692.1|3112835_3114014_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AZU01693.1|3114251_3115637_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AZU01694.1|3115730_3116318_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZU01695.1|3116515_3116842_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZU01696.1|3117043_3117316_+	hypothetical protein	NA	NA	NA	NA	NA
AZU01697.1|3117489_3118947_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZU01698.1|3118989_3120354_-	shikimate transporter	NA	NA	NA	NA	NA
AZU01699.1|3120605_3121115_+	hypothetical protein	NA	NA	NA	NA	NA
AZU01700.1|3123606_3124203_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZU01701.1|3124340_3125243_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.3	4.8e-68
AZU02465.1|3125234_3126056_+	hypothetical protein	NA	NA	NA	NA	NA
AZU01702.1|3126179_3126503_+	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
AZU01703.1|3126613_3127243_+	hypothetical protein	NA	NA	NA	NA	NA
AZU01704.1|3127482_3127944_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
AZU01705.1|3128080_3128365_-	hypothetical protein	NA	NA	NA	NA	NA
AZU01706.1|3128357_3133388_-	hypothetical protein	NA	NA	NA	NA	NA
AZU01707.1|3133616_3134663_-	hypothetical protein	NA	NA	NA	NA	NA
AZU01708.1|3136743_3138045_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	66.2	5.5e-166
AZU01709.1|3138214_3139765_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AZU01710.1|3139761_3140508_+	ATP-binding protein	NA	NA	NA	NA	NA
AZU01711.1|3140991_3142074_-	hypothetical protein	NA	NA	NA	NA	NA
AZU01712.1|3142379_3143285_-	hypothetical protein	NA	NA	NA	NA	NA
AZU01713.1|3143368_3143941_-	hypothetical protein	NA	NA	NA	NA	NA
AZU02466.1|3143957_3144548_-|transposase	transposase	transposase	A0A219YB42	Aeromonas_phage	40.7	6.0e-27
