The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034721	Salmonella enterica subsp. enterica serovar Bareilly strain RSE03 chromosome, complete genome	4682141	1614891	1624062	4682141	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AZT76071.1|1614891_1615839_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AZT76072.1|1615822_1616554_+	ABC transporter permease	NA	NA	NA	NA	NA
AZT76073.1|1616534_1616642_-	protein YohO	NA	NA	NA	NA	NA
AZT76074.1|1616701_1617433_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AZT76075.1|1617655_1619341_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AZT76076.1|1619337_1620057_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AZT76077.1|1620103_1620571_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
AZT76078.1|1620627_1621158_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AZT76079.1|1621329_1621788_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AZT76080.1|1622028_1624062_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 2
CP034721	Salmonella enterica subsp. enterica serovar Bareilly strain RSE03 chromosome, complete genome	4682141	1910663	1970281	4682141	portal,capsid,tRNA,integrase,holin,tail,terminase,head,lysis	Salmonella_phage(32.26%)	75	1902729:1902742	1917279:1917292
1902729:1902742	attL	GATTTCAGCGGTAA	NA	NA	NA	NA
AZT76331.1|1910663_1911770_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AZT76332.1|1911823_1912285_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AZT76333.1|1912296_1912626_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AZT76334.1|1912622_1913288_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AZT76335.1|1913459_1914710_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
AZT76336.1|1914823_1915966_-|integrase	integrase	integrase	O21929	Phage_21	80.3	8.2e-174
AZT76337.1|1915955_1916192_-	excisionase	NA	NA	NA	NA	NA
AZT76338.1|1916334_1916874_-	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	99.4	1.0e-97
AZT76339.1|1917010_1917838_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	98.5	3.2e-151
1917279:1917292	attR	TTACCGCTGAAATC	NA	NA	NA	NA
AZT78805.1|1917895_1918267_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
AZT76340.1|1918806_1919145_+	hypothetical protein	NA	NA	NA	NA	NA
AZT76341.1|1919082_1919391_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	5.0e-09
AZT76342.1|1919599_1920295_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.1	1.6e-127
AZT76343.1|1920268_1920454_+	amino acid permease	NA	NA	NA	NA	NA
AZT76344.1|1920392_1920617_+	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AZT76345.1|1920645_1921200_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
AZT76346.1|1921339_1921516_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	94.6	4.6e-28
AZT76347.1|1921534_1921843_-	XRE family transcriptional regulator	NA	A0A088CD40	Shigella_phage	93.1	2.5e-45
AZT76348.1|1921832_1922096_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	90.8	2.1e-40
AZT76349.1|1922027_1923026_+	peptidase	NA	Q8HA97	Salmonella_phage	76.7	3.9e-119
AZT76350.1|1923022_1923247_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	98.6	2.8e-38
AZT76351.1|1923243_1924203_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.6	7.7e-117
AZT76352.1|1924204_1924687_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.1	6.0e-86
AZT76353.1|1924686_1925565_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	87.7	2.7e-148
AZT76354.1|1925557_1927288_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	58.4	7.9e-221
AZT76355.1|1927284_1927605_+	LexA family transcriptional regulator	NA	S5FXP5	Shigella_phage	56.6	7.4e-24
AZT76356.1|1927601_1927991_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	86.8	9.2e-61
AZT78806.1|1928007_1928868_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	99.0	1.0e-160
AZT76357.1|1928875_1929865_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	2.7e-189
AZT76358.1|1929879_1930458_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.8	3.2e-49
AZT76359.1|1930656_1931382_+	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	64.1	1.8e-78
AZT76360.1|1931507_1931924_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
AZT76361.1|1932497_1932686_+	hypothetical protein	NA	NA	NA	NA	NA
AZT76362.1|1932775_1933165_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	71.8	1.4e-40
AZT76363.1|1933151_1933433_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	1.3e-35
AZT76364.1|1933432_1934059_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	79.2	1.1e-92
AZT76365.1|1934055_1934649_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	77.9	2.2e-53
AZT76366.1|1934771_1935173_-	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AZT76367.1|1935458_1935572_+	hypothetical protein	NA	A0A0U2S671	Escherichia_phage	80.6	1.1e-09
AZT76368.1|1935575_1936004_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	81.0	7.1e-38
AZT76369.1|1935975_1937907_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	2.8e-259
AZT76370.1|1937890_1938094_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
AZT76371.1|1938090_1939671_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
AZT76372.1|1939660_1941157_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
AZT76373.1|1941169_1941517_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	3.2e-20
AZT76374.1|1941571_1942600_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
AZT76375.1|1942657_1943017_+	DNA packaging protein	NA	NA	NA	NA	NA
AZT76376.1|1943027_1943405_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	53.8	2.6e-28
AZT76377.1|1943391_1943970_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	79.7	1.1e-81
AZT76378.1|1943966_1944368_+|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	98.0	1.2e-50
AZT76379.1|1944375_1945122_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
AZT76380.1|1945172_1945568_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
AZT76381.1|1945564_1945903_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.7	1.0e-31
AZT76382.1|1945874_1948916_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	63.7	4.0e-284
AZT76383.1|1948918_1949248_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	2.1e-42
AZT76384.1|1949257_1949956_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	9.3e-104
AZT76385.1|1949962_1950700_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	83.8	3.7e-127
AZT76386.1|1950597_1951245_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.6	9.3e-90
AZT76387.1|1954707_1954950_+	hypothetical protein	NA	NA	NA	NA	NA
AZT76388.1|1955003_1957472_+	shikimate transporter	NA	Q8HAB4	Salmonella_phage	64.8	2.5e-143
AZT76389.1|1957486_1958005_+|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	52.0	1.9e-45
AZT76390.1|1958008_1958542_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	72.5	1.4e-70
AZT78807.1|1958544_1959243_-|tail	phage tail protein	tail	A0A1C9II89	Salmonella_phage	53.4	7.7e-58
AZT76391.1|1959779_1960337_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	88.5	2.3e-89
AZT76392.1|1960508_1960928_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.8	1.0e-36
AZT76393.1|1960930_1962199_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	96.9	8.6e-241
AZT76394.1|1962191_1962863_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	2.6e-79
AZT76395.1|1963114_1963327_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.5e-20
AZT76396.1|1963785_1964910_+	DUF3626 domain-containing protein	NA	NA	NA	NA	NA
AZT76397.1|1965861_1966275_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	1.9e-19
AZT76398.1|1966291_1967020_+	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	1.4e-62
AZT76399.1|1967211_1967754_+	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AZT76400.1|1967902_1968280_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AZT76401.1|1968352_1969162_-	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.0	9.2e-63
AZT78808.1|1970041_1970281_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
>prophage 3
CP034721	Salmonella enterica subsp. enterica serovar Bareilly strain RSE03 chromosome, complete genome	4682141	2427530	2433433	4682141		Escherichia_phage(33.33%)	8	NA	NA
AZT76827.1|2427530_2427830_-	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	55.7	4.2e-13
AZT76828.1|2427868_2428009_-	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	83.9	1.5e-08
AZT76829.1|2428363_2428633_-	hypothetical protein	NA	S4TSR3	Salmonella_phage	93.7	3.5e-27
AZT76830.1|2428939_2429827_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	4.3e-37
AZT76831.1|2430206_2430608_-	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
AZT76832.1|2430742_2431633_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AZT76833.1|2431632_2432625_+	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
AZT76834.1|2432626_2433433_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
>prophage 4
CP034721	Salmonella enterica subsp. enterica serovar Bareilly strain RSE03 chromosome, complete genome	4682141	2931013	2938898	4682141	transposase,protease	Macacine_betaherpesvirus(16.67%)	6	NA	NA
AZT77272.1|2931013_2932124_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	3.8e-06
AZT77273.1|2932534_2934811_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AZT77274.1|2934841_2935162_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AZT77275.1|2935485_2935707_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AZT77276.1|2935836_2937783_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
AZT77277.1|2937779_2938898_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
>prophage 5
CP034721	Salmonella enterica subsp. enterica serovar Bareilly strain RSE03 chromosome, complete genome	4682141	4430280	4465821	4682141	plate,capsid,portal,integrase,holin,tail,terminase,head	Salmonella_phage(78.05%)	46	4430073:4430117	4461196:4461240
4430073:4430117	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
AZT78514.1|4430280_4430994_+	hypothetical protein	NA	Q37850	Escherichia_phage	48.8	1.1e-62
AZT78515.1|4431025_4431268_-	hypothetical protein	NA	NA	NA	NA	NA
AZT78516.1|4431316_4432435_-	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	99.2	4.2e-191
AZT78517.1|4432592_4433786_+|tail	phage tail protein	tail	A0A0M4S6M1	Salmonella_phage	97.7	5.8e-223
AZT78518.1|4433798_4434314_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	95.9	3.9e-91
AZT78519.1|4434328_4434664_+|tail	phage tail assembly protein	tail	A0A0M4RCV2	Salmonella_phage	99.1	3.0e-52
AZT78520.1|4434672_4434789_+|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	100.0	6.6e-15
AZT78521.1|4434789_4437714_+|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	94.4	0.0e+00
AZT78522.1|4438310_4438907_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	66.5	6.1e-72
AZT78523.1|4438906_4439959_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	60.7	2.7e-115
AZT78524.1|4439948_4440563_-|tail	phage tail protein I	tail	A0A1J0I2I4	Salmonella_phage	99.0	3.4e-110
AZT78525.1|4440555_4441467_-|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	98.7	2.2e-161
AZT78526.1|4441463_4441826_-|plate	baseplate assembly protein	plate	A0A0M4S6L5	Salmonella_phage	100.0	5.0e-61
AZT78527.1|4441822_4442443_-|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	83.1	4.7e-91
AZT78528.1|4442600_4443245_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	98.1	1.2e-116
AZT78529.1|4443205_4443700_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	98.0	8.7e-80
AZT78530.1|4443699_4444230_-	DUF2514 family protein	NA	A0A0M4S5V1	Salmonella_phage	86.9	7.0e-35
AZT78531.1|4444331_4444772_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	97.3	4.0e-76
AZT78532.1|4444755_4445091_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	98.2	2.1e-53
AZT78533.1|4445101_4445302_-|tail	phage tail protein	tail	A0A0M4RTN6	Salmonella_phage	100.0	1.8e-31
AZT78534.1|4445301_4445790_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	97.5	5.2e-85
AZT78535.1|4445892_4446741_-|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	98.2	7.3e-135
AZT78536.1|4446783_4447830_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	98.8	7.0e-196
AZT78537.1|4447870_4448716_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	96.8	2.2e-152
AZT78538.1|4448869_4450582_+	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	97.7	0.0e+00
AZT78539.1|4450582_4451632_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	99.7	2.0e-206
AZT78540.1|4452010_4452739_-	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	71.0	3.5e-93
AZT78541.1|4452938_4455329_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	88.9	0.0e+00
AZT78542.1|4455325_4456435_-	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	82.1	4.1e-178
AZT78543.1|4456431_4456752_-	DUF4406 domain-containing protein	NA	A0A1I9KFD3	Aeromonas_phage	67.8	1.9e-27
AZT78544.1|4456751_4457723_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	81.3	6.2e-138
AZT78545.1|4457724_4457937_-	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	95.7	6.4e-32
AZT78546.1|4457979_4458162_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AZT78547.1|4458161_4458596_-	tellurite resistance protein	NA	Q1MVI3	Enterobacteria_phage	91.0	5.1e-68
AZT78548.1|4458689_4458920_-	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	74.7	2.7e-28
AZT78549.1|4458909_4459116_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	100.0	4.3e-33
AZT78550.1|4459126_4459330_-	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	97.0	4.4e-30
AZT78551.1|4459340_4459622_-	regulator	NA	A0A0M4RCW1	Salmonella_phage	72.0	3.7e-35
AZT78552.1|4459756_4460050_+	XRE family transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	54.6	2.2e-22
AZT78553.1|4460116_4461097_+|integrase	site-specific integrase	integrase	A0A0M4RTQ0	Salmonella_phage	92.3	2.9e-175
AZT78554.1|4461264_4461765_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4461196:4461240	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
AZT78555.1|4461915_4462614_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AZT78556.1|4462610_4463984_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
AZT78557.1|4464034_4464430_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AZT78558.1|4464441_4465194_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AZT78559.1|4465200_4465821_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
