The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034703	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE30 chromosome, complete genome	4689056	1143497	1198444	4689056	holin,tail,lysis,tRNA,terminase	Enterobacteria_phage(25.0%)	56	NA	NA
AZT63218.1|1143497_1144265_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AZT63219.1|1144305_1144653_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZT66211.1|1146021_1146540_-	YfiR family protein	NA	NA	NA	NA	NA
AZT63220.1|1146979_1148050_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
AZT63221.1|1148059_1149181_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AZT63222.1|1149238_1150147_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AZT63223.1|1150107_1151268_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AZT66212.1|1151367_1151415_-	hypothetical protein	NA	NA	NA	NA	NA
AZT63224.1|1151518_1151857_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AZT63225.1|1151998_1152184_-	hypothetical protein	NA	NA	NA	NA	NA
AZT63226.1|1152128_1152866_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AZT63227.1|1152997_1153978_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AZT63228.1|1154834_1157408_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
AZT63229.1|1163149_1163386_+	hypothetical protein	NA	NA	NA	NA	NA
AZT63230.1|1163395_1163851_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
AZT63231.1|1163954_1165256_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.5e-43
AZT66213.1|1165606_1166962_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AZT63232.1|1167076_1169737_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AZT63233.1|1169790_1170471_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AZT63234.1|1170543_1170963_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
AZT63235.1|1171166_1172204_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AZT63236.1|1172319_1173009_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AZT63237.1|1173327_1173711_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
AZT63238.1|1173772_1174360_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
AZT63239.1|1174462_1175362_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZT63240.1|1175379_1176714_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AZT63241.1|1176844_1177582_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
AZT63242.1|1177566_1179189_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AZT63243.1|1179273_1179453_+	hypothetical protein	NA	NA	NA	NA	NA
AZT63244.1|1179452_1179617_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
AZT63245.1|1179613_1180189_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
AZT63246.1|1180220_1180871_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AZT63247.1|1180870_1181827_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AZT63248.1|1181823_1182303_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
AZT66214.1|1182332_1182449_+	transcriptional regulator	NA	NA	NA	NA	NA
AZT63249.1|1182800_1184030_+	DUF4102 domain-containing protein	NA	H6WRW7	Salmonella_phage	94.4	2.9e-233
AZT63250.1|1184007_1184292_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
AZT63251.1|1184332_1184572_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AZT63252.1|1185289_1185613_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	66.4	5.7e-32
AZT63253.1|1185609_1185804_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
AZT66215.1|1185800_1186082_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	78.0	8.2e-35
AZT63254.1|1186078_1186633_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	64.6	2.8e-63
AZT63255.1|1186578_1186770_-	hypothetical protein	NA	NA	NA	NA	NA
AZT63256.1|1187617_1188043_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
AZT63257.1|1188101_1188275_+	hypothetical protein	NA	Q9MBZ5	Enterobacteria_phage	57.9	5.8e-07
AZT63258.1|1188480_1189395_+	hypothetical protein	NA	NA	NA	NA	NA
AZT63259.1|1190089_1190272_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AZT63260.1|1190464_1190854_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	71.8	1.4e-40
AZT63261.1|1190840_1191122_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	78.5	3.7e-35
AZT63262.1|1191121_1191736_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	83.8	9.7e-97
AZT63263.1|1191732_1192212_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	73.8	5.3e-50
AZT63264.1|1192451_1192853_-	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AZT63265.1|1193138_1193684_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	79.9	1.9e-56
AZT63266.1|1193655_1195587_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.6	8.2e-259
AZT63267.1|1195570_1195774_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
AZT63268.1|1198024_1198444_+|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.5e-52
>prophage 2
CP034703	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE30 chromosome, complete genome	4689056	1410356	1441642	4689056	protease,integrase,capsid,transposase	Salmonella_virus(21.43%)	34	1429179:1429193	1442135:1442149
AZT63425.1|1410356_1410815_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
AZT63426.1|1411514_1412753_+	alanine transaminase	NA	NA	NA	NA	NA
AZT66220.1|1412802_1412874_-	membrane protein YpdK	NA	NA	NA	NA	NA
AZT63427.1|1413276_1414197_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	1.1e-75
AZT63428.1|1414718_1414961_+	DUF2545 family protein	NA	NA	NA	NA	NA
AZT63429.1|1415235_1416627_-	phosphoglycerate transporter PgtP	NA	NA	NA	NA	NA
AZT66222.1|1416800_1417019_+	hypothetical protein	NA	NA	NA	NA	NA
AZT66221.1|1417062_1418256_+	phosphoglycerate transport regulator PgtC	NA	NA	NA	NA	NA
AZT63430.1|1418252_1420259_+	two-component system sensor histidine kinase PgtB	NA	NA	NA	NA	NA
AZT66223.1|1420248_1421496_+	two-component system response regulator PgtA	NA	NA	NA	NA	NA
AZT63431.1|1421763_1422702_+|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
AZT66224.1|1422887_1423103_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	6.5e-08
AZT63432.1|1423181_1424333_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.3	6.8e-51
AZT63433.1|1424398_1424542_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
AZT63434.1|1425531_1427454_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
AZT63435.1|1427460_1427727_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.3e-25
AZT63436.1|1427695_1428085_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
AZT63437.1|1428186_1428390_+	hypothetical protein	NA	NA	NA	NA	NA
1429179:1429193	attL	TGTCCCCTGCAGGAA	NA	NA	NA	NA
AZT63438.1|1429368_1429629_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AZT63439.1|1429628_1429874_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AZT63440.1|1430211_1430790_-	hypothetical protein	NA	NA	NA	NA	NA
AZT63441.1|1430898_1431159_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	66.3	9.3e-25
AZT63442.1|1431170_1431521_-	hypothetical protein	NA	NA	NA	NA	NA
AZT63443.1|1432135_1434805_-	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	48.7	2.5e-242
AZT63444.1|1434855_1435125_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	50.8	6.7e-10
AZT63445.1|1435213_1435621_-	hypothetical protein	NA	NA	NA	NA	NA
AZT63446.1|1435613_1436036_-	hypothetical protein	NA	NA	NA	NA	NA
AZT63447.1|1436028_1436232_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AZT63448.1|1436424_1436610_+	hypothetical protein	NA	NA	NA	NA	NA
AZT63449.1|1436825_1437833_-|capsid	major capsid protein	capsid	F1BUM2	Cronobacter_phage	45.7	4.7e-64
AZT63450.1|1437842_1438601_-	hypothetical protein	NA	NA	NA	NA	NA
AZT63451.1|1438750_1438969_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AZT63452.1|1439442_1440465_-|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	38.1	2.4e-52
AZT63453.1|1440491_1441642_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.3	6.8e-51
1442135:1442149	attR	TGTCCCCTGCAGGAA	NA	NA	NA	NA
>prophage 3
CP034703	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE30 chromosome, complete genome	4689056	1681585	1690756	4689056	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AZT63647.1|1681585_1682533_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
AZT63648.1|1682516_1683248_+	ABC transporter permease	NA	NA	NA	NA	NA
AZT63649.1|1683228_1683336_-	protein YohO	NA	NA	NA	NA	NA
AZT63650.1|1683395_1684127_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AZT63651.1|1684349_1686035_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AZT63652.1|1686031_1686751_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AZT63653.1|1686797_1687265_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AZT63654.1|1687321_1687852_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AZT63655.1|1688023_1688482_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AZT63656.1|1688722_1690756_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
CP034703	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE30 chromosome, complete genome	4689056	1758149	1768655	4689056		Enterobacteria_phage(37.5%)	9	NA	NA
AZT63697.1|1758149_1759553_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	2.3e-21
AZT63698.1|1759730_1760624_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AZT63699.1|1760999_1762085_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.3e-101
AZT63700.1|1762084_1762984_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
AZT63701.1|1763031_1763910_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	1.6e-108
AZT63702.1|1763910_1764462_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
AZT63703.1|1765457_1766231_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZT63704.1|1766235_1767315_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
AZT63705.1|1767341_1768655_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
CP034703	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE30 chromosome, complete genome	4689056	1851475	1874771	4689056	plate,transposase,integrase,tail	Salmonella_phage(22.22%)	26	1853052:1853111	1871393:1871454
AZT63777.1|1851475_1851766_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	1.2e-07
AZT63778.1|1852137_1852935_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1853052:1853111	attL	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC	NA	NA	NA	NA
AZT63779.1|1853179_1854037_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	61.6	2.2e-91
AZT63780.1|1854030_1854579_+	hypothetical protein	NA	A5LH27	Enterobacteria_phage	70.1	3.6e-26
AZT63781.1|1854571_1855189_+|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	36.2	3.9e-13
AZT63782.1|1855227_1856697_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	37.5	3.0e-75
AZT63783.1|1856693_1857200_+|tail	phage tail protein	tail	NA	NA	NA	NA
AZT63784.1|1857258_1857558_+|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	31.6	1.9e-05
AZT63785.1|1859220_1859436_+|tail	phage tail protein	tail	R9TR63	Vibrio_phage	51.4	9.7e-12
AZT63786.1|1859437_1860556_+	late control protein D	NA	R9TNM7	Vibrio_phage	32.8	7.3e-34
AZT63787.1|1860595_1860949_+|plate	baseplate assembly protein	plate	R9TRM1	Vibrio_phage	54.1	6.5e-21
AZT63788.1|1860932_1861853_+|plate	baseplate assembly protein	plate	A0A088FQL4	Escherichia_phage	49.2	1.7e-65
AZT63789.1|1861842_1862406_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.7	2.0e-27
AZT63790.1|1862398_1864027_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	39.3	4.2e-38
AZT63791.1|1864029_1864545_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	8.1e-12
AZT63792.1|1864934_1865375_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	45.8	1.5e-27
AZT63793.1|1865434_1867264_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.3	1.5e-60
AZT63794.1|1867602_1867845_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.3	7.6e-29
AZT63795.1|1868118_1869268_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.3	6.8e-51
AZT63796.1|1870147_1870336_+	hypothetical protein	NA	NA	NA	NA	NA
AZT63797.1|1870560_1871232_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.9	4.8e-81
AZT63798.1|1871266_1871455_-	hypothetical protein	NA	NA	NA	NA	NA
1871393:1871454	attR	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCA	NA	NA	NA	NA
AZT63799.1|1871489_1871672_+	hypothetical protein	NA	NA	NA	NA	NA
AZT63800.1|1872064_1872442_+	hypothetical protein	NA	NA	NA	NA	NA
AZT63801.1|1872468_1873287_+	hypothetical protein	NA	NA	NA	NA	NA
AZT66241.1|1873748_1874771_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP034703	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE30 chromosome, complete genome	4689056	1939388	2037282	4689056	tRNA,tail,integrase,transposase	Enterobacteria_phage(25.58%)	106	1974843:1974859	2020827:2020843
AZT63870.1|1939388_1940643_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
AZT63871.1|1940677_1942852_-	ferric-rhodotorulic acid/ferric-coprogen receptor FhuE	NA	NA	NA	NA	NA
AZT63872.1|1943193_1943553_+	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
AZT63873.1|1943555_1943930_+	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
AZT63874.1|1943943_1944582_+	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
AZT63875.1|1944562_1945387_+	thiamine kinase	NA	NA	NA	NA	NA
AZT63876.1|1945397_1946423_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
AZT63877.1|1946447_1946990_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZT63878.1|1947243_1948548_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AZT63879.1|1948726_1949266_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AZT63880.1|1949340_1949976_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZT63881.1|1950217_1950475_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	37.1	2.1e-05
AZT63882.1|1950571_1951537_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AZT63883.1|1955358_1956669_+	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
AZT63884.1|1956661_1957348_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.4	4.1e-35
AZT63885.1|1957361_1958606_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AZT63886.1|1958634_1959546_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AZT63887.1|1959564_1960386_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	1.0e-21
AZT63888.1|1960467_1961514_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
AZT63889.1|1961538_1962318_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
AZT63890.1|1962633_1963644_-	type III secretion system effector SifA	NA	NA	NA	NA	NA
AZT63891.1|1963972_1964836_-	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	26.2	2.0e-10
AZT63892.1|1964819_1965956_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.0	2.1e-28
AZT63893.1|1966206_1967436_+	peptidase T	NA	NA	NA	NA	NA
AZT63894.1|1967439_1968774_+	hypothetical protein	NA	NA	NA	NA	NA
AZT63895.1|1970014_1971478_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AZT63896.1|1971477_1972152_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AZT63897.1|1972275_1973646_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.1e-108
AZT63898.1|1973649_1974291_-	lysogenization regulator HflD	NA	NA	NA	NA	NA
AZT63899.1|1974377_1975484_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
1974843:1974859	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
AZT63900.1|1975537_1975999_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AZT63901.1|1976010_1976340_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AZT63902.1|1976336_1977002_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AZT63903.1|1977173_1978424_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
AZT63904.1|1978538_1979681_-|integrase	integrase	integrase	O21929	Phage_21	80.3	8.2e-174
AZT63905.1|1979670_1979907_-	excisionase	NA	NA	NA	NA	NA
AZT63906.1|1979956_1980460_-	Eaa protein	NA	A0A075B8H2	Enterobacteria_phage	92.3	6.0e-36
AZT63907.1|1980780_1981101_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.2	1.8e-33
AZT63908.1|1981136_1981967_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.3e-104
AZT63909.1|1982123_1982429_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	59.2	7.3e-29
AZT63910.1|1982518_1983043_+	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
AZT63911.1|1983132_1983666_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AZT63912.1|1984565_1984904_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AZT63913.1|1984900_1985296_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	5.0e-30
AZT63914.1|1986895_1987246_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	95.7	5.4e-60
AZT63915.1|1987267_1987426_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
AZT63916.1|1987824_1988031_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	9.6e-17
AZT63917.1|1988066_1988894_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AZT63918.1|1988890_1989640_-	hypothetical protein	NA	NA	NA	NA	NA
AZT63919.1|1989790_1990258_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	83.9	3.9e-66
AZT63920.1|1990271_1990499_+	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
AZT66246.1|1990464_1990839_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	3.3e-63
AZT63921.1|1991355_1992610_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	4.8e-18
AZT63922.1|1992634_1993000_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	54.3	2.3e-37
AZT63923.1|1992996_1993266_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	53.5	1.5e-17
AZT63924.1|1994219_1995020_+	hypothetical protein	NA	NA	NA	NA	NA
AZT63925.1|1995667_1996438_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
AZT63926.1|1996873_1997059_+	hypothetical protein	NA	NA	NA	NA	NA
AZT63927.1|1997149_1997725_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.2	1.5e-91
AZT63928.1|1999177_2000809_+|tail	phage tail protein	tail	A0A1B0VFW4	Salmonella_phage	65.5	9.7e-152
AZT63929.1|2000823_2001342_+|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	51.4	2.5e-45
AZT66247.1|2001983_2002316_-|tail	tail assembly chaperone	tail	A0A1B0VCD0	Salmonella_phage	66.2	1.7e-18
AZT63930.1|2002461_2004468_+	E3 ubiquitin--protein ligase	NA	Q9MBL9	Phage_Gifsy-2	79.6	1.5e-61
AZT63931.1|2004778_2005450_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
AZT66248.1|2005703_2005916_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.5e-20
AZT63932.1|2006362_2007487_+	DUF3626 domain-containing protein	NA	NA	NA	NA	NA
AZT63933.1|2008535_2008949_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	3.2e-19
AZT63934.1|2008965_2009694_+	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.0	1.0e-60
AZT63935.1|2009885_2010428_+	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	66.5	2.3e-70
AZT63936.1|2010576_2010954_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AZT63937.1|2011026_2011845_-	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.4	1.9e-63
AZT63938.1|2012718_2012958_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AZT63939.1|2013138_2013660_-	lipoprotein EnvE	NA	NA	NA	NA	NA
AZT63940.1|2014075_2014288_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
AZT63941.1|2014419_2014683_-	virulence factor	NA	NA	NA	NA	NA
AZT63942.1|2014731_2014923_+	hypothetical protein	NA	NA	NA	NA	NA
AZT63943.1|2015490_2016048_+	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	2.2e-15
AZT63944.1|2017044_2017245_+	hypothetical protein	NA	NA	NA	NA	NA
AZT63945.1|2017284_2017629_-	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
AZT63946.1|2018006_2018132_+	hypothetical protein	NA	NA	NA	NA	NA
AZT63947.1|2018331_2018556_+	hypothetical protein	NA	NA	NA	NA	NA
AZT63948.1|2018753_2019224_+	Hsp20 family protein	NA	NA	NA	NA	NA
AZT63949.1|2019332_2019521_-	hypothetical protein	NA	NA	NA	NA	NA
AZT63950.1|2019562_2020606_+	hypothetical protein	NA	NA	NA	NA	NA
AZT63951.1|2020688_2021219_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
2020827:2020843	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
AZT63952.1|2021366_2021681_-	hypothetical protein	NA	NA	NA	NA	NA
AZT66249.1|2023995_2024970_+	ABC transporter permease	NA	NA	NA	NA	NA
AZT63953.1|2024982_2025771_+	ABC transporter permease	NA	NA	NA	NA	NA
AZT63954.1|2025764_2026562_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.8e-11
AZT63955.1|2026555_2027146_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
AZT63956.1|2027227_2028361_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AZT63957.1|2028554_2028881_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AZT63958.1|2029074_2029725_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AZT63959.1|2029833_2030622_+	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
AZT66250.1|2030766_2031360_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AZT63960.1|2031428_2032277_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AZT63961.1|2032531_2032780_-	histidine kinase	NA	NA	NA	NA	NA
AZT63962.1|2033095_2033641_+	chorismate mutase	NA	NA	NA	NA	NA
AZT63963.1|2033837_2034476_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
AZT63964.1|2034492_2034678_-	hypothetical protein	NA	NA	NA	NA	NA
AZT63965.1|2034648_2035011_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
AZT63966.1|2035013_2035196_+	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
AZT63967.1|2035425_2036067_+	hypothetical protein	NA	NA	NA	NA	NA
AZT63968.1|2036187_2036373_+	hypothetical protein	NA	NA	NA	NA	NA
AZT63969.1|2036380_2036629_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AZT63970.1|2036823_2037282_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 7
CP034703	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE30 chromosome, complete genome	4689056	2907229	2982914	4689056	tRNA,protease,integrase,transposase	Bacillus_phage(17.39%)	57	2928203:2928219	2977481:2977497
AZT64759.1|2907229_2908630_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
AZT64760.1|2909235_2910327_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
AZT64761.1|2910511_2911702_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AZT64762.1|2911763_2912411_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZT64763.1|2912438_2912987_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
AZT64764.1|2915331_2915532_-	hypothetical protein	NA	NA	NA	NA	NA
AZT64765.1|2919902_2920607_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
AZT64766.1|2920587_2921910_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
AZT64767.1|2921902_2922706_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AZT64768.1|2922841_2923618_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AZT64769.1|2923597_2924491_-	hypothetical protein	NA	NA	NA	NA	NA
AZT64770.1|2924701_2925448_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AZT64771.1|2925444_2925627_-	protein YcaR	NA	NA	NA	NA	NA
AZT64772.1|2925678_2926911_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZT64773.1|2926954_2927932_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AZT64774.1|2927928_2929677_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.3	2.4e-60
2928203:2928219	attL	GCGATCGCGATACGCTG	NA	NA	NA	NA
AZT64775.1|2929713_2931978_-	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	22.1	3.3e-09
AZT64776.1|2932154_2933410_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
AZT64777.1|2933522_2933807_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
AZT64778.1|2933962_2935636_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AZT64779.1|2935749_2936433_-	(d)CMP kinase	NA	NA	NA	NA	NA
AZT64780.1|2936605_2937367_-|protease	metalloprotease	protease	NA	NA	NA	NA
AZT64781.1|2937509_2938793_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZT64782.1|2938863_2939952_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	2.8e-78
AZT64783.1|2940137_2940830_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AZT64784.1|2940966_2942727_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AZT64785.1|2943131_2943989_+	formate transporter FocA	NA	NA	NA	NA	NA
AZT64786.1|2944048_2946331_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.1e-161
AZT64787.1|2946406_2947366_-	SPI-2 type III secretion system effector SopD2	NA	NA	NA	NA	NA
AZT64788.1|2947496_2947823_+	cytoplasmic protein	NA	NA	NA	NA	NA
AZT64789.1|2947914_2948739_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	2.8e-22
AZT64790.1|2949031_2950453_-	amino acid permease	NA	NA	NA	NA	NA
AZT64791.1|2950670_2951819_-	MFS transporter	NA	NA	NA	NA	NA
AZT64792.1|2952164_2953028_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AZT64793.1|2953656_2956101_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	5.4e-223
AZT64794.1|2956338_2957631_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
AZT64795.1|2957889_2959233_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
AZT66287.1|2959242_2959854_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AZT64796.1|2959996_2964010_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
AZT64797.1|2964144_2964639_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
AZT64798.1|2965185_2966154_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	6.5e-63
AZT64799.1|2966268_2968035_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	1.6e-22
AZT64800.1|2968035_2969757_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.5	6.4e-13
AZT64801.1|2969801_2970506_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZT64802.1|2970506_2970890_+	hypothetical protein	NA	NA	NA	NA	NA
AZT64803.1|2970817_2971036_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZT64804.1|2971126_2972038_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZT64805.1|2972146_2973007_+	pirin family protein	NA	NA	NA	NA	NA
AZT64806.1|2973026_2973704_+	hydrolase	NA	NA	NA	NA	NA
AZT64807.1|2974040_2975295_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
AZT64808.1|2975603_2975981_+|integrase	integrase	integrase	NA	NA	NA	NA
AZT64809.1|2976142_2976340_+	hypothetical protein	NA	NA	NA	NA	NA
AZT64810.1|2976550_2978827_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
2977481:2977497	attR	CAGCGTATCGCGATCGC	NA	NA	NA	NA
AZT64811.1|2978857_2979178_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AZT64812.1|2979501_2979723_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AZT64813.1|2979852_2981799_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
AZT64814.1|2981795_2982914_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 8
CP034703	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE30 chromosome, complete genome	4689056	3315106	3322245	4689056		Salmonella_phage(66.67%)	9	NA	NA
AZT65080.1|3315106_3316432_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.5	1.0e-103
AZT65081.1|3316647_3317502_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZT65082.1|3317552_3317732_-	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AZT65083.1|3317840_3318170_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	39.6	1.0e-15
AZT66302.1|3318405_3318615_+	copper-binding protein	NA	NA	NA	NA	NA
AZT65084.1|3319039_3319402_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
AZT65085.1|3319398_3320325_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	97.4	1.1e-168
AZT65086.1|3320305_3321958_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	38.0	1.5e-83
AZT65087.1|3322014_3322245_-	hypothetical protein	NA	A0A291AX01	Salmonella_phage	65.2	9.7e-18
>prophage 9
CP034703	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE30 chromosome, complete genome	4689056	3605456	3633586	4689056	plate,transposase	Bradyrhizobium_phage(16.67%)	28	NA	NA
AZT65318.1|3605456_3606800_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AZT65319.1|3606803_3607340_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AZT65320.1|3607406_3607892_-	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
AZT65321.1|3608034_3608418_-	hypothetical protein	NA	NA	NA	NA	NA
AZT65322.1|3608402_3608888_-	hypothetical protein	NA	NA	NA	NA	NA
AZT66320.1|3609928_3610261_-	hypothetical protein	NA	NA	NA	NA	NA
AZT65323.1|3610387_3610498_-	hypothetical protein	NA	NA	NA	NA	NA
AZT65324.1|3610560_3612069_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AZT65325.1|3612092_3612635_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AZT65326.1|3615739_3616642_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
AZT65327.1|3616628_3617453_+	impE family protein	NA	NA	NA	NA	NA
AZT65328.1|3617449_3617944_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AZT65329.1|3617959_3619843_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AZT65330.1|3619839_3620835_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AZT65331.1|3620845_3621901_+	cytoplasmic protein	NA	NA	NA	NA	NA
AZT65332.1|3622429_3623161_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
AZT65333.1|3623224_3623692_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
AZT65334.1|3623688_3624411_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZT65335.1|3624445_3625201_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AZT65336.1|3625272_3626640_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
AZT65337.1|3626695_3627466_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZT65338.1|3627543_3628344_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AZT65339.1|3628475_3629651_-	MFS transporter	NA	NA	NA	NA	NA
AZT65340.1|3629755_3630670_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZT65341.1|3630691_3631495_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	3.2e-39
AZT65342.1|3631731_3632190_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	7.7e-14
AZT66321.1|3632146_3632383_-	hypothetical protein	NA	NA	NA	NA	NA
AZT65343.1|3632330_3633586_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
>prophage 1
CP034704	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE30 plasmid pRSE30, complete sequence	63885	43524	52084	63885	transposase,integrase	Shigella_phage(16.67%)	8	25188:25204	47717:47733
25188:25204	attL	TATCCATACTCCACCCG	NA	NA	NA	NA
AZT66382.1|43524_44728_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.8	1.1e-115
AZT66383.1|45414_45633_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
AZT66384.1|45634_45940_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
AZT66385.1|46248_47031_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	3.5e-51
AZT66386.1|47181_48123_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.0	1.4e-73
47717:47733	attR	CGGGTGGAGTATGGATA	NA	NA	NA	NA
AZT66387.1|48548_49754_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	1.4e-163
AZT66388.1|49750_50728_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	52.9	2.0e-83
AZT66389.1|50809_52084_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.2	5.0e-156
