The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034700	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE39 chromosome, complete genome	4689404	1143954	1198903	4689404	terminase,tail,lysis,tRNA,holin	Enterobacteria_phage(25.0%)	56	NA	NA
AZT32129.1|1143954_1144722_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AZT32130.1|1144762_1145110_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZT32131.1|1145266_1146487_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
AZT35185.1|1146479_1146998_-	YfiR family protein	NA	NA	NA	NA	NA
AZT32132.1|1147437_1148508_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
AZT32133.1|1148517_1149639_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AZT32134.1|1149696_1150605_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AZT32135.1|1150565_1151726_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AZT35186.1|1151825_1151873_-	hypothetical protein	NA	NA	NA	NA	NA
AZT32136.1|1151976_1152315_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AZT32137.1|1152585_1153323_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AZT32138.1|1153454_1154435_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AZT32139.1|1154431_1155163_+	polyphenol oxidase	NA	NA	NA	NA	NA
AZT32140.1|1155292_1157866_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
AZT32141.1|1163607_1163838_+	hypothetical protein	NA	NA	NA	NA	NA
AZT32142.1|1163854_1164310_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
AZT32143.1|1164413_1165715_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.5e-43
AZT35187.1|1166065_1167421_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AZT32144.1|1167535_1170196_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AZT32145.1|1170249_1170930_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AZT32146.1|1171002_1171422_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
AZT32147.1|1171625_1172663_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AZT32148.1|1172778_1173468_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AZT32149.1|1173786_1174170_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
AZT32150.1|1174231_1174819_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
AZT32151.1|1174921_1175821_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZT32152.1|1175838_1177173_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AZT32153.1|1177303_1178041_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
AZT32154.1|1178025_1179648_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AZT32155.1|1179732_1179912_+	hypothetical protein	NA	NA	NA	NA	NA
AZT32156.1|1179911_1180076_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
AZT32157.1|1180072_1180648_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
AZT32158.1|1180679_1181330_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AZT32159.1|1181329_1182286_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AZT32160.1|1182282_1182762_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
AZT35188.1|1182791_1182908_+	transcriptional regulator	NA	NA	NA	NA	NA
AZT32161.1|1183259_1184489_+	DUF4102 domain-containing protein	NA	H6WRW7	Salmonella_phage	94.4	2.9e-233
AZT32162.1|1184466_1184751_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
AZT32163.1|1184791_1185031_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AZT32164.1|1185748_1186072_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	66.4	5.7e-32
AZT32165.1|1186068_1186263_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
AZT35189.1|1186259_1186541_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	78.0	8.2e-35
AZT32166.1|1186537_1187092_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	64.6	2.8e-63
AZT32167.1|1187037_1187229_-	hypothetical protein	NA	NA	NA	NA	NA
AZT32168.1|1188076_1188502_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
AZT32169.1|1188560_1188734_+	hypothetical protein	NA	Q9MBZ5	Enterobacteria_phage	57.9	5.8e-07
AZT32170.1|1188939_1189854_+	hypothetical protein	NA	NA	NA	NA	NA
AZT32171.1|1190548_1190731_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AZT35190.1|1191298_1191580_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	78.5	3.7e-35
AZT32172.1|1191579_1192194_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	83.8	9.7e-97
AZT32173.1|1192190_1192670_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	73.8	5.3e-50
AZT32174.1|1192909_1193311_-	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AZT32175.1|1193606_1194143_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.0	1.4e-54
AZT32176.1|1194114_1196046_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.6	8.2e-259
AZT32177.1|1196029_1196233_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
AZT32178.1|1198483_1198903_+|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.5e-52
>prophage 2
CP034700	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE39 chromosome, complete genome	4689404	1410938	1460838	4689404	transposase,tRNA,capsid,protease,integrase	Salmonella_virus(18.75%)	49	1407171:1407186	1465540:1465555
1407171:1407186	attL	GACGGCTTTTCGTTAC	NA	NA	NA	NA
AZT32344.1|1410938_1411397_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
AZT32345.1|1412096_1413335_+	alanine transaminase	NA	NA	NA	NA	NA
AZT35196.1|1413384_1413456_-	membrane protein YpdK	NA	NA	NA	NA	NA
AZT32346.1|1413858_1414779_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	1.1e-75
AZT32347.1|1415300_1415543_+	DUF2545 family protein	NA	NA	NA	NA	NA
AZT32348.1|1415817_1417209_-	phosphoglycerate transporter PgtP	NA	NA	NA	NA	NA
AZT35198.1|1417382_1417601_+	hypothetical protein	NA	NA	NA	NA	NA
AZT35197.1|1417644_1418838_+	phosphoglycerate transport regulator PgtC	NA	NA	NA	NA	NA
AZT32349.1|1418834_1420841_+	two-component system sensor histidine kinase PgtB	NA	NA	NA	NA	NA
AZT35199.1|1420830_1422078_+	two-component system response regulator PgtA	NA	NA	NA	NA	NA
AZT32350.1|1422345_1423284_+|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
AZT35200.1|1423469_1423799_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	1.0e-07
AZT32351.1|1425075_1425219_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
AZT32352.1|1426208_1428131_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
AZT32353.1|1428148_1428403_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
AZT32354.1|1428371_1428761_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
AZT32355.1|1430046_1430307_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AZT32356.1|1430306_1430552_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AZT32357.1|1430889_1431468_-	hypothetical protein	NA	NA	NA	NA	NA
AZT32358.1|1431576_1431837_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	66.3	9.3e-25
AZT32359.1|1431848_1432199_-	hypothetical protein	NA	NA	NA	NA	NA
AZT32360.1|1432813_1435483_-	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	48.7	2.5e-242
AZT32361.1|1435532_1435802_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	50.8	6.7e-10
AZT32362.1|1435890_1436298_-	hypothetical protein	NA	NA	NA	NA	NA
AZT32363.1|1436290_1436713_-	hypothetical protein	NA	NA	NA	NA	NA
AZT32364.1|1436705_1436909_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AZT32365.1|1437101_1437287_+	hypothetical protein	NA	NA	NA	NA	NA
AZT32366.1|1437502_1438510_-|capsid	major capsid protein	capsid	F1BUM2	Cronobacter_phage	45.7	4.7e-64
AZT32367.1|1438519_1439278_-	hypothetical protein	NA	NA	NA	NA	NA
AZT32368.1|1439427_1439646_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AZT32369.1|1440119_1441142_-|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	38.1	2.4e-52
AZT32370.1|1441168_1442319_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.3	6.8e-51
AZT32371.1|1442346_1442631_-	DUF4102 domain-containing protein	NA	A7X7X0	Dichelobacter_phage	45.0	9.2e-10
AZT32372.1|1442958_1443900_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	87.8	3.2e-147
AZT32373.1|1444188_1444944_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AZT32374.1|1446681_1446966_+	DUF406 family protein	NA	NA	NA	NA	NA
AZT32375.1|1447143_1448454_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AZT32376.1|1448453_1450601_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AZT32377.1|1450809_1451295_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AZT32378.1|1451394_1451946_-	endonuclease SmrB	NA	NA	NA	NA	NA
AZT32379.1|1452111_1453044_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AZT32380.1|1453079_1454165_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
AZT32381.1|1454168_1454993_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AZT32382.1|1454992_1455802_+	hypothetical protein	NA	NA	NA	NA	NA
AZT32383.1|1455801_1456350_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AZT32384.1|1456382_1456658_+	YfcL family protein	NA	NA	NA	NA	NA
AZT32385.1|1456709_1458770_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AZT32386.1|1458869_1460084_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AZT32387.1|1460181_1460838_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
1465540:1465555	attR	GACGGCTTTTCGTTAC	NA	NA	NA	NA
>prophage 3
CP034700	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE39 chromosome, complete genome	4689404	1682278	1691449	4689404	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AZT32571.1|1682278_1683226_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
AZT32572.1|1683209_1683941_+	ABC transporter permease	NA	NA	NA	NA	NA
AZT32573.1|1683921_1684029_-	protein YohO	NA	NA	NA	NA	NA
AZT32574.1|1684088_1684820_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AZT32575.1|1685042_1686728_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AZT32576.1|1686724_1687444_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AZT32577.1|1687490_1687958_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AZT32578.1|1688014_1688545_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AZT32579.1|1688716_1689175_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AZT32580.1|1689415_1691449_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
CP034700	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE39 chromosome, complete genome	4689404	1758850	1769355	4689404		Enterobacteria_phage(37.5%)	10	NA	NA
AZT32627.1|1758850_1760254_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	2.3e-21
AZT32628.1|1760431_1761325_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AZT32629.1|1761700_1762786_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.3e-101
AZT32630.1|1762785_1763685_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
AZT32631.1|1763732_1764611_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	1.6e-108
AZT32632.1|1764611_1765163_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
AZT32633.1|1765168_1766161_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AZT32634.1|1766157_1766931_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZT32635.1|1766935_1768015_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
AZT32636.1|1768041_1769355_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
CP034700	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE39 chromosome, complete genome	4689404	1852180	1875478	4689404	plate,tail,integrase,transposase	Salmonella_phage(23.53%)	24	1853757:1853816	1872100:1872161
AZT32712.1|1852180_1852471_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	1.2e-07
AZT32713.1|1852842_1853640_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1853757:1853816	attL	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC	NA	NA	NA	NA
AZT32714.1|1853884_1854742_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	61.6	2.2e-91
AZT32715.1|1854735_1855284_+	hypothetical protein	NA	A5LH27	Enterobacteria_phage	70.1	3.6e-26
AZT32716.1|1855276_1855894_+|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	36.2	3.9e-13
AZT32717.1|1855932_1857402_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	37.5	3.0e-75
AZT32718.1|1857398_1857905_+|tail	phage tail protein	tail	NA	NA	NA	NA
AZT32719.1|1857963_1858263_+|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	31.6	1.9e-05
AZT32720.1|1859925_1860141_+|tail	phage tail protein	tail	R9TR63	Vibrio_phage	51.4	9.7e-12
AZT32721.1|1860142_1861261_+	late control protein D	NA	R9TNM7	Vibrio_phage	32.8	7.3e-34
AZT32722.1|1861300_1861654_+|plate	baseplate assembly protein	plate	R9TRM1	Vibrio_phage	54.1	6.5e-21
AZT32723.1|1861637_1862558_+|plate	baseplate assembly protein	plate	A0A088FQL4	Escherichia_phage	49.2	1.7e-65
AZT32724.1|1862547_1863111_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.7	2.0e-27
AZT32725.1|1863103_1864732_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	39.3	4.2e-38
AZT32726.1|1864734_1865250_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	8.1e-12
AZT32727.1|1865639_1866080_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	45.8	1.5e-27
AZT32728.1|1866139_1867969_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.3	1.5e-60
AZT32729.1|1868307_1868550_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.3	7.6e-29
AZT32730.1|1871267_1871939_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.9	4.8e-81
AZT32731.1|1871973_1872162_-	hypothetical protein	NA	NA	NA	NA	NA
1872100:1872161	attR	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCA	NA	NA	NA	NA
AZT32732.1|1872196_1872379_+	hypothetical protein	NA	NA	NA	NA	NA
AZT32733.1|1872771_1873149_+	hypothetical protein	NA	NA	NA	NA	NA
AZT32734.1|1873175_1873994_+	hypothetical protein	NA	NA	NA	NA	NA
AZT35219.1|1874455_1875478_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP034700	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE39 chromosome, complete genome	4689404	1940091	2037981	4689404	tail,tRNA,integrase,transposase	Enterobacteria_phage(26.19%)	106	1975545:1975561	2021527:2021543
AZT32801.1|1940091_1941346_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
AZT32802.1|1941380_1943555_-	ferric-rhodotorulic acid/ferric-coprogen receptor FhuE	NA	NA	NA	NA	NA
AZT35224.1|1943896_1944256_+	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
AZT32803.1|1944258_1944633_+	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
AZT32804.1|1944646_1945285_+	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
AZT32805.1|1945265_1946090_+	thiamine kinase	NA	NA	NA	NA	NA
AZT32806.1|1946100_1947126_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
AZT32807.1|1947150_1947693_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZT32808.1|1947947_1949252_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AZT32809.1|1949430_1949970_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AZT32810.1|1950044_1950680_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZT32811.1|1950921_1951179_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	37.1	2.1e-05
AZT32812.1|1951275_1952241_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AZT32813.1|1956060_1957371_+	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
AZT32814.1|1957363_1958050_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.4	4.1e-35
AZT32815.1|1958063_1959308_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AZT32816.1|1959336_1960248_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AZT32817.1|1960266_1961088_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	1.0e-21
AZT32818.1|1961169_1962216_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
AZT32819.1|1962240_1963020_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
AZT32820.1|1963335_1964346_-	type III secretion system effector SifA	NA	NA	NA	NA	NA
AZT32821.1|1964673_1965537_-	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	26.2	2.0e-10
AZT32822.1|1965520_1966657_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.0	2.1e-28
AZT32823.1|1966907_1968137_+	peptidase T	NA	NA	NA	NA	NA
AZT32824.1|1968140_1969475_+	hypothetical protein	NA	NA	NA	NA	NA
AZT32825.1|1969514_1970636_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AZT32826.1|1970716_1972180_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AZT32827.1|1972179_1972854_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AZT32828.1|1972977_1974348_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.1e-108
AZT32829.1|1974351_1974993_-	lysogenization regulator HflD	NA	NA	NA	NA	NA
AZT32830.1|1975079_1976186_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
1975545:1975561	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
AZT32831.1|1976239_1976701_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AZT32832.1|1976712_1977042_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AZT32833.1|1977038_1977704_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AZT32834.1|1977875_1979126_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
AZT32835.1|1979240_1980383_-|integrase	integrase	integrase	O21929	Phage_21	80.3	8.2e-174
AZT32836.1|1980372_1980609_-	excisionase	NA	NA	NA	NA	NA
AZT32837.1|1980658_1981162_-	Eaa protein	NA	A0A075B8H2	Enterobacteria_phage	92.3	6.0e-36
AZT32838.1|1981482_1981803_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.2	1.8e-33
AZT32839.1|1981838_1982669_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.3e-104
AZT32840.1|1982825_1983131_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	59.2	7.3e-29
AZT32841.1|1983220_1983745_+	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
AZT32842.1|1983834_1984368_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AZT32843.1|1985267_1985606_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AZT32844.1|1985602_1985998_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	5.0e-30
AZT32845.1|1987597_1987948_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	95.7	5.4e-60
AZT32846.1|1987969_1988128_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
AZT32847.1|1988526_1988733_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	9.6e-17
AZT32848.1|1988768_1989596_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AZT32849.1|1989592_1990342_-	hypothetical protein	NA	NA	NA	NA	NA
AZT32850.1|1990492_1990960_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	83.9	3.9e-66
AZT32851.1|1990973_1991201_+	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
AZT35225.1|1991166_1991541_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	3.3e-63
AZT32852.1|1992057_1993312_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	4.8e-18
AZT32853.1|1993697_1993967_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	53.5	1.5e-17
AZT32854.1|1994920_1995721_+	hypothetical protein	NA	NA	NA	NA	NA
AZT32855.1|1996368_1997139_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
AZT32856.1|1997574_1997760_+	hypothetical protein	NA	NA	NA	NA	NA
AZT32857.1|1997850_1998426_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.2	1.5e-91
AZT32858.1|1999878_2001510_+|tail	phage tail protein	tail	A0A1B0VFW4	Salmonella_phage	65.5	9.7e-152
AZT32859.1|2001524_2002043_+|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	51.4	2.5e-45
AZT35226.1|2002684_2002933_-|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	1.2e-18
AZT32860.1|2002926_2003043_+|tail	phage tail protein	tail	NA	NA	NA	NA
AZT32861.1|2003161_2005168_+	E3 ubiquitin--protein ligase	NA	Q9MBL9	Phage_Gifsy-2	79.6	1.5e-61
AZT32862.1|2005478_2006150_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
AZT35227.1|2006403_2006616_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.5e-20
AZT32863.1|2007062_2008187_+	DUF3626 domain-containing protein	NA	NA	NA	NA	NA
AZT32864.1|2009235_2009649_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	3.2e-19
AZT32865.1|2009665_2010394_+	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.0	1.0e-60
AZT32866.1|2010585_2011128_+	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	66.5	2.3e-70
AZT32867.1|2011276_2011654_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AZT32868.1|2011726_2012545_-	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.4	1.9e-63
AZT32869.1|2013418_2013658_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AZT32870.1|2013838_2014360_-	lipoprotein EnvE	NA	NA	NA	NA	NA
AZT32871.1|2014775_2014988_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
AZT32872.1|2015119_2015383_-	virulence factor	NA	NA	NA	NA	NA
AZT32873.1|2015431_2015623_+	hypothetical protein	NA	NA	NA	NA	NA
AZT32874.1|2016190_2016748_+	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	2.2e-15
AZT32875.1|2017744_2017945_+	hypothetical protein	NA	NA	NA	NA	NA
AZT32876.1|2017984_2018329_-	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
AZT32877.1|2018706_2018832_+	hypothetical protein	NA	NA	NA	NA	NA
AZT32878.1|2019031_2019256_+	hypothetical protein	NA	NA	NA	NA	NA
AZT32879.1|2019453_2019924_+	Hsp20 family protein	NA	NA	NA	NA	NA
AZT32880.1|2020032_2020221_-	hypothetical protein	NA	NA	NA	NA	NA
AZT32881.1|2020262_2021306_+	hypothetical protein	NA	NA	NA	NA	NA
AZT32882.1|2021388_2021919_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
2021527:2021543	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
AZT32883.1|2022066_2022381_-	hypothetical protein	NA	NA	NA	NA	NA
AZT32884.1|2025681_2026470_+	ABC transporter permease	NA	NA	NA	NA	NA
AZT32885.1|2026463_2027261_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.8e-11
AZT32886.1|2027254_2027845_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
AZT32887.1|2027926_2029060_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AZT32888.1|2029253_2029580_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AZT32889.1|2029773_2030424_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AZT32890.1|2030532_2031321_+	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
AZT35228.1|2031465_2032059_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AZT32891.1|2032127_2032976_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AZT32892.1|2033230_2033479_-	histidine kinase	NA	NA	NA	NA	NA
AZT32893.1|2033794_2034340_+	chorismate mutase	NA	NA	NA	NA	NA
AZT32894.1|2034536_2035175_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
AZT32895.1|2035191_2035377_-	hypothetical protein	NA	NA	NA	NA	NA
AZT32896.1|2035347_2035710_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
AZT32897.1|2035712_2035895_+	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
AZT32898.1|2036124_2036766_+	hypothetical protein	NA	NA	NA	NA	NA
AZT32899.1|2036886_2037072_+	hypothetical protein	NA	NA	NA	NA	NA
AZT32900.1|2037079_2037328_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AZT32901.1|2037522_2037981_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 7
CP034700	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE39 chromosome, complete genome	4689404	2907464	2983036	4689404	tRNA,integrase,protease,transposase	Bacillus_phage(17.39%)	57	2928440:2928456	2977603:2977619
AZT33707.1|2907464_2908865_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
AZT33708.1|2909470_2910562_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
AZT33709.1|2910746_2911937_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AZT33710.1|2911998_2912646_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZT33711.1|2912673_2913222_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
AZT33712.1|2913481_2915329_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AZT33713.1|2915567_2915768_-	hypothetical protein	NA	NA	NA	NA	NA
AZT33714.1|2915673_2920140_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
AZT33715.1|2920139_2920844_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
AZT33716.1|2920824_2922147_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
AZT33717.1|2922139_2922943_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AZT33718.1|2923078_2923855_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AZT33719.1|2923834_2924728_-	hypothetical protein	NA	NA	NA	NA	NA
AZT33720.1|2924938_2925685_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AZT33721.1|2925681_2925864_-	protein YcaR	NA	NA	NA	NA	NA
AZT33722.1|2925915_2927148_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZT33723.1|2927191_2928169_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AZT33724.1|2928165_2929914_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.3	2.4e-60
2928440:2928456	attL	GCGATCGCGATACGCTG	NA	NA	NA	NA
AZT33725.1|2929950_2932215_-	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	22.1	3.3e-09
AZT33726.1|2932391_2933647_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
AZT33727.1|2933759_2934044_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
AZT33728.1|2934199_2935873_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AZT33729.1|2935986_2936670_-	(d)CMP kinase	NA	NA	NA	NA	NA
AZT33730.1|2936842_2937604_-|protease	metalloprotease	protease	NA	NA	NA	NA
AZT33731.1|2937746_2939030_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZT33732.1|2939100_2940189_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	2.8e-78
AZT33733.1|2941202_2942963_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AZT33734.1|2943367_2944225_+	formate transporter FocA	NA	NA	NA	NA	NA
AZT33735.1|2944284_2946567_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.1e-161
AZT33736.1|2946642_2947602_-	SPI-2 type III secretion system effector SopD2	NA	NA	NA	NA	NA
AZT33737.1|2947732_2948059_+	cytoplasmic protein	NA	NA	NA	NA	NA
AZT33738.1|2948150_2948975_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	2.8e-22
AZT33739.1|2949267_2950689_-	amino acid permease	NA	NA	NA	NA	NA
AZT33740.1|2950906_2952055_-	MFS transporter	NA	NA	NA	NA	NA
AZT33741.1|2952403_2953267_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AZT33742.1|2953268_2953886_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
AZT33743.1|2953896_2956341_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	5.4e-223
AZT33744.1|2956578_2957871_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
AZT33745.1|2958129_2959473_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
AZT33746.1|2959482_2960094_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AZT33747.1|2964268_2964763_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
AZT33748.1|2965309_2966278_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	6.5e-63
AZT33749.1|2966392_2968159_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	1.6e-22
AZT33750.1|2968159_2969881_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.5	6.4e-13
AZT33751.1|2970628_2971012_+	hypothetical protein	NA	NA	NA	NA	NA
AZT33752.1|2970939_2971158_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZT33753.1|2971248_2972160_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZT33754.1|2972268_2973129_+	pirin family protein	NA	NA	NA	NA	NA
AZT33755.1|2973148_2973826_+	hydrolase	NA	NA	NA	NA	NA
AZT33756.1|2974162_2975417_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
AZT33757.1|2975725_2976103_+|integrase	integrase	integrase	NA	NA	NA	NA
AZT33758.1|2976264_2976462_+	hypothetical protein	NA	NA	NA	NA	NA
AZT33759.1|2976672_2978949_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
2977603:2977619	attR	CAGCGTATCGCGATCGC	NA	NA	NA	NA
AZT33760.1|2978979_2979300_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AZT33761.1|2979623_2979845_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AZT33762.1|2979974_2981921_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
AZT33763.1|2981917_2983036_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 8
CP034700	Salmonella enterica subsp. enterica serovar Stanleyville strain RSE39 chromosome, complete genome	4689404	3605805	3633939	4689404	plate,transposase	Vibrio_phage(14.29%)	30	NA	NA
AZT34279.1|3605805_3607149_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AZT34280.1|3607152_3607689_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AZT34281.1|3607755_3608241_-	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
AZT34282.1|3608383_3608767_-	hypothetical protein	NA	NA	NA	NA	NA
AZT34283.1|3608751_3609237_-	hypothetical protein	NA	NA	NA	NA	NA
AZT34284.1|3609539_3610025_-	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
AZT35290.1|3610278_3610611_-	hypothetical protein	NA	NA	NA	NA	NA
AZT34285.1|3610737_3610848_-	hypothetical protein	NA	NA	NA	NA	NA
AZT34286.1|3610910_3612419_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AZT34287.1|3612442_3612985_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AZT34288.1|3613084_3615724_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.7	6.7e-78
AZT34289.1|3616091_3616994_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
AZT34290.1|3616980_3617805_+	impE family protein	NA	NA	NA	NA	NA
AZT34291.1|3617801_3618296_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AZT34292.1|3618311_3620195_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AZT34293.1|3620191_3621187_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AZT34294.1|3621197_3622253_+	cytoplasmic protein	NA	NA	NA	NA	NA
AZT34295.1|3622782_3623514_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
AZT34296.1|3623577_3624045_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
AZT34297.1|3624041_3624764_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZT34298.1|3624798_3625554_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AZT34299.1|3625625_3626993_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
AZT34300.1|3627048_3627819_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZT34301.1|3627896_3628697_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AZT34302.1|3628828_3630004_-	MFS transporter	NA	NA	NA	NA	NA
AZT34303.1|3630108_3631023_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZT34304.1|3631044_3631848_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	3.2e-39
AZT34305.1|3632084_3632543_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	7.7e-14
AZT35291.1|3632499_3632736_-	hypothetical protein	NA	NA	NA	NA	NA
AZT34306.1|3632683_3633939_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
