The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034719	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 chromosome, complete genome	4766197	1210057	1299385	4766197	terminase,lysis,capsid,integrase,tail,holin,tRNA,transposase,head,portal	Salmonella_phage(36.21%)	99	1216325:1216341	1305232:1305248
AZT58727.1|1210057_1210516_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
1216325:1216341	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
AZT58728.1|1216459_1216915_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
AZT58729.1|1217018_1218320_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
AZT58730.1|1218316_1218640_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
AZT61987.1|1218684_1220040_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AZT58731.1|1220154_1222815_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AZT58732.1|1222868_1223549_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AZT58733.1|1223621_1224041_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
AZT58734.1|1224244_1225282_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AZT58735.1|1225397_1226087_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AZT58736.1|1226405_1226789_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
AZT58737.1|1226850_1227438_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
AZT58738.1|1227540_1228440_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZT58739.1|1228457_1229792_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AZT58740.1|1229922_1230660_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
AZT58741.1|1230644_1232267_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AZT58742.1|1232351_1232531_+	hypothetical protein	NA	NA	NA	NA	NA
AZT58743.1|1232530_1232695_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
AZT58744.1|1232691_1233267_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
AZT58745.1|1233298_1233949_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AZT58746.1|1233948_1234905_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AZT58747.1|1234901_1235381_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
AZT61988.1|1235410_1235527_+	transcriptional regulator	NA	NA	NA	NA	NA
AZT58748.1|1235878_1237108_+	DUF4102 domain-containing protein	NA	H6WRW7	Salmonella_phage	93.9	5.4e-232
AZT58749.1|1237085_1237370_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
AZT58750.1|1237410_1237650_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AZT58751.1|1237692_1238850_-	enterohemolysin	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
AZT58752.1|1238812_1241740_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	98.2	0.0e+00
AZT58753.1|1241866_1242217_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
AZT58754.1|1242238_1242397_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
AZT58755.1|1242750_1243446_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
AZT58756.1|1243419_1243605_+	amino acid permease	NA	NA	NA	NA	NA
AZT58757.1|1243543_1243768_+	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AZT58758.1|1243796_1244351_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	1.5e-101
AZT58759.1|1244347_1245490_+	peptidase	NA	A0A1C9IHV9	Salmonella_phage	97.9	2.3e-208
AZT58760.1|1245486_1245711_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AZT58761.1|1245707_1246667_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.2e-117
AZT58762.1|1246668_1247151_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.1	6.0e-86
AZT58763.1|1248039_1248429_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	1.6e-68
AZT58764.1|1248445_1249306_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.3	9.2e-162
AZT58765.1|1249313_1250303_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	3.5e-189
AZT58766.1|1250317_1250896_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	1.1e-49
AZT58767.1|1251096_1251822_+	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	66.2	4.0e-81
AZT58768.1|1251954_1252380_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
AZT58769.1|1252660_1252852_-	hypothetical protein	NA	NA	NA	NA	NA
AZT58770.1|1252906_1253095_+	hypothetical protein	NA	NA	NA	NA	NA
AZT58771.1|1253184_1253574_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	72.5	2.8e-41
AZT58772.1|1253560_1253842_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AZT58773.1|1253841_1254456_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.6	2.2e-109
AZT61989.1|1254488_1254935_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	83.9	9.3e-57
AZT58774.1|1255262_1255766_+	hypothetical protein	NA	NA	NA	NA	NA
AZT58775.1|1256022_1256424_-	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AZT58776.1|1256709_1257255_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
AZT58777.1|1257226_1259158_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
AZT58778.1|1259141_1259345_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
AZT58779.1|1259341_1260922_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.6	8.1e-188
AZT58780.1|1260911_1262408_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.1e-96
AZT58781.1|1262420_1262768_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
AZT58782.1|1262822_1263851_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.3e-114
AZT58783.1|1263908_1264274_+	DNA packaging protein	NA	NA	NA	NA	NA
AZT58784.1|1264284_1264662_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
AZT58785.1|1264648_1265227_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
AZT58786.1|1265223_1265625_+|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	99.0	4.0e-51
AZT58787.1|1265632_1266379_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
AZT58788.1|1266429_1266825_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
AZT58789.1|1266821_1267160_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AZT58790.1|1267131_1270227_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.7	4.8e-277
AZT58791.1|1270229_1270559_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
AZT58792.1|1270568_1271267_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
AZT58793.1|1271273_1272011_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
AZT58794.1|1271908_1272556_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
AZT58795.1|1272617_1275980_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
AZT58796.1|1276018_1276261_+	hypothetical protein	NA	NA	NA	NA	NA
AZT58797.1|1276314_1278687_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
AZT58798.1|1278683_1279508_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
AZT58799.1|1279497_1280076_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
AZT58800.1|1280172_1280400_-	phage virulence factor	NA	NA	NA	NA	NA
AZT58801.1|1280506_1280719_+	hypothetical protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
AZT61990.1|1280781_1280847_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
AZT58802.1|1281426_1281591_+|integrase	integrase	integrase	NA	NA	NA	NA
AZT58803.1|1281511_1282057_-|transposase	transposase	transposase	NA	NA	NA	NA
AZT58804.1|1282303_1282441_-	hypothetical protein	NA	NA	NA	NA	NA
AZT58805.1|1282907_1284401_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
AZT58806.1|1284805_1286605_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
AZT58807.1|1286621_1287596_+	signal peptidase I	NA	NA	NA	NA	NA
AZT58808.1|1287869_1288550_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
AZT58809.1|1288546_1289452_+	GTPase Era	NA	NA	NA	NA	NA
AZT58810.1|1289463_1290192_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AZT58811.1|1290203_1290935_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AZT58812.1|1290934_1291315_+	holo-ACP synthase	NA	NA	NA	NA	NA
AZT58813.1|1291426_1291687_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
AZT58814.1|1291724_1292651_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
AZT58815.1|1292766_1293963_+	MFS transporter	NA	NA	NA	NA	NA
AZT58816.1|1293984_1294902_+	oxidoreductase	NA	NA	NA	NA	NA
AZT58817.1|1294940_1295789_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AZT58818.1|1295904_1296798_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AZT58819.1|1296808_1298170_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AZT58820.1|1298173_1298809_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AZT58821.1|1298833_1299385_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1305232:1305248	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 2
CP034719	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 chromosome, complete genome	4766197	1669376	1735772	4766197	lysis,holin,tail	Salmonella_phage(28.57%)	60	NA	NA
AZT59132.1|1669376_1670168_+|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
AZT59133.1|1670464_1670668_+|tail	phage tail protein	tail	NA	NA	NA	NA
AZT59134.1|1670836_1673203_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
AZT59135.1|1673531_1674521_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
AZT59136.1|1674535_1674904_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
AZT59137.1|1674932_1676264_-	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
AZT59138.1|1676560_1676890_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
AZT59139.1|1677482_1678724_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
AZT59140.1|1678726_1679254_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
AZT59141.1|1679631_1680075_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
AZT59142.1|1680128_1681958_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
AZT59143.1|1682305_1682596_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
AZT59144.1|1682623_1683127_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
AZT59145.1|1683407_1685168_-	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
AZT59146.1|1685199_1685427_-	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
AZT59147.1|1685606_1686614_+	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
AZT59148.1|1686641_1687262_+	hypothetical protein	NA	NA	NA	NA	NA
AZT59149.1|1687370_1687655_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AZT59150.1|1687779_1689540_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
AZT59151.1|1689691_1690387_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AZT59152.1|1690414_1691605_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
AZT59153.1|1691995_1692340_+	hypothetical protein	NA	NA	NA	NA	NA
AZT59154.1|1692343_1693933_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
AZT59155.1|1693934_1694960_-	ABC transporter permease	NA	NA	NA	NA	NA
AZT59156.1|1694959_1696054_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
AZT59157.1|1696063_1697869_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZT59158.1|1697975_1699532_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
AZT59159.1|1699857_1700430_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
AZT59160.1|1700843_1701563_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AZT59161.1|1701592_1702579_-	GTP-binding protein	NA	NA	NA	NA	NA
AZT59162.1|1702791_1703364_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
AZT59163.1|1703687_1703942_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AZT59164.1|1704329_1704452_+	hypothetical protein	NA	NA	NA	NA	NA
AZT59165.1|1704453_1705119_+	hypothetical protein	NA	NA	NA	NA	NA
AZT59166.1|1705183_1706365_-	sugar efflux transporter SetB	NA	NA	NA	NA	NA
AZT59167.1|1706733_1707864_+	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
AZT59168.1|1707863_1708802_+	1-phosphofructokinase	NA	NA	NA	NA	NA
AZT59169.1|1708818_1710507_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
AZT59170.1|1710571_1711429_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
AZT59171.1|1711507_1712557_-	YeiH family protein	NA	NA	NA	NA	NA
AZT59172.1|1712677_1713541_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZT59173.1|1713730_1715200_+	amino acid permease	NA	NA	NA	NA	NA
AZT59174.1|1715545_1717537_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
AZT59175.1|1717580_1718903_-	MFS transporter	NA	NA	NA	NA	NA
AZT59176.1|1718935_1719823_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
AZT59177.1|1720039_1721407_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AZT59178.1|1721411_1721801_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZT59179.1|1721789_1722647_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZT59180.1|1722976_1723645_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
AZT59181.1|1723659_1724802_+	DUF418 family protein	NA	NA	NA	NA	NA
AZT59182.1|1724951_1725974_+	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
AZT59183.1|1726472_1727471_+	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
AZT59184.1|1727604_1729125_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
AZT59185.1|1729140_1730151_+	galactoside ABC transporter permease	NA	NA	NA	NA	NA
AZT59186.1|1730225_1731461_-	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
AZT59187.1|1731454_1732696_-	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
AZT59188.1|1732900_1733146_-	DUF2542 family protein	NA	NA	NA	NA	NA
AZT59189.1|1733142_1733862_-	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
AZT59190.1|1734038_1734923_-	cytidine deaminase	NA	NA	NA	NA	NA
AZT59191.1|1735076_1735772_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
>prophage 3
CP034719	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 chromosome, complete genome	4766197	1755179	1764350	4766197	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AZT59209.1|1755179_1756127_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
AZT59210.1|1756110_1756842_+	ABC transporter permease	NA	NA	NA	NA	NA
AZT59211.1|1756822_1756930_-	protein YohO	NA	NA	NA	NA	NA
AZT59212.1|1756989_1757721_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AZT59213.1|1757943_1759629_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	90.9	1.4e-278
AZT59214.1|1759625_1760345_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AZT59215.1|1760391_1760859_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AZT59216.1|1760915_1761446_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AZT59217.1|1761617_1762076_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AZT59218.1|1762316_1764350_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
CP034719	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 chromosome, complete genome	4766197	1832658	1843164	4766197		Enterobacteria_phage(37.5%)	10	NA	NA
AZT59272.1|1832658_1834062_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
AZT59273.1|1834239_1835133_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AZT59274.1|1835509_1836595_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
AZT59275.1|1836594_1837494_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
AZT62011.1|1837541_1838420_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
AZT59276.1|1838420_1838972_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
AZT59277.1|1838977_1839970_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AZT59278.1|1839966_1840740_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZT59279.1|1840744_1841824_+	CDP-glucose 4,6-dehydratase	NA	A0A0P0YNH4	Yellowstone_lake_phycodnavirus	23.1	2.3e-08
AZT59280.1|1841850_1843164_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
CP034719	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 chromosome, complete genome	4766197	1929870	1940473	4766197		Morganella_phage(25.0%)	13	NA	NA
AZT59361.1|1929870_1930344_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
AZT59362.1|1930991_1931282_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
AZT59363.1|1931653_1932451_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
AZT59364.1|1932711_1932954_+	hypothetical protein	NA	NA	NA	NA	NA
AZT59365.1|1932931_1933093_+	hypothetical protein	NA	NA	NA	NA	NA
AZT59366.1|1933219_1933639_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AZT59367.1|1933641_1934910_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
AZT59368.1|1935364_1935577_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AZT62019.1|1935587_1935776_+	cold-shock protein	NA	NA	NA	NA	NA
AZT59369.1|1936036_1937233_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
AZT59370.1|1937882_1938182_+	hypothetical protein	NA	NA	NA	NA	NA
AZT59371.1|1938273_1938969_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AZT59372.1|1939042_1940473_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
CP034719	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 chromosome, complete genome	4766197	2044517	2051326	4766197	integrase,tail	Salmonella_phage(33.33%)	11	2046727:2046749	2056442:2056464
AZT59478.1|2044517_2044748_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
AZT59479.1|2044885_2045260_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AZT59480.1|2045260_2046136_+	copper resistance D family protein	NA	NA	NA	NA	NA
AZT59481.1|2046152_2046506_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
2046727:2046749	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
AZT62025.1|2046879_2047734_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
AZT62026.1|2047793_2048288_-	RecE	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
AZT59482.1|2048477_2048708_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
AZT59483.1|2048761_2049295_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
AZT59484.1|2049551_2049719_-	lytic enzyme	NA	NA	NA	NA	NA
AZT59485.1|2049783_2049972_-	hypothetical protein	NA	NA	NA	NA	NA
AZT62027.1|2050444_2051326_+|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2056442:2056464	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 7
CP034719	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 chromosome, complete genome	4766197	2839658	2924435	4766197	terminase,lysis,tail,holin,protease,tRNA,portal	Salmonella_phage(44.44%)	92	NA	NA
AZT60265.1|2839658_2840339_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
AZT60266.1|2840959_2841619_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
AZT60267.1|2841705_2842035_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AZT60268.1|2842031_2842313_-	acylphosphatase	NA	NA	NA	NA	NA
AZT60269.1|2842361_2843141_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZT60270.1|2843166_2843715_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AZT60271.1|2843929_2845141_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
AZT60272.1|2845198_2845516_+	heat-shock protein HspQ	NA	NA	NA	NA	NA
AZT60273.1|2845560_2845977_-	CoA-binding protein	NA	NA	NA	NA	NA
AZT60274.1|2846147_2846810_+	DUF2057 family protein	NA	NA	NA	NA	NA
AZT60275.1|2846904_2847363_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AZT60276.1|2847398_2849453_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
AZT60277.1|2849576_2850023_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AZT60278.1|2850041_2852195_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AZT60279.1|2852181_2852787_-	TfoX family DNA transformation protein	NA	NA	NA	NA	NA
AZT60280.1|2853003_2853513_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AZT60281.1|2853869_2854922_+	porin OmpA	NA	NA	NA	NA	NA
AZT60282.1|2854993_2855446_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
AZT60283.1|2855631_2857392_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AZT60284.1|2857460_2857979_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
AZT60285.1|2858078_2858246_-	ribosome modulation factor	NA	NA	NA	NA	NA
AZT60286.1|2858501_2859065_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AZT60287.1|2859061_2860702_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AZT60288.1|2860706_2861960_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
AZT60289.1|2861974_2863882_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
AZT60290.1|2863894_2866003_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AZT60291.1|2866101_2867211_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AZT60292.1|2867207_2867750_-	cell division protein ZapC	NA	NA	NA	NA	NA
AZT60293.1|2867915_2868926_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AZT60294.1|2869133_2871746_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
AZT62057.1|2872172_2872364_+	DinI family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
AZT60295.1|2872634_2873321_+	virulence protein	NA	NA	NA	NA	NA
AZT60296.1|2873305_2873605_+	hypothetical protein	NA	NA	NA	NA	NA
AZT60297.1|2873673_2874300_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AZT60298.1|2874947_2875916_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
AZT60299.1|2876391_2876973_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AZT60300.1|2876972_2879411_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	6.4e-91
AZT60301.1|2879464_2879707_-	hypothetical protein	NA	NA	NA	NA	NA
AZT60302.1|2879745_2883096_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
AZT60303.1|2883167_2883872_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
AZT60304.1|2883769_2884507_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
AZT60305.1|2884516_2885212_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.2	6.5e-89
AZT60306.1|2885301_2885835_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AZT60307.1|2885951_2886449_-	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
AZT60308.1|2886547_2886880_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
AZT62058.1|2886876_2889864_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
AZT60309.1|2889943_2890273_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AZT60310.1|2890269_2890668_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AZT60311.1|2890713_2891463_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
AZT60312.1|2891474_2891876_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
AZT60313.1|2891872_2892439_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
AZT60314.1|2892419_2892719_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AZT60315.1|2892711_2893035_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AZT62060.1|2893125_2895207_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
AZT62059.1|2895130_2896648_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
AZT60316.1|2896674_2896881_-	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AZT62061.1|2896877_2899016_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
AZT60317.1|2898972_2899506_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
AZT60318.1|2899713_2900193_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AZT60319.1|2900210_2900663_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AZT62062.1|2900646_2900976_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AZT60320.1|2901251_2901938_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
AZT60321.1|2902298_2902748_+	hypothetical protein	NA	NA	NA	NA	NA
AZT60322.1|2902883_2903009_-	hypothetical protein	NA	NA	NA	NA	NA
AZT60323.1|2903182_2903500_-	hypothetical protein	NA	NA	NA	NA	NA
AZT60324.1|2903566_2904364_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
AZT60325.1|2904353_2904500_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AZT60326.1|2904496_2905108_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
AZT62063.1|2905110_2905317_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AZT60327.1|2906001_2906223_-	hypothetical protein	NA	NA	NA	NA	NA
AZT60328.1|2906334_2906568_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
AZT60329.1|2906859_2907150_-	hypothetical protein	NA	NA	NA	NA	NA
AZT60330.1|2907227_2907539_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
AZT60331.1|2907535_2907883_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
AZT60332.1|2907893_2908643_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AZT60333.1|2908645_2909629_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
AZT60334.1|2909713_2910088_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AZT60335.1|2910053_2910293_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
AZT62064.1|2910412_2910823_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
AZT60336.1|2910872_2911133_+	hypothetical protein	NA	NA	NA	NA	NA
AZT60337.1|2911125_2911284_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
AZT60338.1|2911305_2911605_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
AZT60339.1|2911731_2914659_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	98.2	0.0e+00
AZT60340.1|2914621_2915779_+	enterohemolysin	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
AZT60341.1|2915821_2916061_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AZT60342.1|2916101_2916350_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AZT60343.1|2916394_2917687_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
AZT60344.1|2917881_2919084_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AZT60345.1|2920841_2922056_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
AZT60346.1|2922142_2922376_+	hypothetical protein	NA	NA	NA	NA	NA
AZT60347.1|2922372_2922834_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZT60348.1|2923034_2924435_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
>prophage 8
CP034719	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 chromosome, complete genome	4766197	2988720	2995734	4766197	transposase,protease	Helicobacter_phage(16.67%)	7	NA	NA
AZT60398.1|2988720_2989179_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
AZT60399.1|2989135_2989318_-	hypothetical protein	NA	NA	NA	NA	NA
AZT60400.1|2989370_2991647_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AZT60401.1|2991677_2991998_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AZT60402.1|2992321_2992543_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AZT60403.1|2992672_2994619_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
AZT60404.1|2994615_2995734_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 9
CP034719	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 chromosome, complete genome	4766197	4345668	4392711	4766197	tRNA,plate,tail	Burkholderia_phage(42.86%)	49	NA	NA
AZT61588.1|4345668_4346667_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AZT61589.1|4346754_4348065_-	conjugal transfer protein	NA	NA	NA	NA	NA
AZT61590.1|4348311_4348827_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
AZT62119.1|4348925_4349135_-	CsbD family protein	NA	NA	NA	NA	NA
AZT61591.1|4349156_4349270_-	hypothetical protein	NA	NA	NA	NA	NA
AZT61592.1|4349266_4350592_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
AZT61593.1|4350770_4351379_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AZT61594.1|4351487_4351856_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AZT61595.1|4352026_4354447_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AZT61596.1|4354545_4355418_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AZT61597.1|4355431_4355929_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AZT61598.1|4356109_4357027_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AZT61599.1|4357190_4358549_-	maltoporin	NA	NA	NA	NA	NA
AZT61600.1|4358637_4359747_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AZT61601.1|4360108_4361299_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AZT61602.1|4361430_4362975_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AZT61603.1|4362989_4363880_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AZT61604.1|4364045_4364456_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AZT61605.1|4364598_4366695_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AZT61606.1|4366694_4367432_-	hypothetical protein	NA	NA	NA	NA	NA
AZT61607.1|4367428_4368097_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AZT62120.1|4368130_4368373_-	outer membrane protein	NA	NA	NA	NA	NA
AZT61608.1|4368816_4370466_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AZT61609.1|4370810_4372160_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AZT61610.1|4372292_4372640_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
AZT61611.1|4373215_4373503_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
AZT61612.1|4373505_4374111_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
AZT61613.1|4374123_4374438_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AZT61614.1|4374597_4375053_+	hypothetical protein	NA	NA	NA	NA	NA
AZT61615.1|4375049_4375247_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AZT61616.1|4375236_4376664_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
AZT61617.1|4376663_4377188_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AZT61618.1|4377239_4377557_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZT61619.1|4377516_4377645_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZT61620.1|4377741_4380096_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
AZT61621.1|4381047_4381257_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AZT61622.1|4381244_4382288_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
AZT61623.1|4382297_4383020_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
AZT61624.1|4383347_4383710_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
AZT61625.1|4383706_4384636_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
AZT61626.1|4384635_4386183_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
AZT61627.1|4386346_4386706_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AZT61628.1|4386696_4387812_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
AZT61629.1|4387804_4388437_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
AZT61630.1|4388439_4390185_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
AZT61631.1|4390189_4390795_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AZT61632.1|4390791_4391247_+	hypothetical protein	NA	NA	NA	NA	NA
AZT61633.1|4391495_4391786_+	hypothetical protein	NA	NA	NA	NA	NA
AZT61634.1|4391982_4392711_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
CP034720	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 plasmid pRSE04, complete sequence	93964	0	12622	93964		Enterobacteria_phage(100.0%)	12	NA	NA
AZT62137.1|2600_2801_+	hypothetical protein	NA	NA	NA	NA	NA
AZT62138.1|2949_3252_+	transcriptional regulator	NA	NA	NA	NA	NA
AZT62139.1|3526_4045_+	fimbrial protein	NA	NA	NA	NA	NA
AZT62140.1|4272_6681_+	outer membrane usher protein PefC	NA	NA	NA	NA	NA
AZT62141.1|6673_7366_+	fimbrial chaperone	NA	NA	NA	NA	NA
AZT62142.1|7380_7938_+	hypothetical protein	NA	NA	NA	NA	NA
AZT62143.1|8190_9066_+	hypothetical protein	NA	NA	NA	NA	NA
AZT62144.1|9497_9710_+	regulator	NA	NA	NA	NA	NA
AZT62145.1|9694_10045_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AZT62146.1|10289_10943_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AZT62147.1|11075_11975_+	hypothetical protein	NA	NA	NA	NA	NA
AZT62148.1|12064_12622_+	hypothetical protein	NA	Q9EV15	Enterobacteria_phage	38.5	4.5e-24
>prophage 2
CP034720	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 plasmid pRSE04, complete sequence	93964	18251	18992	93964		Xanthomonas_phage(100.0%)	1	NA	NA
AZT62156.1|18251_18992_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	3.9e-07
>prophage 3
CP034720	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 plasmid pRSE04, complete sequence	93964	36916	37336	93964		Salmonella_phage(100.0%)	1	NA	NA
AZT62169.1|36916_37336_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	88.9	2.2e-68
>prophage 4
CP034720	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 plasmid pRSE04, complete sequence	93964	43805	44027	93964		Vibrio_virus(100.0%)	1	NA	NA
AZT62178.1|43805_44027_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	42.3	1.0e-08
>prophage 5
CP034720	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 plasmid pRSE04, complete sequence	93964	54260	58226	93964		Emiliania_huxleyi_virus(33.33%)	6	NA	NA
AZT62193.1|54260_56258_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.0	5.5e-16
AZT62194.1|56326_56569_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AZT62195.1|56623_57142_-	single-stranded DNA-binding protein SSB2	NA	A0A0A0P1Q9	Enterobacteria_phage	82.5	6.8e-51
AZT62196.1|57172_57301_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AZT62197.1|57735_57939_-	hypothetical protein	NA	NA	NA	NA	NA
AZT62198.1|57902_58226_-	hypothetical protein	NA	G8C7V1	Escherichia_phage	56.5	2.0e-13
>prophage 6
CP034720	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 plasmid pRSE04, complete sequence	93964	61418	70714	93964	transposase	Escherichia_phage(28.57%)	12	NA	NA
AZT62204.1|61418_62099_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
AZT62240.1|62243_62432_-	hypothetical protein	NA	NA	NA	NA	NA
AZT62205.1|62480_62837_-	hypothetical protein	NA	NA	NA	NA	NA
AZT62206.1|62829_63300_-	hypothetical protein	NA	NA	NA	NA	NA
AZT62207.1|63810_64233_+	protein SamA	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
AZT62208.1|64232_65507_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
AZT62209.1|65588_66566_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
AZT62210.1|66562_67768_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
AZT62211.1|68182_69124_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
AZT62212.1|69155_69722_-	DUF2913 family protein	NA	NA	NA	NA	NA
AZT62242.1|69778_70114_-	hypothetical protein	NA	NA	NA	NA	NA
AZT62241.1|70297_70714_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
>prophage 7
CP034720	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 plasmid pRSE04, complete sequence	93964	74263	74824	93964		Ralstonia_phage(100.0%)	1	NA	NA
AZT62216.1|74263_74824_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	42.7	1.3e-31
>prophage 8
CP034720	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 plasmid pRSE04, complete sequence	93964	80331	80496	93964		Salmonella_phage(100.0%)	1	NA	NA
AZT62221.1|80331_80496_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
>prophage 9
CP034720	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 plasmid pRSE04, complete sequence	93964	85918	86269	93964	transposase	Escherichia_phage(100.0%)	1	NA	NA
AZT62226.1|85918_86269_+|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
>prophage 10
CP034720	Salmonella enterica subsp. enterica serovar Typhimurium strain RSE04 plasmid pRSE04, complete sequence	93964	89329	90112	93964	integrase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
AZT62231.1|89329_90112_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
