The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034689	Achromobacter spanius strain UQ283 chromosome, complete genome	6687823	1966702	2001688	6687823	portal,head,integrase,tail,protease,capsid,terminase	Pseudomonas_phage(16.67%)	40	1968212:1968258	2009728:2009774
AZS78558.1|1966702_1967383_+	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	27.3	9.0e-19
AZS78559.1|1967740_1968013_+	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	57.8	1.1e-20
1968212:1968258	attL	CCCTTACAAGGCGTAGGTCACAGGTTCGACCCCTGTAGCACCCACCA	NA	NA	NA	NA
AZS78560.1|1968429_1969545_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	27.4	1.6e-20
AZS78561.1|1969839_1971186_-	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	46.8	2.9e-37
AZS78562.1|1971182_1971506_-	hypothetical protein	NA	NA	NA	NA	NA
AZS78563.1|1971512_1971794_-	DUF4884 domain-containing protein	NA	NA	NA	NA	NA
AZS82534.1|1971781_1972150_-	hypothetical protein	NA	A0A248SL53	Klebsiella_phage	42.9	7.8e-17
AZS78564.1|1972320_1972839_-	hypothetical protein	NA	A0A2H4J7V6	uncultured_Caudovirales_phage	40.5	4.6e-07
AZS78565.1|1972922_1973597_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78566.1|1973645_1974422_-	ParB/RepB/Spo0J family partition protein	NA	C7BGF1	Burkholderia_phage	64.2	1.8e-84
AZS78567.1|1974438_1975338_-	recombination-associated protein RdgC	NA	B5AX95	Iodobacteriophage	32.7	4.8e-36
AZS78568.1|1975493_1975727_-	hypothetical protein	NA	NA	NA	NA	NA
AZS78569.1|1975723_1976263_-	hypothetical protein	NA	W8VMA8	Pseudomonas_phage	28.1	8.7e-09
AZS78570.1|1976952_1977642_+	hypothetical protein	NA	NA	NA	NA	NA
AZS82535.1|1978087_1978687_-	S24 family peptidase	NA	NA	NA	NA	NA
AZS78571.1|1979254_1979527_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78572.1|1979728_1980244_+	hypothetical protein	NA	B7SYH6	Stenotrophomonas_phage	40.5	5.6e-29
AZS78573.1|1980237_1980543_+	hypothetical protein	NA	A0A1J0GUZ1	Halomonas_phage	36.7	3.0e-06
AZS78574.1|1980535_1980841_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78575.1|1980831_1981332_+	DUF1364 family protein	NA	NA	NA	NA	NA
AZS78576.1|1981328_1982153_+	helix-turn-helix domain-containing protein	NA	A0A0U4IBP5	Pseudomonas_phage	62.9	2.9e-27
AZS78577.1|1982149_1983514_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	41.3	3.0e-74
AZS78578.1|1983723_1984137_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78579.1|1984136_1984778_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78580.1|1985243_1985828_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
AZS78581.1|1986555_1986936_+	HNH endonuclease	NA	A0A0R6PJG8	Moraxella_phage	51.8	4.8e-22
AZS78582.1|1987145_1987628_+|terminase	phage terminase small subunit P27 family	terminase	A4JWZ6	Burkholderia_virus	62.0	3.0e-53
AZS78583.1|1987631_1989356_+|terminase	terminase large subunit	terminase	A4JWZ7	Burkholderia_virus	80.1	2.1e-274
AZS78584.1|1989509_1990739_+|portal	phage portal protein	portal	A0A1J0GUY8	Halomonas_phage	66.9	1.7e-156
AZS78585.1|1990747_1991374_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0GUZ0	Halomonas_phage	64.5	1.1e-63
AZS78586.1|1991385_1992609_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	62.4	3.5e-138
AZS78587.1|1992650_1992971_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1J0GUX7	Halomonas_phage	40.9	7.7e-13
AZS78588.1|1992979_1993312_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AZS78589.1|1993315_1993810_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
AZS78590.1|1993802_1994156_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AZS78591.1|1994152_1994593_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78592.1|1994697_1995348_+|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	54.9	9.1e-61
AZS78593.1|1995421_1995739_+	hypothetical protein	NA	A0A0S2SYT8	Pseudomonas_phage	42.9	9.9e-21
AZS78594.1|1995735_1996047_+	hypothetical protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	44.0	2.0e-13
AZS78595.1|1996081_2001688_+|tail	phage tail protein	tail	A0A1V0E8B0	Vibrio_phage	42.1	5.1e-67
2009728:2009774	attR	CCCTTACAAGGCGTAGGTCACAGGTTCGACCCCTGTAGCACCCACCA	NA	NA	NA	NA
>prophage 2
CP034689	Achromobacter spanius strain UQ283 chromosome, complete genome	6687823	2176698	2238960	6687823	tRNA,transposase,integrase,protease,terminase	Vibrio_phage(13.33%)	74	2168886:2168904	2204382:2204400
2168886:2168904	attL	ACCTGATCGACCGCCACGC	NA	NA	NA	NA
AZS78732.1|2176698_2177985_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AZS78733.1|2177988_2178627_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AZS78734.1|2178632_2179790_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AZS78735.1|2179815_2181168_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AZS78736.1|2181171_2182245_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AZS78737.1|2182402_2182639_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AZS78738.1|2182723_2183830_+	GTPase HflX	NA	NA	NA	NA	NA
AZS78739.1|2183795_2185100_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
AZS78740.1|2185118_2186024_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
AZS78741.1|2186289_2187447_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
AZS78742.1|2187511_2188819_+	adenylosuccinate synthase	NA	A0A0B5J049	Pandoravirus	31.8	6.9e-60
AZS78743.1|2188900_2189443_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
AZS78744.1|2189826_2190039_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AZS78745.1|2190058_2192119_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	42.6	1.0e-65
AZS78746.1|2192851_2195131_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.1	4.2e-36
AZS82547.1|2195245_2195794_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AZS78747.1|2195951_2197063_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.1	2.5e-42
AZS78748.1|2197208_2197622_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78749.1|2197632_2199414_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZS78750.1|2199470_2199779_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78751.1|2199780_2200059_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78752.1|2200055_2200556_+	hypothetical protein	NA	I6NSS1	Burkholderia_phage	54.9	1.8e-40
AZS78753.1|2200552_2200972_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78754.1|2201077_2201296_-	hypothetical protein	NA	NA	NA	NA	NA
AZS78755.1|2201766_2201931_-	2'-5' RNA ligase	NA	NA	NA	NA	NA
AZS78756.1|2202757_2203726_-|integrase	integrase	integrase	A0A2H4J8E5	uncultured_Caudovirales_phage	43.2	5.3e-65
AZS78757.1|2203652_2203883_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AZS78758.1|2203965_2204304_-	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	40.5	3.4e-11
AZS78759.1|2204290_2204473_-	hypothetical protein	NA	NA	NA	NA	NA
2204382:2204400	attR	GCGTGGCGGTCGATCAGGT	NA	NA	NA	NA
AZS78760.1|2204469_2205180_-	hypothetical protein	NA	A0A1I9KFE6	Aeromonas_phage	68.2	1.6e-10
AZS78761.1|2205172_2205778_-	hypothetical protein	NA	NA	NA	NA	NA
AZS78762.1|2205774_2206863_-	hypothetical protein	NA	A1YZU8	Burkholderia_virus	44.7	2.3e-08
AZS78763.1|2207070_2207448_-	hypothetical protein	NA	NA	NA	NA	NA
AZS78764.1|2207674_2208169_-	siphovirus Gp157 family protein	NA	Q9T0Y7	Lactobacillus_phage	28.7	1.2e-09
AZS78765.1|2208177_2208795_-	hypothetical protein	NA	NA	NA	NA	NA
AZS78766.1|2208800_2209247_-	hypothetical protein	NA	Q9MC50	Pseudomonas_phage	43.3	2.0e-27
AZS78767.1|2209407_2210058_-	ATP-binding protein	NA	A0A059VF62	Pseudomonas_phage	47.2	1.8e-48
AZS78768.1|2210327_2210819_-	HNH endonuclease	NA	Q2NPG0	Xanthomonas_virus	48.7	6.5e-35
AZS78769.1|2210833_2211163_-	hypothetical protein	NA	NA	NA	NA	NA
AZS78770.1|2211146_2211578_-	hypothetical protein	NA	NA	NA	NA	NA
AZS78771.1|2211574_2211796_-	hypothetical protein	NA	NA	NA	NA	NA
AZS78772.1|2212074_2212362_-	hypothetical protein	NA	NA	NA	NA	NA
AZS78773.1|2212404_2212740_-	hypothetical protein	NA	NA	NA	NA	NA
AZS78774.1|2212799_2213222_-	hypothetical protein	NA	NA	NA	NA	NA
AZS78775.1|2213392_2213719_-	hypothetical protein	NA	C9DGI1	Deftia_phage	49.5	3.1e-17
AZS78776.1|2214129_2214594_-	hypothetical protein	NA	NA	NA	NA	NA
AZS78777.1|2215296_2215548_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78778.1|2216159_2216468_+	DNA-binding protein	NA	A0A1S5NNI6	Burkholderia_phage	50.0	2.7e-15
AZS78779.1|2216469_2216883_+	hypothetical protein	NA	A0A1B0VMG4	Pseudomonas_phage	46.7	4.6e-18
AZS78780.1|2216879_2217224_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78781.1|2217220_2217940_+	DUF1376 domain-containing protein	NA	A0A2I7RGZ2	Vibrio_phage	32.2	5.8e-08
AZS78782.1|2217936_2218299_+	hypothetical protein	NA	NA	NA	NA	NA
AZS82548.1|2218313_2219240_+	hypothetical protein	NA	A0A2R4ALE6	Vibrio_phage	41.2	3.4e-53
AZS78783.1|2219242_2219608_+	hypothetical protein	NA	NA	NA	NA	NA
AZS82549.1|2219832_2220240_+	hypothetical protein	NA	R9ZZU8	Cellulophaga_phage	60.6	2.3e-30
AZS78784.1|2220534_2220921_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78785.1|2221400_2221688_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78786.1|2221684_2222914_+|terminase	PBSX family phage terminase large subunit	terminase	L7TKU1	Rhizobium_phage	48.1	1.3e-111
AZS78787.1|2222916_2225070_+	hypothetical protein	NA	A0A0E3GMB1	Rhodoferax_phage	36.8	3.9e-92
AZS78788.1|2225120_2225846_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78789.1|2225855_2227097_+	hypothetical protein	NA	A0A1B1IR95	uncultured_Mediterranean_phage	40.5	1.1e-75
AZS78790.1|2227154_2227394_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78791.1|2227377_2228073_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78792.1|2228069_2229506_+	hypothetical protein	NA	A0A0E3JSB2	Rhodoferax_phage	46.4	3.3e-111
AZS78793.1|2229505_2229874_+	hypothetical protein	NA	U6C692	Ralstonia_phage	46.5	3.3e-07
AZS78794.1|2229887_2230490_+	aspartyl beta-hydroxylase	NA	NA	NA	NA	NA
AZS78795.1|2230492_2230948_+	hypothetical protein	NA	A0A2I7S0B0	Vibrio_phage	29.9	1.9e-12
AZS78796.1|2231003_2232026_+	hypothetical protein	NA	A0A0E3GMA9	Rhodoferax_phage	40.6	1.4e-07
AZS78797.1|2232037_2233348_+	hypothetical protein	NA	A0A0E3JI98	Rhodoferax_phage	29.3	1.4e-20
AZS78798.1|2233350_2235900_+	hypothetical protein	NA	H9C1A7	Pectobacterium_phage	57.0	1.0e-35
AZS78799.1|2236035_2237457_+	hypothetical protein	NA	A0A0K0KWC8	Prochlorococcus_phage	34.0	1.1e-31
AZS78800.1|2237621_2238326_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
AZS78801.1|2238405_2238687_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78802.1|2238696_2238960_+	hypothetical protein	NA	W6AQP4	Acinetobacter_phage	27.3	3.7e-05
>prophage 3
CP034689	Achromobacter spanius strain UQ283 chromosome, complete genome	6687823	2257303	2278273	6687823	tail,integrase	uncultured_Caudovirales_phage(61.54%)	20	2272714:2272728	2282828:2282842
AZS78836.1|2257303_2258932_+|tail	phage tail protein	tail	A0A2H4J3N6	uncultured_Caudovirales_phage	56.0	2.6e-157
AZS78837.1|2258928_2259162_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78838.1|2259165_2260062_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	35.8	6.7e-30
AZS78839.1|2260248_2261130_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	45.5	9.5e-53
AZS78840.1|2261157_2261616_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78841.1|2261698_2262280_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	45.9	7.6e-43
AZS78842.1|2262279_2264457_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	44.2	2.3e-172
AZS78843.1|2264453_2265374_+	GNAT family N-acetyltransferase	NA	M1E3T3	Enterobacteria_phage	33.3	1.6e-10
AZS78844.1|2265373_2267371_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78845.1|2267483_2269274_+	hypothetical protein	NA	Q6J1R1	Burkholderia_virus	37.0	1.6e-19
AZS78846.1|2269283_2271764_+	hypothetical protein	NA	Q6J1R0	Burkholderia_virus	38.0	1.2e-158
AZS78847.1|2271763_2272129_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	38.8	4.7e-14
AZS78848.1|2272125_2273781_+	transcriptional regulator	NA	A0A2H4JCA3	uncultured_Caudovirales_phage	50.8	9.2e-150
2272714:2272728	attL	GCCGGCGCGGCTTCG	NA	NA	NA	NA
AZS78849.1|2273820_2275044_+	hypothetical protein	NA	Q8HA60	Vibrio_phage	51.5	1.2e-18
AZS78850.1|2275043_2275466_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78851.1|2275462_2275795_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78852.1|2275791_2276010_+	hypothetical protein	NA	NA	NA	NA	NA
AZS82553.1|2275993_2276497_+	lysozyme	NA	Q3HQU9	Burkholderia_phage	66.2	8.9e-56
AZS78853.1|2276493_2276970_+	hypothetical protein	NA	NA	NA	NA	NA
AZS78854.1|2276980_2278273_-|integrase	site-specific integrase	integrase	A0A2H4IYX8	uncultured_Caudovirales_phage	34.5	2.5e-54
2282828:2282842	attR	CGAAGCCGCGCCGGC	NA	NA	NA	NA
>prophage 4
CP034689	Achromobacter spanius strain UQ283 chromosome, complete genome	6687823	3303178	3309967	6687823		uncultured_Caudovirales_phage(83.33%)	8	NA	NA
AZS79633.1|3303178_3304459_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.5	4.4e-168
AZS79634.1|3304471_3304978_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	41.7	6.7e-27
AZS79635.1|3305140_3305467_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZS79636.1|3305463_3306594_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	56.5	2.6e-87
AZS79637.1|3306603_3307029_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	3.6e-50
AZS79638.1|3307037_3308285_+	MFS transporter	NA	NA	NA	NA	NA
AZS82621.1|3308365_3309076_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	75.3	1.3e-92
AZS79639.1|3309151_3309967_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	8.8e-21
>prophage 5
CP034689	Achromobacter spanius strain UQ283 chromosome, complete genome	6687823	4557145	4621689	6687823	portal,head,integrase,tail,protease,capsid,terminase	Pseudomonas_phage(26.67%)	70	4556399:4556415	4618794:4618810
4556399:4556415	attL	AACGCCTGCGGCAAGCG	NA	NA	NA	NA
AZS80663.1|4557145_4558666_-|tail	tail fiber protein	tail	A0A0B5A596	Achromobacter_phage	58.8	6.8e-59
AZS80664.1|4558667_4559558_-	hypothetical protein	NA	NA	NA	NA	NA
AZS80665.1|4559554_4565158_-|tail	phage tail protein	tail	A0A1V1FCQ8	Vibrio_phage	43.2	8.7e-67
AZS80666.1|4565194_4565506_-	hypothetical protein	NA	NA	NA	NA	NA
AZS80667.1|4565502_4565820_-	hypothetical protein	NA	A0A0S2SYT8	Pseudomonas_phage	43.8	2.6e-21
AZS80668.1|4565893_4566544_-|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	54.4	2.6e-60
AZS80669.1|4566648_4567089_-	hypothetical protein	NA	NA	NA	NA	NA
AZS80670.1|4567085_4567439_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AZS80671.1|4567431_4567926_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
AZS80672.1|4567922_4568261_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AZS80673.1|4568257_4568677_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
AZS80674.1|4568679_4569027_-	hypothetical protein	NA	NA	NA	NA	NA
AZS80675.1|4569090_4570329_-|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	49.5	2.6e-101
AZS80676.1|4570397_4571138_-|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	59.1	1.1e-57
AZS80677.1|4571103_4572444_-|portal	phage portal protein	portal	C7BGG8	Burkholderia_phage	37.0	1.3e-56
AZS80678.1|4572443_4574144_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	60.9	2.0e-200
AZS80679.1|4574190_4574511_-	hypothetical protein	NA	Q2NPI9	Xanthomonas_virus	44.7	1.8e-06
AZS80680.1|4574864_4575197_-	HNH endonuclease	NA	NA	NA	NA	NA
AZS80681.1|4575390_4575576_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	45.9	9.0e-06
AZS80682.1|4575645_4576059_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A2H4JFV9	uncultured_Caudovirales_phage	43.1	1.3e-20
AZS80683.1|4576072_4576435_+	response regulator transcription factor	NA	NA	NA	NA	NA
AZS80684.1|4576468_4577239_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	73.8	1.7e-111
AZS80685.1|4577473_4578565_-	(p)ppGpp synthetase	NA	NA	NA	NA	NA
AZS80686.1|4578703_4579297_-	hypothetical protein	NA	NA	NA	NA	NA
AZS80687.1|4579293_4579665_-	hypothetical protein	NA	NA	NA	NA	NA
AZS80688.1|4579675_4580038_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.1	1.7e-24
AZS80689.1|4580073_4580268_-	hypothetical protein	NA	NA	NA	NA	NA
AZS80690.1|4580506_4581370_-	hypothetical protein	NA	A0A0U2BXL1	Paracoccus_phage	33.5	3.8e-14
AZS80691.1|4582902_4583823_-	hypothetical protein	NA	A0A0E3GMA4	Rhodoferax_phage	38.5	5.1e-09
AZS80692.1|4584033_4584240_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZS80693.1|4584313_4585375_+	LexA family transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	46.7	1.2e-06
AZS80694.1|4585591_4585933_+	hypothetical protein	NA	NA	NA	NA	NA
AZS80695.1|4585929_4586706_+	hypothetical protein	NA	NA	NA	NA	NA
AZS80696.1|4586753_4586960_-	hypothetical protein	NA	NA	NA	NA	NA
AZS80697.1|4586958_4587237_+	hypothetical protein	NA	NA	NA	NA	NA
AZS80698.1|4587233_4587728_+	hypothetical protein	NA	NA	NA	NA	NA
AZS80699.1|4587724_4588888_+	hypothetical protein	NA	NA	NA	NA	NA
AZS80700.1|4588945_4589257_+	hypothetical protein	NA	A0A0A7NV51	Enterobacteria_phage	60.0	4.1e-11
AZS80701.1|4589073_4589532_+	DUF4884 domain-containing protein	NA	NA	NA	NA	NA
AZS82712.1|4591315_4593916_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	20.6	6.1e-23
AZS80702.1|4593912_4595106_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AZS80703.1|4595324_4595537_+	endopeptidase	NA	NA	NA	NA	NA
AZS82713.1|4595708_4596839_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AZS80704.1|4597841_4598489_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AZS80705.1|4598561_4599188_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AZS80706.1|4599274_4600126_+	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	35.4	2.7e-36
AZS80707.1|4600310_4600847_+	hypothetical protein	NA	NA	NA	NA	NA
AZS80708.1|4600843_4601608_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AZS80709.1|4601604_4601877_-	hypothetical protein	NA	NA	NA	NA	NA
AZS80710.1|4602107_4602764_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZS80711.1|4602944_4603682_-	transcriptional regulator	NA	NA	NA	NA	NA
AZS80712.1|4605019_4605214_-	hypothetical protein	NA	NA	NA	NA	NA
AZS80713.1|4605867_4606914_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
AZS80714.1|4606915_4607386_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AZS80715.1|4607610_4607877_-	hypothetical protein	NA	NA	NA	NA	NA
AZS80716.1|4607860_4608355_-	hypothetical protein	NA	A0A2H4JFP9	uncultured_Caudovirales_phage	63.7	2.5e-50
AZS80717.1|4608344_4608809_-	hypothetical protein	NA	A0A0A1IVG1	Pseudomonas_phage	35.3	1.2e-09
AZS82714.1|4608938_4609961_+|integrase	site-specific integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	30.9	3.1e-23
AZS80718.1|4609964_4610321_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZS80719.1|4612175_4612841_-	DUF2612 domain-containing protein	NA	A0A0N9SSD8	Pseudomonas_phage	35.6	1.9e-29
AZS80720.1|4612840_4614292_-	hypothetical protein	NA	A0A0N9SH53	Pseudomonas_phage	34.2	2.0e-71
AZS80721.1|4614326_4614731_-	hypothetical protein	NA	E5AGC2	Erwinia_phage	41.1	2.2e-12
AZS80722.1|4614730_4615426_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	32.6	2.9e-12
AZS80723.1|4615422_4616364_-	hypothetical protein	NA	NA	NA	NA	NA
AZS80724.1|4616350_4616683_-	hypothetical protein	NA	A0A0N9SG14	Pseudomonas_phage	38.1	2.6e-11
AZS80725.1|4616679_4617267_-	hypothetical protein	NA	I3PGV3	Xanthomonas_phage	27.5	8.9e-07
AZS80726.1|4617275_4619258_-	hypothetical protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	30.1	4.3e-21
4618794:4618810	attR	CGCTTGCCGCAGGCGTT	NA	NA	NA	NA
AZS80727.1|4619403_4619889_-	hypothetical protein	NA	NA	NA	NA	NA
AZS80728.1|4619888_4620317_-	DUF3277 family protein	NA	NA	NA	NA	NA
AZS80729.1|4620330_4621689_-	DUF3383 family protein	NA	A0A0N9SJA3	Pseudomonas_phage	40.4	7.4e-81
