The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	141252	208639	5637049	tRNA,transposase	Bacillus_phage(25.0%)	58	NA	NA
AZR80231.1|141252_141996_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AZR75103.1|142148_142586_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AZR75104.1|142607_143000_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AZR75105.1|143162_143591_+	KINB signaling pathway activation protein	NA	NA	NA	NA	NA
AZR75106.1|143657_144371_+	N-acetylmuramoyl-L-alanine amidase CwlD	NA	E5DV68	Deep-sea_thermophilic_phage	33.5	8.8e-17
AZR75107.1|144516_145584_+	ATP-binding protein	NA	NA	NA	NA	NA
AZR75108.1|145755_146373_-	spore gernimation protein GerD	NA	NA	NA	NA	NA
AZR75109.1|146512_147124_+	KINB signaling pathway activation protein	NA	NA	NA	NA	NA
AZR75110.1|147241_148006_-	polysaccharide deacetylase family sporulation protein PdaB	NA	NA	NA	NA	NA
AZR75111.1|148176_148395_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75112.1|154610_155756_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.8	1.6e-52
AZR75113.1|155966_156860_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	30.0	1.1e-21
AZR75114.1|157108_157930_+	TIGR00159 family protein	NA	NA	NA	NA	NA
AZR75115.1|157922_159404_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75116.1|159396_160743_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AZR80232.1|161031_161217_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75117.1|161229_163032_+	glutamine--fructose-6-phosphate aminotransferase	NA	M1HQK2	Paramecium_bursaria_Chlorella_virus	39.7	3.5e-102
AZR75118.1|163183_164023_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
AZR75119.1|167001_168693_+	transcriptional antiterminator	NA	NA	NA	NA	NA
AZR75120.1|168771_169812_+	hypothetical protein	NA	A0A1S5V0T1	Saudi_moumouvirus	25.9	1.5e-12
AZR75121.1|169868_171281_+|transposase	transposase	transposase	NA	NA	NA	NA
AZR75122.1|171553_172072_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75123.1|172653_172884_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75124.1|172897_173935_+	hypothetical protein	NA	J7Q326	Aeropyrum_coil-shaped_virus	29.4	1.9e-15
AZR75125.1|174518_175061_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75126.1|175251_175581_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75127.1|175981_176209_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75128.1|176284_176521_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75129.1|176958_177144_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75130.1|177156_177375_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75131.1|178239_178470_+	transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	54.5	1.3e-17
AZR75132.1|178479_178887_-	hypothetical protein	NA	U5PVI9	Bacillus_phage	36.5	5.2e-14
AZR75133.1|179034_180216_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	55.8	4.6e-127
AZR75134.1|180317_180503_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75135.1|180504_180801_-	hypothetical protein	NA	H0USY0	Bacillus_phage	42.5	2.2e-14
AZR75136.1|180963_182139_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75137.1|182300_183704_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR75138.1|184856_185441_+	hypothetical protein	NA	A0JC18	Ralstonia_phage	35.1	5.2e-23
AZR80233.1|186167_186980_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.7e-24
AZR75139.1|187561_188230_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AZR75140.1|188204_189245_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	5.0e-29
AZR75141.1|189257_190070_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR75142.1|190351_191260_-	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
AZR75143.1|191405_192170_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75144.1|192281_193718_+	FAD-binding oxidoreductase	NA	A0A2K9KZR0	Tupanvirus	30.4	6.7e-56
AZR75145.1|193714_194248_+	MFS transporter	NA	NA	NA	NA	NA
AZR75146.1|194326_196045_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75147.1|196171_197422_+	MFS transporter	NA	NA	NA	NA	NA
AZR75148.1|197455_197902_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75149.1|198175_198679_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75150.1|198726_199194_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75151.1|199818_200631_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.7e-24
AZR75152.1|200672_200942_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75153.1|201513_201705_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75154.1|201623_201980_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75155.1|202024_203665_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR75156.1|206102_206936_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	50.6	1.2e-73
AZR75157.1|207235_208639_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	214060	282610	5637049	tRNA,transposase,protease,coat	Streptococcus_phage(12.5%)	66	NA	NA
AZR75163.1|214060_215290_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	2.6e-85
AZR80234.1|215416_215692_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75164.1|215678_216545_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR75165.1|216687_217641_+	EamA family transporter	NA	NA	NA	NA	NA
AZR75166.1|217662_217821_+	YrzO family protein	NA	NA	NA	NA	NA
AZR75167.1|217918_219322_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR75168.1|219516_219759_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75169.1|219927_220533_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZR75170.1|220605_220701_-	DUF3948 domain-containing protein	NA	NA	NA	NA	NA
AZR75171.1|220678_220870_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75172.1|221006_221984_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZR75173.1|222145_222475_+	translation initiation factor, aIF-2BI	NA	NA	NA	NA	NA
AZR75174.1|222593_223430_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.1	4.8e-46
AZR75175.1|223568_223925_+	ferrichrome ABC transporter permease	NA	NA	NA	NA	NA
AZR75176.1|224490_224604_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75177.1|224661_225369_+	DNAase	NA	NA	NA	NA	NA
AZR75178.1|225365_226235_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AZR75179.1|226544_228194_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75180.1|228433_228967_+	invasion protein	NA	NA	NA	NA	NA
AZR75181.1|228978_229773_-	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
AZR75182.1|229908_230037_-|coat	spore coat protein B	coat	NA	NA	NA	NA
AZR75183.1|230457_230592_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75184.1|230716_232597_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.4	7.4e-47
AZR75185.1|232986_233232_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75186.1|233553_235281_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR80235.1|235417_236341_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR75187.1|236353_237274_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR75188.1|237284_238265_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	6.0e-16
AZR75189.1|238261_239227_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.2	1.5e-19
AZR75190.1|239261_240134_-	HAD family phosphatase	NA	NA	NA	NA	NA
AZR75191.1|240575_240683_+	DUF3948 domain-containing protein	NA	NA	NA	NA	NA
AZR75192.1|240717_240834_+	DUF3948 domain-containing protein	NA	NA	NA	NA	NA
AZR75193.1|240868_240985_+	DUF3948 domain-containing protein	NA	NA	NA	NA	NA
AZR75194.1|241019_241139_+	DUF3948 domain-containing protein	NA	NA	NA	NA	NA
AZR75195.1|241532_242651_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
AZR75196.1|242717_243674_+	fumarylacetoacetase	NA	NA	NA	NA	NA
AZR80236.1|243639_244812_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75197.1|245043_246459_+	amino acid permease	NA	NA	NA	NA	NA
AZR75198.1|246567_247839_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	24.5	6.6e-15
AZR75199.1|248067_249153_+	D-alanine--D-alanine ligase B	NA	NA	NA	NA	NA
AZR75200.1|249215_250592_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AZR75201.1|250897_252472_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.2	1.7e-68
AZR75202.1|252568_253531_+	UV damage endonuclease UvsE	NA	NA	NA	NA	NA
AZR75203.1|253523_254096_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AZR75204.1|254189_254549_+	holo-ACP synthase	NA	NA	NA	NA	NA
AZR75205.1|254642_255656_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AZR75206.1|255773_256943_+	alanine racemase	NA	NA	NA	NA	NA
AZR75207.1|257251_257539_+	antitoxin endoai	NA	NA	NA	NA	NA
AZR75208.1|257543_257894_+	MazF/PemK family toxin	NA	A0A2P0ZKX3	Lactobacillus_phage	37.7	4.9e-13
AZR75209.1|257955_260130_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AZR75210.1|260187_260304_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
AZR75211.1|260499_260958_+	SprT family protein	NA	NA	NA	NA	NA
AZR75212.1|267451_267925_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AZR75213.1|267905_268598_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AZR80237.1|268617_269055_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AZR75214.1|269054_270071_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.4	1.9e-68
AZR75215.1|270551_272531_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.1	3.3e-53
AZR75216.1|272664_273294_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
AZR75217.1|273323_273515_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75218.1|273511_274261_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZR75219.1|274650_274935_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
AZR75220.1|274973_276620_+	chaperonin GroL	NA	A0A219YK78	uncultured_virus	56.9	5.3e-158
AZR75221.1|277017_278565_+	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	31.7	1.2e-21
AZR75222.1|278949_280275_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.1	6.4e-45
AZR75223.1|280419_281121_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
AZR75224.1|281104_282610_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.0	4.6e-31
>prophage 3
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	317781	326157	5637049		Synechococcus_phage(50.0%)	8	NA	NA
AZR75240.1|317781_319089_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
AZR75241.1|319177_319897_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	6.8e-49
AZR75242.1|319889_320144_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AZR75243.1|320140_320824_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AZR75244.1|320807_323027_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.0e-163
AZR75245.1|323011_324427_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
AZR75246.1|324532_325573_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
AZR75247.1|325569_326157_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 4
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	519744	590379	5637049	tRNA,transposase	Streptococcus_phage(22.22%)	54	NA	NA
AZR75423.1|519744_520974_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	2.6e-85
AZR75424.1|521338_521605_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80239.1|521629_522610_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AZR75425.1|522759_523857_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AZR75426.1|523891_524116_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75427.1|524241_524523_+	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
AZR75428.1|524711_524972_+	stress-induced protein	NA	NA	NA	NA	NA
AZR75429.1|525246_525777_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75430.1|525831_527592_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	1.3e-56
AZR75431.1|527606_528695_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
AZR75432.1|529051_533488_-	glutamate synthase	NA	NA	NA	NA	NA
AZR75433.1|533686_534991_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AZR75434.1|535112_536126_+	daunorubicin ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.6	2.0e-22
AZR75435.1|536118_536910_+	daunorubicin ABC transporter permease	NA	NA	NA	NA	NA
AZR75436.1|536914_537700_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR75437.1|537772_538177_+	transporter	NA	NA	NA	NA	NA
AZR80240.1|538226_538682_+	peroxiredoxin	NA	NA	NA	NA	NA
AZR75438.1|538976_539411_+	transcriptional repressor	NA	NA	NA	NA	NA
AZR75439.1|539581_540001_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZR75440.1|540107_540464_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75441.1|540647_540752_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75442.1|547098_547419_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75443.1|547770_548490_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR75444.1|548636_549098_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AZR75445.1|549591_550368_+	peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AZR75446.1|550555_551206_+	thioredoxin	NA	NA	NA	NA	NA
AZR75447.1|551594_552737_+	epoxyqueuosine reductase	NA	NA	NA	NA	NA
AZR75448.1|552781_553669_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75449.1|553727_554216_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
AZR75450.1|554343_556413_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AZR75451.1|556436_556532_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75452.1|556798_558694_+	protein prkA	NA	A0MN77	Thermus_phage	35.8	1.2e-100
AZR75453.1|558767_558917_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75454.1|559147_560323_+	sporulation protein YhbH	NA	A0A140HLI1	Bacillus_phage	44.6	5.0e-25
AZR75455.1|560451_560940_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80241.1|561036_561906_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AZR75456.1|562039_563443_+|transposase	transposase	transposase	NA	NA	NA	NA
AZR75457.1|566238_567150_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZR75458.1|567203_568754_-	glycine/betaine ABC transporter	NA	A0A2I7QNT1	Vibrio_phage	25.6	1.1e-22
AZR75459.1|569000_571898_+	collagenase	NA	NA	NA	NA	NA
AZR75460.1|572201_572750_+	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AZR75461.1|572762_574331_+	flotillin	NA	NA	NA	NA	NA
AZR75462.1|574579_576556_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	50.5	2.5e-16
AZR75463.1|576707_578315_+	sensor histidine kinase	NA	NA	NA	NA	NA
AZR75464.1|579060_580272_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.0	1.3e-68
AZR75465.1|580655_581960_-	citrate transporter	NA	NA	NA	NA	NA
AZR75466.1|582214_582469_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75467.1|582604_583108_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80242.1|583514_584264_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75468.1|584732_585299_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
AZR75469.1|585262_586990_+|transposase	transposase	transposase	NA	NA	NA	NA
AZR75470.1|588023_588956_+	glycerol-3-phosphate ABC transporter permease	NA	NA	NA	NA	NA
AZR75471.1|589255_589525_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75472.1|589566_590379_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.7e-24
>prophage 5
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	700673	771048	5637049	integrase,transposase,tail,portal,protease,capsid,terminase,bacteriocin,head	Bacillus_phage(81.63%)	73	698839:698859	759824:759844
698839:698859	attL	CTGATTAAAGTTTCACTTTAT	NA	NA	NA	NA
AZR75565.1|700673_701726_+	(R,R)-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	3.9e-21
AZR75566.1|701845_702190_+	transporter	NA	NA	NA	NA	NA
AZR75567.1|702443_703295_+	phospholipase	NA	NA	NA	NA	NA
AZR75568.1|703371_704418_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	59.3	8.2e-88
AZR75569.1|704356_705457_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	97.3	4.4e-201
AZR75570.1|706283_707486_+	hypothetical protein	NA	W8CYT9	Bacillus_phage	43.3	8.0e-87
AZR80244.1|707682_708108_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	40.0	1.2e-21
AZR75571.1|708426_708771_-	transcriptional regulator	NA	W8CZ48	Bacillus_phage	99.1	7.2e-57
AZR75572.1|708919_709156_+	transcriptional regulator	NA	W8CYU0	Bacillus_phage	100.0	4.3e-37
AZR75573.1|709188_709377_+	transcriptional regulator	NA	W8CYN7	Bacillus_phage	98.4	9.4e-27
AZR75574.1|709591_710371_+	phage regulatory protein	NA	A0A0S2GLP8	Bacillus_phage	98.5	7.6e-139
AZR75575.1|710533_710848_+	hypothetical protein	NA	W8CYU1	Bacillus_phage	98.1	7.7e-50
AZR75576.1|711122_711770_+	RNA polymerase subunit sigma	NA	A0A0S2GLJ1	Bacillus_phage	95.8	7.3e-111
AZR75577.1|712012_713017_+	DNA replication protein DnaD	NA	A0A0S2GLI6	Bacillus_phage	98.2	7.4e-187
AZR75578.1|712979_713792_+	DNA replication protein	NA	A0A0S2GLK2	Bacillus_phage	99.3	1.5e-153
AZR80245.1|713833_714100_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
AZR75579.1|714171_714336_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	98.1	2.9e-24
AZR75580.1|714888_716520_-	hypothetical protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.7	1.4e-28
AZR75581.1|716676_717507_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75582.1|717835_718006_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75583.1|718026_718497_+	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	62.2	2.3e-50
AZR75584.1|718493_719036_+|integrase	site-specific integrase	integrase	A0A1B1P746	Bacillus_phage	99.4	4.2e-96
AZR80246.1|719411_719510_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75585.1|719675_720260_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75586.1|720303_720540_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75587.1|720625_720865_+	hypothetical protein	NA	A0A1B1P745	Bacillus_phage	67.6	2.8e-20
AZR75588.1|720855_721044_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75589.1|721054_721402_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	56.8	7.3e-25
AZR75590.1|721404_721713_+	hypothetical protein	NA	A0A1B1P767	Bacillus_phage	88.5	9.6e-45
AZR75591.1|721818_722130_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	51.9	1.2e-18
AZR80247.1|722161_723769_+|terminase	terminase	terminase	A0A1B1P766	Bacillus_phage	49.9	1.5e-149
AZR75592.1|723782_724949_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	72.7	9.0e-160
AZR80248.1|725094_725652_+|protease	Clp protease ClpP	protease	A0A0U4B047	Bacillus_phage	51.7	2.9e-39
AZR75593.1|725695_726859_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	42.7	1.2e-84
AZR80249.1|726911_727007_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75594.1|726999_727296_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	95.9	1.1e-45
AZR75595.1|727276_727633_+|head,tail	phage head-tail adapter protein	head,tail	A0A1B1P760	Bacillus_phage	97.5	4.6e-59
AZR80250.1|727649_728027_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	91.2	1.4e-58
AZR75596.1|728013_728442_+	hypothetical protein	NA	A0A1B1P769	Bacillus_phage	83.8	2.1e-61
AZR75597.1|728442_729027_+|tail	phage tail protein	tail	A0A1B1P778	Bacillus_phage	91.2	2.9e-98
AZR75598.1|729098_729560_+	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	95.4	1.2e-75
AZR75599.1|729738_734406_+	hypothetical protein	NA	A0A1B1P764	Bacillus_phage	82.6	4.5e-194
AZR75600.1|734407_735091_+|tail	phage tail protein	tail	A0A1C8EA72	Bacillus_phage	96.5	6.5e-126
AZR75601.1|735087_737430_+	endopeptidase	NA	A0A1B1P7P0	Bacillus_phage	97.6	0.0e+00
AZR75602.1|737444_738620_+	hypothetical protein	NA	A0A1B1P768	Bacillus_phage	76.6	9.3e-165
AZR75603.1|738682_738913_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	97.4	1.4e-32
AZR75604.1|738909_739962_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7Q1	Bacillus_phage	94.8	3.6e-192
AZR75605.1|740402_741092_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75606.1|741301_744220_-	hypothetical protein	NA	A0A2K9L3I8	Tupanvirus	33.5	1.5e-70
AZR80251.1|744778_744931_-	hypothetical protein	NA	NA	NA	NA	NA
AZR75607.1|745072_745483_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AZR75608.1|745559_746912_-	FAD-dependent oxidase	NA	S4VXI2	Pandoravirus	37.8	1.9e-12
AZR75609.1|747055_747859_-	cytosolic protein	NA	A0A2H4J969	uncultured_Caudovirales_phage	80.7	2.2e-109
AZR80252.1|747836_748706_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AZR75610.1|750175_751102_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	89.1	3.9e-166
AZR75611.1|751503_751734_-	transcriptional regulator	NA	S5MBY6	Brevibacillus_phage	44.3	1.8e-11
AZR75612.1|752214_752535_+	hypothetical protein	NA	W8CYN5	Bacillus_phage	95.3	1.1e-48
AZR75613.1|752545_753712_+	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	98.5	1.4e-221
AZR75614.1|753701_754310_+	hypothetical protein	NA	W8CZ47	Bacillus_phage	100.0	1.2e-112
AZR75615.1|754314_755196_-	cytosolic protein	NA	I7ILW0	Bacillus_phage	98.0	1.6e-156
AZR75616.1|755693_756866_+	amino acid aldolase	NA	NA	NA	NA	NA
AZR75617.1|756853_758170_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AZR75618.1|758223_759375_-	VanZ family protein	NA	NA	NA	NA	NA
AZR75619.1|759545_759749_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75620.1|759879_760167_-	hypothetical protein	NA	NA	NA	NA	NA
759824:759844	attR	CTGATTAAAGTTTCACTTTAT	NA	NA	NA	NA
AZR75621.1|760353_761166_-	undecaprenyl-diphosphatase 1	NA	NA	NA	NA	NA
AZR75622.1|761302_762244_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.4	7.3e-11
AZR75623.1|762464_763757_+	cell wall-binding protein	NA	W5QUL8	Bacillus_phage	67.3	1.0e-31
AZR75624.1|764103_765507_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR75625.1|765711_766185_+	DUF2178 domain-containing protein	NA	NA	NA	NA	NA
AZR75626.1|766302_766935_+	class A sortase	NA	NA	NA	NA	NA
AZR75627.1|767075_768155_+	hypothetical protein	NA	NA	NA	NA	NA
AZR75628.1|769635_771048_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	1160926	1204980	5637049	transposase,protease	Staphylococcus_phage(20.0%)	42	NA	NA
AZR80271.1|1160926_1161796_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AZR75997.1|1161783_1162278_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZR75998.1|1162472_1163486_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZR75999.1|1163525_1163654_-	YhfH family protein	NA	NA	NA	NA	NA
AZR76000.1|1163834_1164569_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76001.1|1164578_1165568_+	lipoate--protein ligase	NA	NA	NA	NA	NA
AZR76002.1|1165707_1166136_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76003.1|1166297_1167830_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.4	3.7e-44
AZR76004.1|1167847_1168174_+	S-layer protein	NA	NA	NA	NA	NA
AZR76005.1|1168348_1169404_+	sulfate transporter subunit	NA	NA	NA	NA	NA
AZR76006.1|1169438_1170266_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
AZR80272.1|1170523_1171927_+|transposase	transposase	transposase	NA	NA	NA	NA
AZR76007.1|1172779_1173853_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	4.4e-28
AZR76008.1|1173894_1174905_-	cytotoxin	NA	R4WAV6	Staphylococcus_phage	30.6	3.5e-27
AZR76009.1|1175196_1176303_+	phosphoesterase	NA	NA	NA	NA	NA
AZR76010.1|1176424_1177402_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76011.1|1177445_1178411_-	sigma-M negative effector	NA	NA	NA	NA	NA
AZR76012.1|1178548_1179451_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZR76013.1|1179568_1179778_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76014.1|1180153_1181896_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	25.7	1.3e-13
AZR76015.1|1181905_1182610_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.3	2.1e-34
AZR76016.1|1182744_1183599_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZR76017.1|1183989_1184289_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76018.1|1184475_1185795_+	peptidase M48	NA	NA	NA	NA	NA
AZR76019.1|1185929_1187657_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.6	1.2e-11
AZR80273.1|1188091_1188724_+	S-layer protein	NA	A0A0E3DEP6	Bacillus_phage	23.9	4.6e-09
AZR80274.1|1188962_1189628_+	S-layer protein	NA	NA	NA	NA	NA
AZR76020.1|1189847_1191437_+	malate synthase A	NA	NA	NA	NA	NA
AZR76021.1|1191460_1192738_+	isocitrate lyase	NA	NA	NA	NA	NA
AZR76022.1|1192848_1193640_-	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AZR76023.1|1193659_1193938_-	hypothetical protein	NA	NA	NA	NA	NA
AZR76024.1|1193939_1194092_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76025.1|1194088_1194307_-	hypothetical protein	NA	NA	NA	NA	NA
AZR76026.1|1194589_1194793_+	cold-shock protein CspA	NA	Q9AZD3	Lactococcus_phage	62.9	8.0e-16
AZR76027.1|1194992_1195196_-	hypothetical protein	NA	NA	NA	NA	NA
AZR76028.1|1195542_1195725_-	hypothetical protein	NA	NA	NA	NA	NA
AZR76029.1|1196141_1197371_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	2.6e-85
AZR76030.1|1197737_1198319_+	competence protein	NA	NA	NA	NA	NA
AZR76031.1|1198754_1199348_+	alkaline phosphatase	NA	NA	NA	NA	NA
AZR76032.1|1199404_1199968_+	signal peptidase I	NA	NA	NA	NA	NA
AZR76033.1|1200407_1201811_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR76034.1|1203801_1204980_-|transposase	transposase	transposase	J7KBT5	Streptococcus_phage	27.5	1.6e-10
>prophage 7
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	1219419	1232363	5637049		Phage_Wrath(27.27%)	17	NA	NA
AZR76050.1|1219419_1221198_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.6	9.2e-23
AZR76051.1|1221228_1222632_-	recombinase family protein	NA	A0A2I7SDG6	Paenibacillus_phage	44.8	3.1e-114
AZR76052.1|1222744_1222963_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR76053.1|1222978_1223662_-	DNA-binding protein	NA	A0A2I6PF08	Staphylococcus_phage	29.8	6.5e-17
AZR76054.1|1223812_1224085_+	transcriptional regulator	NA	A0A141E0W0	Streptococcus_phage	47.8	8.8e-10
AZR76055.1|1224545_1224776_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76056.1|1224794_1225145_+	hypothetical protein	NA	A0A2H4JBP9	uncultured_Caudovirales_phage	84.2	4.7e-48
AZR76057.1|1225241_1225442_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76058.1|1225616_1225808_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76059.1|1225813_1226485_+	DNA-binding protein	NA	A0A1B2AQ06	Phage_Wrath	90.6	2.7e-116
AZR76060.1|1226505_1226982_+	hypothetical protein	NA	A0A1B2AQ07	Phage_Wrath	47.5	3.3e-28
AZR76061.1|1227054_1229409_+	DNA primase	NA	A0A1B2AQ05	Phage_Wrath	78.4	0.0e+00
AZR76062.1|1229675_1229903_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76063.1|1229890_1230319_+	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	70.4	8.9e-57
AZR76064.1|1230321_1230861_+	nuclease	NA	A0A0S2SXQ1	Bacillus_phage	52.0	3.6e-47
AZR76065.1|1231382_1231874_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76066.1|1231967_1232363_+	hypothetical protein	NA	A0A288WFT8	Bacillus_phage	87.0	1.4e-59
>prophage 8
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	1293954	1331738	5637049	bacteriocin,transposase,coat	Acinetobacter_phage(33.33%)	40	NA	NA
AZR76129.1|1293954_1295211_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	59.9	9.8e-112
AZR76130.1|1295616_1296354_+|coat	spore coat protein	coat	I7I009	Enterobacteria_phage	45.7	3.0e-52
AZR76131.1|1296362_1296908_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	46.6	1.1e-32
AZR76132.1|1296923_1297892_+	dTDP-glucose 4,6-dehydratase	NA	M1HHF3	Acanthocystis_turfacea_Chlorella_virus	43.5	4.6e-69
AZR76133.1|1297907_1298762_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZR76134.1|1298870_1299641_+	enoyl-ACP reductase	NA	NA	NA	NA	NA
AZR76135.1|1299782_1300328_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76136.1|1300388_1300847_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZR76137.1|1300972_1301332_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76138.1|1301433_1301619_+	cytochrome C oxidase subunit III	NA	NA	NA	NA	NA
AZR76139.1|1301694_1302198_-	hypothetical protein	NA	NA	NA	NA	NA
AZR76140.1|1302365_1302833_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZR76141.1|1302975_1305042_-	ATP-dependent DNA helicase	NA	A0A068EQC7	Bacillus_phage	31.5	2.9e-76
AZR76142.1|1305142_1305565_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZR76143.1|1305566_1306085_-	hypothetical protein	NA	NA	NA	NA	NA
AZR76144.1|1306178_1306910_-	esterase family protein	NA	NA	NA	NA	NA
AZR76145.1|1307113_1308025_+	EamA family transporter	NA	NA	NA	NA	NA
AZR76146.1|1308522_1308921_-	hypothetical protein	NA	NA	NA	NA	NA
AZR76147.1|1309076_1310555_-	sodium:proline symporter	NA	NA	NA	NA	NA
AZR76148.1|1310846_1311035_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80276.1|1311429_1312857_+	anthranilate synthase component I	NA	NA	NA	NA	NA
AZR76149.1|1312853_1313441_+	type 1 glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	48.4	1.0e-47
AZR76150.1|1313437_1314463_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.2	1.8e-50
AZR76151.1|1314464_1315226_+	indole-3-glycerol phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	41.0	3.1e-36
AZR76152.1|1315222_1315837_+	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
AZR76153.1|1315833_1317027_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AZR76154.1|1317030_1317807_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AZR76155.1|1317880_1318240_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76156.1|1318354_1319854_+	lactate permease	NA	NA	NA	NA	NA
AZR76157.1|1319944_1320628_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76158.1|1320642_1321476_-	hypothetical protein	NA	NA	NA	NA	NA
AZR76159.1|1321672_1322458_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AZR76160.1|1322477_1323713_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AZR76161.1|1323751_1324180_-	hypothetical protein	NA	NA	NA	NA	NA
AZR76162.1|1324282_1324378_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76163.1|1324379_1325714_+	CoA-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.7	3.7e-16
AZR76164.1|1325874_1326285_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76165.1|1326315_1327857_-	NADH oxidase	NA	NA	NA	NA	NA
AZR76166.1|1327872_1329822_-|bacteriocin	bacteriocin biosynthesis protein SagD	bacteriocin	NA	NA	NA	NA
AZR76167.1|1329818_1331738_-|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
>prophage 9
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	1415691	1424442	5637049		Bacillus_virus(55.56%)	11	NA	NA
AZR76253.1|1415691_1416051_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	60.5	1.9e-36
AZR76254.1|1416037_1416805_+	ribonucleotide-diphosphate reductase subunit alpha	NA	G3MBF2	Bacillus_virus	75.0	7.6e-107
AZR76255.1|1417045_1417807_+	GIY-YIG nuclease	NA	A0A024FSJ1	Bacillus_phage	49.2	2.5e-33
AZR76256.1|1417901_1419224_+	ribonucleoside-diphosphate reductase subunit alpha	NA	G3MBF2	Bacillus_virus	72.7	9.2e-185
AZR76257.1|1419378_1419960_+	ribonucleoside-diphosphate reductase	NA	G3MBF3	Bacillus_virus	78.1	3.4e-83
AZR76258.1|1420146_1420920_+	nuclease	NA	A0A2P0PAD9	Pectobacterium_phage	37.9	2.7e-11
AZR76259.1|1421043_1421445_+	ribonucleoside-diphosphate reductase	NA	G3MBF3	Bacillus_virus	62.6	4.0e-43
AZR76260.1|1421661_1422042_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR76261.1|1422038_1422737_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	1.2e-18
AZR76262.1|1422733_1423525_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR76263.1|1423539_1424442_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.1	2.2e-36
>prophage 10
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	1433566	1460262	5637049	integrase,tail	Bacillus_phage(96.43%)	31	1433687:1433701	1457805:1457819
AZR76276.1|1433566_1435081_-	D-alanine--poly(phosphoribitol) ligase	NA	A0A2K9L3I8	Tupanvirus	28.9	5.2e-51
1433687:1433701	attL	TTCTTTTTTGATTGC	NA	NA	NA	NA
AZR76277.1|1435093_1435285_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
AZR76278.1|1435577_1436747_+	N-acyl-L-amino acid amidohydrolase	NA	NA	NA	NA	NA
AZR76279.1|1436971_1437148_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76280.1|1437140_1437587_+	flavodoxin	NA	A7KUZ7	Bacillus_phage	31.7	7.0e-12
AZR76281.1|1438026_1439118_-|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	80.1	1.2e-161
AZR76282.1|1439833_1441099_+	hypothetical protein	NA	A0A288WGM1	Bacillus_phage	58.6	2.0e-136
AZR76283.1|1441433_1441784_-	transcriptional regulator	NA	A0A288WGH2	Bacillus_phage	65.2	4.3e-33
AZR76284.1|1441932_1442148_+	transcriptional regulator	NA	A0A288WG89	Bacillus_phage	63.2	2.9e-16
AZR76285.1|1442222_1442411_+	transcriptional regulator	NA	W8CYN7	Bacillus_phage	87.1	8.2e-23
AZR76286.1|1442625_1443369_+	phage regulatory protein	NA	H0UST9	Bacillus_phage	75.3	2.3e-100
AZR76287.1|1443531_1443840_+	hypothetical protein	NA	W8CYU1	Bacillus_phage	92.6	2.2e-41
AZR76288.1|1443865_1444513_+	RNA polymerase subunit sigma	NA	A0A0S2GLJ1	Bacillus_phage	96.7	3.9e-112
AZR76289.1|1444755_1445760_+	DNA replication protein DnaD	NA	A0A0S2GLI6	Bacillus_phage	98.2	7.4e-187
AZR76290.1|1445722_1446535_+	DNA replication protein	NA	A0A0S2GLK2	Bacillus_phage	99.3	1.5e-153
AZR80279.1|1446576_1446843_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
AZR76291.1|1446914_1447079_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	98.1	2.9e-24
AZR76292.1|1449257_1449941_+|tail	phage tail protein	tail	A0A1C8EA72	Bacillus_phage	96.5	6.5e-126
AZR76293.1|1449937_1452280_+	endopeptidase	NA	A0A1C8E983	Bacillus_phage	95.1	0.0e+00
AZR76294.1|1452294_1453479_+	hypothetical protein	NA	A0A1B1P768	Bacillus_phage	62.4	2.4e-128
AZR76295.1|1453597_1453879_+	hypothetical protein	NA	D2XR31	Bacillus_phage	76.9	1.3e-32
AZR76296.1|1453881_1454085_+	hypothetical protein	NA	D2XR32	Bacillus_phage	60.6	6.6e-18
AZR76297.1|1454145_1455186_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	78.3	4.2e-161
AZR76298.1|1455221_1455419_-	hypothetical protein	NA	A0A1B0T6A3	Bacillus_phage	83.1	4.4e-19
AZR76299.1|1456060_1456645_-	hypothetical protein	NA	A0A288WFT6	Bacillus_phage	75.9	3.8e-82
AZR76300.1|1456684_1456882_-	transcriptional regulator	NA	A0A288WG80	Bacillus_phage	56.9	4.4e-11
AZR76301.1|1457072_1457390_+	hypothetical protein	NA	H0USY0	Bacillus_phage	99.0	2.9e-52
AZR76302.1|1457386_1457569_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	86.7	8.8e-22
AZR76303.1|1457684_1458866_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	80.7	1.4e-184
1457805:1457819	attR	GCAATCAAAAAAGAA	NA	NA	NA	NA
AZR76304.1|1458807_1459428_+	hypothetical protein	NA	H0USY2	Bacillus_phage	84.0	2.8e-99
AZR76305.1|1459437_1460262_-	cytosolic protein	NA	A0A1C8EA76	Bacillus_phage	73.5	2.5e-108
>prophage 11
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	1969570	1978247	5637049		Bacillus_phage(66.67%)	8	NA	NA
AZR76808.1|1969570_1970857_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.0	3.8e-10
AZR76809.1|1970956_1971721_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZR76810.1|1971961_1973722_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	97.7	1.6e-272
AZR76811.1|1973781_1974486_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	99.6	9.3e-128
AZR80294.1|1974500_1975556_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	98.0	6.2e-184
AZR76812.1|1975580_1976174_-	hypothetical protein	NA	NA	NA	NA	NA
AZR76813.1|1976355_1977084_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	6.0e-61
AZR76814.1|1977374_1978247_+	aminoglycoside adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	44.8	1.6e-65
>prophage 12
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	2017343	2058797	5637049	transposase,protease,coat	Bacillus_phage(22.22%)	48	NA	NA
AZR76849.1|2017343_2018291_+|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	58.1	5.7e-96
AZR76850.1|2018332_2018641_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR76851.1|2018747_2019683_+	aldo/keto reductase	NA	NA	NA	NA	NA
AZR76852.1|2019730_2020906_+	MFS transporter	NA	NA	NA	NA	NA
AZR76853.1|2021200_2021479_-	hypothetical protein	NA	NA	NA	NA	NA
AZR76854.1|2021509_2021857_-	hypothetical protein	NA	NA	NA	NA	NA
AZR76855.1|2022053_2022581_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76856.1|2022715_2023813_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
AZR76857.1|2024014_2025997_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.2	8.7e-30
AZR76858.1|2026062_2026224_-	hypothetical protein	NA	NA	NA	NA	NA
AZR76859.1|2026194_2026500_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76860.1|2026822_2027188_+	DUF3979 domain-containing protein	NA	NA	NA	NA	NA
AZR76861.1|2027369_2028581_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.0	1.3e-68
AZR76862.1|2028819_2029860_-	hypothetical protein	NA	NA	NA	NA	NA
AZR76863.1|2030100_2030544_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	62.1	6.2e-45
AZR76864.1|2030647_2031103_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76865.1|2031316_2032261_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZR76866.1|2032305_2033307_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AZR76867.1|2033411_2033603_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80298.1|2033795_2035244_+	amine oxidase	NA	A0A2K9L3H9	Tupanvirus	22.0	3.7e-14
AZR76868.1|2035328_2035913_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZR76869.1|2035937_2036840_-	oxidoreductase	NA	A0A1V0SDE7	Indivirus	25.1	1.9e-08
AZR76870.1|2037005_2037956_+	GTP-binding protein	NA	NA	NA	NA	NA
AZR76871.1|2038068_2038539_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZR76872.1|2038677_2039628_-	adhesin	NA	NA	NA	NA	NA
AZR80299.1|2039905_2040043_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76873.1|2040158_2040818_+	oxidoreductase	NA	NA	NA	NA	NA
AZR76874.1|2040847_2041885_-	NADPH dehydrogenase NamA	NA	NA	NA	NA	NA
AZR76875.1|2042018_2042471_+	cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	41.0	6.6e-26
AZR76876.1|2042478_2043483_+	group-specific protein	NA	NA	NA	NA	NA
AZR76877.1|2043567_2045229_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR76878.1|2045288_2045705_+	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	64.8	1.3e-39
AZR76879.1|2045885_2046155_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76880.1|2046196_2047009_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.7e-24
AZR76881.1|2047060_2047462_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AZR76882.1|2047475_2048087_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AZR76883.1|2048132_2048711_-|coat	spore coat protein G	coat	NA	NA	NA	NA
AZR76884.1|2048892_2049969_+|coat	spore coat protein H	coat	NA	NA	NA	NA
AZR76885.1|2050074_2050692_+	ADP-ribose pyrophosphatase	NA	NA	NA	NA	NA
AZR76886.1|2050796_2051399_+	alkaline phosphatase	NA	NA	NA	NA	NA
AZR76887.1|2051496_2052876_+	transporter	NA	NA	NA	NA	NA
AZR76888.1|2053208_2054150_+	magnesium transporter	NA	NA	NA	NA	NA
AZR76889.1|2054348_2055245_+	permease	NA	NA	NA	NA	NA
AZR76890.1|2055248_2056118_+	TIGR03943 family protein	NA	NA	NA	NA	NA
AZR76891.1|2056228_2056744_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AZR76892.1|2056870_2056957_-	sporulation protein YjcZ	NA	NA	NA	NA	NA
AZR80300.1|2057168_2058302_+	cardiolipin synthase	NA	NA	NA	NA	NA
AZR76893.1|2058338_2058797_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 13
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	2125421	2171679	5637049	transposase,protease	Bacillus_phage(57.14%)	43	NA	NA
AZR76957.1|2125421_2127650_-|protease	protease	protease	NA	NA	NA	NA
AZR76958.1|2127646_2128861_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
AZR76959.1|2128860_2129823_-	MoxR family ATPase	NA	NA	NA	NA	NA
AZR76960.1|2130328_2134012_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
AZR76961.1|2134001_2135477_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	47.3	1.2e-20
AZR80308.1|2135496_2136027_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AZR76962.1|2136044_2136734_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AZR76963.1|2136870_2137563_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AZR76964.1|2137887_2138901_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
AZR76965.1|2138918_2139932_+	thiamine biosynthesis protein MoeB	NA	NA	NA	NA	NA
AZR76966.1|2139975_2141265_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AZR76967.1|2141309_2141780_+	molybdopterin (MPT) converting factor, subunit 2	NA	NA	NA	NA	NA
AZR76968.1|2141776_2142010_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
AZR76969.1|2142090_2143260_+	MFS transporter	NA	NA	NA	NA	NA
AZR76970.1|2143573_2143705_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76971.1|2144527_2145340_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.7e-24
AZR76972.1|2145381_2145651_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80309.1|2146411_2146831_+	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
AZR76973.1|2146801_2146987_-	hypothetical protein	NA	NA	NA	NA	NA
AZR76974.1|2147017_2147491_-	precorrin-2 dehydrogenase	NA	NA	NA	NA	NA
AZR76975.1|2147483_2148194_-	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AZR76976.1|2148190_2149615_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AZR76977.1|2149676_2149994_-	nitrite reductase (NAD(P)H) small subunit	NA	NA	NA	NA	NA
AZR76978.1|2150009_2152415_-	nitrite reductase large subunit	NA	NA	NA	NA	NA
AZR76979.1|2152623_2153331_-	iron-sulfur cluster repair di-iron protein	NA	NA	NA	NA	NA
AZR76980.1|2153534_2154428_-	calcium-binding protein	NA	NA	NA	NA	NA
AZR76981.1|2154636_2154789_+	exosporium protein G	NA	NA	NA	NA	NA
AZR76982.1|2154980_2155217_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76983.1|2155313_2156153_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
AZR76984.1|2156517_2157747_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	2.6e-85
AZR76985.1|2158434_2160036_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76986.1|2160191_2160764_-	preprotein translocase	NA	NA	NA	NA	NA
AZR76987.1|2161313_2161589_+	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	41.2	2.9e-08
AZR76988.1|2161904_2162192_+	hypothetical protein	NA	NA	NA	NA	NA
AZR76989.1|2162238_2162556_+	restriction endonuclease	NA	NA	NA	NA	NA
AZR76990.1|2162759_2163053_+	5-methylcytosine-specific restriction enzyme A	NA	NA	NA	NA	NA
AZR76991.1|2163391_2163700_-	YolD-like family protein	NA	NA	NA	NA	NA
AZR76992.1|2163996_2164785_+	hypothetical protein	NA	A0A288WG17	Bacillus_phage	51.4	7.4e-65
AZR76993.1|2164873_2165647_+	anion permease	NA	NA	NA	NA	NA
AZR76994.1|2165687_2166479_+	RNA methyltransferase	NA	A0A288WG17	Bacillus_phage	68.4	1.5e-102
AZR76995.1|2166547_2166952_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR76996.1|2167292_2168696_+|transposase	transposase	transposase	NA	NA	NA	NA
AZR76997.1|2170581_2171679_-|transposase	transposase	transposase	A0A0E3M2X0	Bacillus_phage	20.6	1.5e-10
>prophage 14
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	3529255	3572151	5637049	transposase,integrase,holin	Bacillus_phage(38.46%)	42	3563854:3563872	3572153:3572171
AZR78215.1|3529255_3530485_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	2.6e-85
AZR78216.1|3531032_3532043_+	aldo/keto reductase	NA	NA	NA	NA	NA
AZR78217.1|3532123_3532540_+	MxaD family protein	NA	NA	NA	NA	NA
AZR80368.1|3532701_3533718_-	collagenase	NA	Q2A0D0	Sodalis_phage	31.1	2.8e-16
AZR78218.1|3533928_3534741_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.7e-24
AZR78219.1|3534782_3535052_-	hypothetical protein	NA	NA	NA	NA	NA
AZR78220.1|3535748_3536315_-	esterase	NA	NA	NA	NA	NA
AZR78221.1|3536720_3537977_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	59.9	9.8e-112
AZR78222.1|3538114_3538942_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80369.1|3539105_3539954_-	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AZR78223.1|3540141_3540891_-	SMS protein	NA	NA	NA	NA	NA
AZR78224.1|3540974_3541184_+	hypothetical protein	NA	NA	NA	NA	NA
AZR78225.1|3541216_3542116_-	isomerase	NA	NA	NA	NA	NA
AZR80370.1|3542399_3543893_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.6	5.0e-38
AZR78226.1|3544036_3544573_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
AZR78227.1|3544694_3545018_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR80371.1|3545211_3545340_-	hypothetical protein	NA	NA	NA	NA	NA
AZR78228.1|3545461_3545737_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR78229.1|3545986_3549334_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AZR78230.1|3549538_3550876_-	hypothetical protein	NA	NA	NA	NA	NA
AZR78231.1|3550865_3551588_-	RNA polymerase sigma-I factor	NA	NA	NA	NA	NA
AZR78232.1|3552162_3552924_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AZR80372.1|3553022_3553646_-	LysE family translocator	NA	NA	NA	NA	NA
AZR78233.1|3553807_3553936_-	DUF3963 domain-containing protein	NA	NA	NA	NA	NA
AZR78234.1|3554069_3555554_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AZR78235.1|3555589_3555889_-	lysine transporter LysE	NA	NA	NA	NA	NA
AZR78236.1|3556040_3556298_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80373.1|3556434_3556914_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR78237.1|3557023_3557986_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR78238.1|3558149_3558899_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR78239.1|3558899_3559661_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.8	3.5e-27
AZR78240.1|3559831_3560173_-	cytoplasmic protein	NA	NA	NA	NA	NA
AZR78241.1|3560248_3560569_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZR78242.1|3561031_3562348_-	condensation protein	NA	NA	NA	NA	NA
3563854:3563872	attL	GTGGGCAAATTGTGGGCAA	NA	NA	NA	NA
AZR78243.1|3564060_3564894_+	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	81.2	5.5e-119
AZR78244.1|3564975_3566664_+	hypothetical protein	NA	A0A217EQY2	Bacillus_phage	39.8	1.4e-33
AZR78245.1|3567158_3568115_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	92.5	5.3e-174
AZR78246.1|3568114_3568555_-|holin	holin	holin	A0A1B1P7S2	Bacillus_phage	84.9	4.9e-66
AZR78247.1|3569441_3570254_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.7e-24
AZR78248.1|3570295_3570565_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80374.1|3570670_3570952_+	hypothetical protein	NA	A0A0M4RD70	Bacillus_phage	92.5	5.1e-45
AZR78249.1|3571017_3572151_+|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	71.6	9.7e-159
3572153:3572171	attR	GTGGGCAAATTGTGGGCAA	NA	NA	NA	NA
>prophage 15
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	4363087	4373766	5637049	holin,tail	Bacillus_phage(91.67%)	15	NA	NA
AZR80402.1|4363087_4363786_-	2OG-Fe(II) oxygenase	NA	A0A1V0SIE1	Klosneuvirus	30.1	3.0e-17
AZR79027.1|4363912_4364284_-	competence protein ComG	NA	NA	NA	NA	NA
AZR79028.1|4364280_4364625_-	competence protein ComG	NA	NA	NA	NA	NA
AZR79029.1|4364755_4365379_-	hypothetical protein	NA	H0USY2	Bacillus_phage	85.4	2.5e-100
AZR79030.1|4365320_4366502_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	83.0	2.9e-190
AZR79031.1|4366617_4366800_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	3.9e-22
AZR79032.1|4366802_4367105_-	hypothetical protein	NA	A0A288WG38	Bacillus_phage	88.9	5.0e-46
AZR79033.1|4367268_4367466_+	transcriptional regulator	NA	A0A288WG80	Bacillus_phage	44.4	1.3e-07
AZR79034.1|4367487_4367754_+	hypothetical protein	NA	NA	NA	NA	NA
AZR79035.1|4367954_4368773_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P783	Bacillus_phage	97.1	3.3e-161
AZR79036.1|4368789_4369020_-|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	92.1	4.5e-31
AZR79037.1|4369062_4369302_-	peptidase	NA	A0A1B1P7E0	Bacillus_phage	98.7	8.2e-36
AZR79038.1|4369382_4370663_-	hypothetical protein	NA	A0A1C8E978	Bacillus_phage	75.6	3.6e-186
AZR79039.1|4370677_4373083_-	endopeptidase	NA	A0A1B1P770	Bacillus_phage	94.5	0.0e+00
AZR79040.1|4373082_4373766_-|tail	phage tail protein	tail	A0A1B1P761	Bacillus_phage	93.4	1.8e-120
>prophage 16
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	4377384	4386755	5637049	integrase	Bacillus_phage(92.31%)	17	4384122:4384137	4390885:4390900
AZR79042.1|4377384_4377804_-	hypothetical protein	NA	A0A1B1P8B9	Bacillus_phage	44.2	1.3e-15
AZR79043.1|4377815_4378070_-	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	94.0	1.3e-39
AZR79044.1|4378084_4378258_-	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	100.0	1.2e-25
AZR79045.1|4378349_4378604_+	hypothetical protein	NA	NA	NA	NA	NA
AZR79046.1|4378636_4379047_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80403.1|4379051_4379852_-	hypothetical protein	NA	A0A1B1P8D0	Bacillus_phage	82.6	9.3e-124
AZR79047.1|4379820_4380726_-	DNA replication protein DnaD	NA	W8CYG5	Bacillus_phage	38.0	5.0e-41
AZR79048.1|4380732_4380909_-	hypothetical protein	NA	A0A0U3SQC4	Bacillus_phage	96.6	7.4e-26
AZR79049.1|4380938_4381103_-	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	83.3	1.8e-18
AZR79050.1|4381115_4381376_-	group-specific protein	NA	A0A1B1P7U4	Bacillus_phage	95.3	5.8e-43
AZR79051.1|4381415_4382147_-	Rha family transcriptional regulator	NA	A0A1B1P7T7	Bacillus_phage	92.6	3.1e-126
AZR79052.1|4382109_4382382_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR79053.1|4382546_4382894_+	transcriptional regulator	NA	S5MUA5	Brevibacillus_phage	40.0	7.3e-09
AZR80404.1|4382904_4383087_-	hypothetical protein	NA	NA	NA	NA	NA
AZR79054.1|4383411_4384548_-	hypothetical protein	NA	H0UST6	Bacillus_phage	39.6	1.1e-74
4384122:4384137	attL	TAGAAAATTTTTGTTC	NA	NA	NA	NA
AZR79055.1|4385034_4385388_+	transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	44.5	1.4e-20
AZR79056.1|4385585_4386755_+|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.2	5.4e-64
4390885:4390900	attR	GAACAAAAATTTTCTA	NA	NA	NA	NA
>prophage 17
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	4594753	4606230	5637049		uncultured_Caudovirales_phage(78.57%)	16	NA	NA
AZR79269.1|4594753_4595149_-	hypothetical protein	NA	A0A288WFT8	Bacillus_phage	86.3	1.5e-58
AZR79270.1|4595528_4595885_-	hypothetical protein	NA	A0A2H4J4W9	uncultured_Caudovirales_phage	69.8	1.1e-39
AZR79271.1|4595928_4596201_-	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	52.3	1.1e-15
AZR79272.1|4596204_4596744_-	nuclease	NA	A0A2H4J819	uncultured_Caudovirales_phage	92.2	7.0e-91
AZR79273.1|4596744_4597179_-	hypothetical protein	NA	A0A2H4J832	uncultured_Caudovirales_phage	95.1	2.3e-76
AZR79274.1|4597179_4597551_-	hypothetical protein	NA	NA	NA	NA	NA
AZR79275.1|4597845_4600224_-	DNA primase	NA	A0A2H4JEX8	uncultured_Caudovirales_phage	93.8	0.0e+00
AZR79276.1|4600293_4600728_-	hypothetical protein	NA	Q9ZXC5	Bacillus_phage	66.9	1.7e-50
AZR79277.1|4600727_4601657_-	hypothetical protein	NA	A0A2H4JFH2	uncultured_Caudovirales_phage	54.2	2.1e-90
AZR79278.1|4601659_4602208_-	hypothetical protein	NA	A0A2H4JFP8	uncultured_Caudovirales_phage	93.4	9.3e-91
AZR79279.1|4602185_4602473_-	hypothetical protein	NA	A0A2H4J830	uncultured_Caudovirales_phage	46.8	1.1e-15
AZR79280.1|4602744_4603095_-	hypothetical protein	NA	A0A2H4JBP9	uncultured_Caudovirales_phage	86.2	1.1e-49
AZR79281.1|4603113_4603353_-	hypothetical protein	NA	NA	NA	NA	NA
AZR79282.1|4603635_4603890_-	transcriptional regulator	NA	A0A2H4JEY2	uncultured_Caudovirales_phage	86.9	3.3e-35
AZR79283.1|4604060_4604747_+	XRE family transcriptional regulator	NA	A0A2H4J386	uncultured_Caudovirales_phage	89.5	2.1e-116
AZR79284.1|4604832_4606230_+	recombinase family protein	NA	A0A2H4JFH9	uncultured_Caudovirales_phage	78.3	1.6e-208
>prophage 18
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	4678787	4686473	5637049		Staphylococcus_phage(16.67%)	11	NA	NA
AZR79354.1|4678787_4679711_-	bacitracin ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.4	1.4e-46
AZR79355.1|4679836_4680772_-	two-component sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	26.6	7.8e-13
AZR79356.1|4680773_4681466_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.7	6.3e-36
AZR79357.1|4681634_4681808_+	hypothetical protein	NA	NA	NA	NA	NA
AZR79358.1|4681808_4682003_+	hypothetical protein	NA	NA	NA	NA	NA
AZR79359.1|4682041_4683241_-	methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	3.6e-71
AZR79360.1|4683331_4683538_-	hypothetical protein	NA	NA	NA	NA	NA
AZR79361.1|4683536_4683860_+	heme-degrading monooxygenase	NA	NA	NA	NA	NA
AZR79362.1|4683932_4684697_-	SrtB family sortase	NA	NA	NA	NA	NA
AZR79363.1|4684729_4685500_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.1	3.7e-13
AZR79364.1|4685489_4686473_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	1.1e-17
>prophage 19
CP021436	Bacillus thuringiensis strain C15 chromosome, complete genome	5637049	5218391	5256086	5637049	transposase,integrase,tail	Bacillus_phage(82.86%)	43	5222078:5222093	5263968:5263983
AZR79843.1|5218391_5219204_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.7e-24
AZR79844.1|5219290_5220769_-	spore germination protein	NA	NA	NA	NA	NA
AZR79845.1|5220812_5221892_-	spore gernimation protein	NA	NA	NA	NA	NA
5222078:5222093	attL	AAGTAGATAACTTAAT	NA	NA	NA	NA
AZR79846.1|5222963_5223431_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.2	5.4e-47
AZR79847.1|5223609_5223723_+	hypothetical protein	NA	NA	NA	NA	NA
AZR79848.1|5223804_5226231_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.6	1.7e-91
AZR79849.1|5226723_5227599_+	cytosolic protein	NA	I7ILW0	Bacillus_phage	73.5	4.3e-106
AZR79850.1|5227601_5228210_-	hypothetical protein	NA	A0A0S2GLL8	Bacillus_phage	80.1	1.2e-91
AZR79851.1|5228199_5229366_-	cell division protein FtsK	NA	W8CYG2	Bacillus_phage	81.2	4.0e-184
AZR79852.1|5229376_5229697_-	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	67.9	6.1e-34
AZR79853.1|5229714_5229957_-	hypothetical protein	NA	W8CYT8	Bacillus_phage	85.7	9.6e-16
AZR79854.1|5230077_5230302_+	XRE family transcriptional regulator	NA	A0A1B1P883	Bacillus_phage	78.4	7.7e-28
AZR79855.1|5230440_5230635_-	hypothetical protein	NA	NA	NA	NA	NA
AZR79856.1|5231501_5231699_+	hypothetical protein	NA	A0A1B0T6A3	Bacillus_phage	55.4	5.4e-09
AZR79857.1|5231789_5232542_-	N-acetylmuramoyl-L-alanine amidase	NA	S5M842	Bacillus_phage	78.7	8.3e-74
AZR80428.1|5232541_5232748_-	hypothetical protein	NA	D2XR32	Bacillus_phage	81.8	6.7e-26
AZR79858.1|5232756_5233038_-	hypothetical protein	NA	D2XR31	Bacillus_phage	79.1	4.5e-33
AZR79859.1|5233102_5233327_-	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	86.3	2.5e-26
AZR79860.1|5234826_5237232_-	endopeptidase	NA	A0A1B1P770	Bacillus_phage	82.1	0.0e+00
AZR80429.1|5237228_5237954_-|tail	phage tail protein	tail	A0A1B0T6A0	Bacillus_phage	80.0	2.3e-105
AZR79861.1|5238020_5241545_-|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	97.6	0.0e+00
AZR79862.1|5241561_5241792_-	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	95.2	3.8e-30
AZR79863.1|5241788_5242175_-	hypothetical protein	NA	A0A1B1P7Q6	Bacillus_phage	98.4	1.0e-64
AZR79864.1|5242528_5243398_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AZR80430.1|5243476_5243695_-	hypothetical protein	NA	NA	NA	NA	NA
AZR79865.1|5243823_5244579_+	hypothetical protein	NA	NA	NA	NA	NA
AZR79866.1|5244860_5245085_-	hypothetical protein	NA	W8CYG8	Bacillus_phage	73.6	5.2e-24
AZR79867.1|5245291_5245834_-|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	93.9	5.4e-91
AZR79868.1|5245830_5246316_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	93.2	7.7e-81
AZR79869.1|5246342_5246495_-	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	71.7	8.4e-10
AZR79870.1|5246947_5247151_+	hypothetical protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	65.4	2.4e-12
AZR79871.1|5247275_5248085_-	DNA-binding protein	NA	A0A2H4JAT4	uncultured_Caudovirales_phage	52.5	3.4e-73
AZR79872.1|5248118_5248286_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	64.8	3.6e-14
AZR79873.1|5248324_5248579_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	62.5	2.5e-22
AZR79874.1|5248575_5248863_-	helix-turn-helix domain containing protein	NA	A0A1B1P7W1	Bacillus_phage	47.4	3.9e-16
AZR79875.1|5248876_5249740_-	hypothetical protein	NA	A0A1B0T6C3	Bacillus_phage	62.9	5.6e-90
AZR79876.1|5249690_5250497_-	replication protein	NA	A0A1P8VVR3	Streptococcus_phage	46.3	6.0e-22
AZR79877.1|5250795_5251098_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	63.1	1.8e-27
AZR79878.1|5251607_5251796_-	transcriptional regulator	NA	W8CYN7	Bacillus_phage	90.3	5.7e-24
AZR79879.1|5251865_5252072_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR79880.1|5252241_5252577_+	XRE family transcriptional regulator	NA	H0UST7	Bacillus_phage	44.3	2.4e-17
AZR79881.1|5252992_5254186_-	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	51.4	2.8e-108
AZR79882.1|5255024_5256086_+|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	75.4	1.4e-156
5263968:5263983	attR	ATTAAGTTATCTACTT	NA	NA	NA	NA
>prophage 1
CP021438	Bacillus thuringiensis strain C15 plasmid pBMB172, complete sequence	172221	6073	91064	172221	integrase,transposase	Streptococcus_phage(64.71%)	54	34869:34928	62909:64531
AZR80666.1|6073_6943_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AZR80667.1|8603_8864_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80668.1|10691_12143_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
AZR80669.1|12242_12599_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR80670.1|12948_13635_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	58.1	2.3e-70
AZR80671.1|13805_15041_-	peptidase M23	NA	NA	NA	NA	NA
AZR80672.1|18201_18609_+	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	43.9	3.0e-22
AZR80673.1|18786_19686_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80674.1|19883_21005_-	hemolysin	NA	NA	NA	NA	NA
AZR80675.1|21375_22599_-	hemolysin BL lytic component L1	NA	NA	NA	NA	NA
AZR80676.1|22646_23963_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80677.1|24675_25821_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80678.1|26454_28500_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80679.1|28571_29279_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.0	1.5e-37
AZR80680.1|29281_29572_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80681.1|29958_32679_+	collagenase	NA	NA	NA	NA	NA
AZR80682.1|32970_33366_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80683.1|33956_34664_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.5	7.1e-43
34869:34928	attL	GTAACTACTCAGCTTAGTTAGGAAACAAGGCATGCCAAATACATGTTTTCCATTCGAAAA	NA	NA	NA	NA
AZR80684.1|34986_36390_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR80685.1|36749_36983_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80686.1|38353_38569_+	hypothetical protein	NA	Q0H264	Geobacillus_phage	47.3	1.5e-07
AZR80687.1|39970_40261_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR80688.1|40331_40667_+	50S ribosomal protein L7ae	NA	NA	NA	NA	NA
AZR80689.1|41004_41712_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.0	1.5e-37
AZR80768.1|44409_44907_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80690.1|45097_46099_-	excisionase	NA	NA	NA	NA	NA
AZR80691.1|46502_47675_+|integrase	integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	29.1	1.3e-09
AZR80692.1|49958_51146_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	26.8	1.6e-26
AZR80693.1|53543_53816_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80694.1|53827_54445_-	autotransporter	NA	NA	NA	NA	NA
AZR80695.1|56051_56738_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	59.0	1.2e-71
AZR80696.1|56811_57018_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80697.1|57058_57286_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80698.1|57919_58708_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	27.8	6.3e-16
AZR80699.1|58707_59091_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80700.1|59256_59445_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80701.1|59709_60294_-	hypothetical protein	NA	A0A219Y9V9	Aeromonas_phage	36.8	1.0e-23
AZR80702.1|61446_62850_+|transposase	transposase	transposase	NA	NA	NA	NA
AZR80703.1|66538_67225_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	59.0	1.2e-71
62909:64531	attR	TTTTCGAATGGAAAACATGTATTTGGCATGCCTTGTTTCCTAACTAAGCTGAGTAGTTACGTTTTGTTTTCCATCGCTATCAACGGATGCATGACAATCTAATCCATACGTTTACATATCGAGTAAGACGCTACATGGATGAAGCGAAATCGGCAGGAAAGGAACAAGTATACAAATCTCATCTAGAAAGAAACCAGAATATAAAGAAAGTAGGAGAAGTACTTTTTCTTTTCACTGATGATCAAATTCCTGCAGATGCTACTTTTCAGGAAATCCAGGATCGAGCCTTTGCTATCTTGGAACGTCCCAAATTGGTAGCTATCGCTGATCAAATCGTTACCAATACCAAATTAGATGAAGTTGCTTTCCGATGGGAATATATTGATCAGTTATCTCATCAATTTAAACGATCTCTGCGTCCCGTATTTTTGATGGTTGATTTCTTATCCGCCTCTGCTCATGATCCATTGATGGAAGCTGTCCATTTTTTGAAAAAAGCTTTTATGAAAAATAAGCCATTAGGAAAGTATCCTTCCGATACGTTCCCTCAACAATTTATCCCTAACGGGATGAAACGATACATCTATCAATTAAACTCTTTAGGACAAAAAGTGCTGCAGGTTAATCGCTATGAATTTTTCGTCTATCAACTTTTACGAAATGGTTTAGAAGCAGGAGATATTTTTTGTCGGGATAGTATCCGATTTCGCAGTTTTGAAGATGATCTCATTAGCGATTTAGAGTGGAAACAAAAAGAAACTTTACTTGCTGAGAACGGTCTAACTATTTTTAATCAACCTATTCAAGTTCATTTAGCAGAGCTGGAGAAGGAACTTGAAACTCGTATTACAAAGGTGAACCACCATATTGCATCTGGAGAAAATAAATATATTCAGATCAAAAAACGTGGCTCACATAGTCGCTGGACACTTCCATATGTTCGTGATAGTGAATCGATGAATCATCCCTTCTTTGAAACGGTAAAGCCTGTTGAGATTAAAAATGTTTTGCATTATGTGAATCAACGCTGTCAGTTTCTTGAAGCATTTGAACATATTTTAGGTCGTTATGCAAAACAACCCCGAGAAGAGCAAACCCTAGTAGCGTGCTTACTCGCTTGGGGAACCAATATGGGCTTAGGGAGAATGGGTGACATTTCTGATATGAATCATTCCACTCTTATTTCCACATCGGATAACTTTATTCGATTAGAAACATTAAAAGAAGCAAATTATCGGGTCAGTAATGCTACAGCTAAACTGCCTATCTTTCAACATTACAATATTGACGAAGTTATTCATTCCAGTAGCGATGGACGAAAAGCTGAAACAGGTATTCATACGATTAATGCTCGTCATTCCCCGAAATACTTCGGGCTGAGAAAGGGGATTGTTTCTTACACAATGGTAGCGAACCATATTCCTGTAAATGCGCGAATCATTGGAGCGAATGAACATGAAAGCCATTATGTATTTGACATTCTTTACAATAACACCACAGATGTTCAACCAGATGTACATTCCACAGATACGCATGGGACGAATGAAGTGAACTTTGCCATTCTCCATTTTTTTGGTTATCAGTTTGCACCTCGTTACAAGAATATCCATGATAAAGTCAGTA	NA	NA	NA	NA
AZR80704.1|68650_69592_-	ATPase	NA	NA	NA	NA	NA
AZR80705.1|69716_69941_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80706.1|70799_74303_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80707.1|76559_77267_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.0	1.5e-40
AZR80708.1|77554_78808_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80709.1|79840_80548_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.0	1.5e-37
AZR80710.1|81202_81904_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80711.1|84114_84636_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80712.1|85000_86230_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	2.6e-85
AZR80713.1|86461_86923_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80714.1|87533_87902_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80715.1|88231_88918_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	59.0	1.2e-71
AZR80716.1|89100_89685_+	methyltransferase	NA	NA	NA	NA	NA
AZR80717.1|89940_90210_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80718.1|90251_91064_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.7e-24
>prophage 1
CP021437	Bacillus thuringiensis strain C15 plasmid pBMB240, complete sequence	240314	0	46680	240314	integrase,transposase	Bacillus_phage(54.55%)	51	1237:1251	32885:32899
AZR80444.1|564_834_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80445.1|898_1609_-	hypothetical protein	NA	NA	NA	NA	NA
1237:1251	attL	ATGTATACCGAATCG	NA	NA	NA	NA
AZR80446.1|1614_2088_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80447.1|2065_2908_-|integrase	integrase	integrase	S5M9V8	Brevibacillus_phage	32.6	3.3e-31
AZR80448.1|3046_3361_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80449.1|4097_5153_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80450.1|7783_9187_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR80451.1|10548_10791_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80452.1|11058_11403_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80453.1|11574_12504_-	ATPase	NA	NA	NA	NA	NA
AZR80454.1|12927_13236_-	50S ribosomal protein L7ae	NA	NA	NA	NA	NA
AZR80654.1|13304_13595_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR80455.1|13708_13987_+	DNA-binding protein	NA	A3E2K9	Sodalis_phage	56.2	5.6e-20
AZR80456.1|14039_14273_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AZR80457.1|14294_14576_-	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	67.2	5.2e-13
AZR80458.1|14699_14966_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
AZR80459.1|15375_16035_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80460.1|16153_16504_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80461.1|17566_18979_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR80462.1|19247_19715_-	LacI family transcriptional regulator	NA	A0A0N6W8H7	Bacillus_phage	27.7	1.7e-08
AZR80463.1|19752_20208_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80464.1|20536_20728_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80465.1|20758_21310_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80466.1|21733_22003_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80467.1|22044_22857_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.7e-24
AZR80468.1|23080_23545_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80469.1|23727_23940_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR80470.1|24054_24609_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80471.1|24954_25923_+	Replicase RepFR55	NA	NA	NA	NA	NA
AZR80472.1|26465_27509_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80473.1|27520_27817_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80474.1|29390_29624_+	hypothetical protein	NA	H0USY0	Bacillus_phage	41.9	3.5e-07
AZR80475.1|29625_29811_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80476.1|29912_31094_+	cell division protein FtsK	NA	A0A288WGQ0	Bacillus_phage	57.6	3.3e-125
AZR80477.1|31032_31650_+	hypothetical protein	NA	Q2LIA9	Bacillus_phage	46.1	3.1e-34
AZR80478.1|31660_31891_-	transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	51.9	1.8e-16
AZR80479.1|32758_32977_-	hypothetical protein	NA	NA	NA	NA	NA
32885:32899	attR	CGATTCGGTATACAT	NA	NA	NA	NA
AZR80480.1|32989_33175_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80481.1|33612_33849_-	hypothetical protein	NA	A0A1B1P789	Bacillus_phage	36.7	7.9e-07
AZR80482.1|33924_34152_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80483.1|34552_34882_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80484.1|35072_35615_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80485.1|36198_37218_-	hypothetical protein	NA	J7Q326	Aeropyrum_coil-shaped_virus	28.6	1.1e-15
AZR80486.1|37248_37479_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80487.1|38060_38579_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80655.1|38835_39963_-	peptidase M23	NA	NA	NA	NA	NA
AZR80488.1|40370_40964_+	cell division protein FtsN	NA	NA	NA	NA	NA
AZR80489.1|41170_42592_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AZR80490.1|42657_43851_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AZR80491.1|43898_44957_-	endonuclease	NA	NA	NA	NA	NA
AZR80492.1|45267_46680_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP021437	Bacillus thuringiensis strain C15 plasmid pBMB240, complete sequence	240314	50573	114886	240314	bacteriocin,transposase,integrase	Streptococcus_phage(11.76%)	57	74802:74822	119948:119968
AZR80493.1|50573_50891_-	hypothetical protein	NA	A0A2H4JAV2	uncultured_Caudovirales_phage	43.0	4.3e-16
AZR80494.1|51138_51327_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AZR80495.1|52791_53058_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80496.1|53200_53839_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	5.1e-08
AZR80497.1|53828_54377_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80498.1|54390_54900_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80499.1|54904_56611_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80500.1|56692_57016_-|bacteriocin	circularin A/uberolysin family circular bacteriocin	bacteriocin	NA	NA	NA	NA
AZR80656.1|57329_58511_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZR80501.1|58507_59188_+	macrolide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	4.4e-34
AZR80502.1|59184_60384_+	macrolide ABC transporter permease	NA	NA	NA	NA	NA
AZR80503.1|60447_61122_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80657.1|61704_61962_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80504.1|62729_64166_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AZR80505.1|64734_65772_-	hypothetical protein	NA	J7Q326	Aeropyrum_coil-shaped_virus	29.2	4.9e-16
AZR80506.1|65785_66016_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80507.1|66597_67116_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80508.1|67405_68818_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR80509.1|70541_71135_+	cell division protein FtsN	NA	NA	NA	NA	NA
AZR80510.1|73563_74220_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80511.1|74316_74547_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80512.1|74604_74769_-|integrase	integrase	integrase	NA	NA	NA	NA
74802:74822	attL	ATACTTATAGTGGTGTCATAC	NA	NA	NA	NA
AZR80513.1|75003_75192_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80514.1|75304_75871_+|integrase	site-specific integrase	integrase	A0A1S5SFL0	Streptococcus_phage	35.4	1.6e-24
AZR80515.1|75914_76412_+	potassium transporter	NA	NA	NA	NA	NA
AZR80516.1|77654_80741_-|transposase	DDE transposase	transposase	Q1MVP5	Enterobacteria_phage	22.8	1.3e-53
AZR80517.1|80913_81498_+	hypothetical protein	NA	A0A219Y9V9	Aeromonas_phage	36.8	1.0e-23
AZR80518.1|81792_82452_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80519.1|82501_84628_+	hypothetical protein	NA	A0A1X9I6W8	Streptococcus_phage	33.5	4.9e-63
AZR80520.1|85191_85548_+|transposase	transposase	transposase	NA	NA	NA	NA
AZR80521.1|86044_86209_-	Spo0E family sporulation regulatory protein-aspartic acid phosphatase	NA	NA	NA	NA	NA
AZR80522.1|86322_86604_+	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	60.7	1.7e-11
AZR80523.1|86627_86861_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
AZR80524.1|86921_87197_-	DNA-binding protein	NA	A3E2K9	Sodalis_phage	56.2	3.6e-19
AZR80525.1|87351_87654_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR80526.1|87722_88031_+	50S ribosomal protein L7ae	NA	NA	NA	NA	NA
AZR80527.1|88469_89375_+	ATPase	NA	NA	NA	NA	NA
AZR80528.1|89707_89995_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80529.1|90173_90509_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80530.1|90757_91852_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80531.1|92268_93459_-	peptidase C1	NA	A0A2K9L9R4	Tupanvirus	27.1	3.1e-14
AZR80532.1|93744_94356_+	DNA recombinase	NA	A0A1V0E035	Clostridioides_phage	34.0	4.0e-18
AZR80533.1|95037_95235_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80534.1|95546_96623_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80535.1|97001_97982_+	spore maturation protein	NA	NA	NA	NA	NA
AZR80536.1|97998_98790_+	glyoxalase	NA	A0A288WG17	Bacillus_phage	60.3	2.1e-83
AZR80537.1|99150_99702_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	53.3	4.2e-43
AZR80538.1|99714_102696_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	46.0	1.5e-259
AZR80539.1|102961_103231_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80540.1|103295_104006_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80541.1|104011_104485_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80542.1|104462_105305_-|integrase	integrase	integrase	S5M9V8	Brevibacillus_phage	32.6	3.3e-31
AZR80543.1|105443_105758_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80544.1|106493_107549_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80545.1|110179_111583_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR80546.1|112266_112452_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80547.1|113071_114886_+	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	36.0	1.5e-41
119948:119968	attR	ATACTTATAGTGGTGTCATAC	NA	NA	NA	NA
>prophage 3
CP021437	Bacillus thuringiensis strain C15 plasmid pBMB240, complete sequence	240314	118055	191946	240314	transposase	Bacillus_phage(29.41%)	57	NA	NA
AZR80552.1|118055_119804_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.6	4.3e-41
AZR80553.1|120032_120263_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80554.1|120276_121314_+	hypothetical protein	NA	J7Q326	Aeropyrum_coil-shaped_virus	28.6	8.3e-16
AZR80555.1|121897_122440_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80556.1|122630_122960_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80557.1|123360_123588_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80558.1|123795_125199_+|transposase	transposase	transposase	NA	NA	NA	NA
AZR80559.1|125968_126154_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80560.1|126166_126385_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80561.1|127249_127480_+	transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	54.5	1.3e-17
AZR80562.1|127489_127897_-	hypothetical protein	NA	Q2I8E0	Bacillus_phage	42.9	3.3e-16
AZR80563.1|128044_129226_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	55.8	4.6e-127
AZR80564.1|129327_129513_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80565.1|129514_129811_-	hypothetical protein	NA	H0USY0	Bacillus_phage	42.5	2.2e-14
AZR80566.1|129973_131149_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80658.1|131310_132714_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR80567.1|134857_135952_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	45.8	7.1e-82
AZR80568.1|135953_136091_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
AZR80569.1|136174_136441_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80570.1|136584_137025_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80571.1|137031_138222_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80572.1|138441_138996_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AZR80573.1|139652_140597_-	Replicase RepFR55	NA	NA	NA	NA	NA
AZR80574.1|140941_141439_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR80575.1|141623_141827_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR80576.1|141960_144681_+	TQXA domain-containing protein	NA	NA	NA	NA	NA
AZR80577.1|144957_145482_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80578.1|146236_146485_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80579.1|147070_147610_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80580.1|147766_149179_+|transposase	transposase	transposase	NA	NA	NA	NA
AZR80581.1|151149_152148_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80582.1|152961_153438_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.4	2.1e-43
AZR80583.1|153452_154652_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	52.9	6.9e-115
AZR80584.1|154872_155973_-	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.5	4.9e-59
AZR80585.1|157665_158352_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	58.5	8.6e-70
AZR80659.1|158910_160128_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80586.1|160426_161830_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR80587.1|162982_163567_+	hypothetical protein	NA	A0A219Y9V9	Aeromonas_phage	36.8	1.0e-23
AZR80588.1|163975_164245_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80589.1|164286_165099_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.7e-24
AZR80590.1|165278_165770_-	hypothetical protein	NA	A0A0A7AR67	Bacillus_phage	29.3	4.2e-10
AZR80591.1|167387_167975_+	methyltransferase	NA	NA	NA	NA	NA
AZR80592.1|168600_169416_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
AZR80593.1|169750_171007_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	59.9	9.8e-112
AZR80594.1|171413_172628_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80595.1|172974_173844_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AZR80596.1|177088_179815_+	collagenase	NA	NA	NA	NA	NA
AZR80597.1|180097_180523_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80598.1|181075_182173_-	spore gernimation protein GerH	NA	NA	NA	NA	NA
AZR80599.1|182279_183419_-	spore gernimation protein GerLC	NA	NA	NA	NA	NA
AZR80600.1|184173_185079_+	ATPase	NA	NA	NA	NA	NA
AZR80601.1|185132_185417_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80602.1|185596_185938_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80603.1|186332_187034_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80604.1|187924_189328_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR80605.1|189858_190470_-	DNA recombinase	NA	A0A1V0E035	Clostridioides_phage	33.5	2.0e-17
AZR80606.1|190755_191946_+	peptidase C1	NA	A0A2K9L9R4	Tupanvirus	27.1	3.1e-14
>prophage 4
CP021437	Bacillus thuringiensis strain C15 plasmid pBMB240, complete sequence	240314	196743	197610	240314		Bacillus_phage(50.0%)	3	NA	NA
AZR80613.1|196743_197019_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	60.7	4.3e-20
AZR80614.1|197075_197309_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AZR80615.1|197328_197610_-	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	60.7	1.7e-11
>prophage 5
CP021437	Bacillus thuringiensis strain C15 plasmid pBMB240, complete sequence	240314	205956	206781	240314		Clostridium_botulinum_C_phage(100.0%)	1	NA	NA
AZR80660.1|205956_206781_-	ADP ribosyltransferase	NA	Q331X8	Clostridium_botulinum_C_phage	28.7	2.7e-17
>prophage 6
CP021437	Bacillus thuringiensis strain C15 plasmid pBMB240, complete sequence	240314	211858	215295	240314	transposase	Wolbachia_phage(20.0%)	6	NA	NA
AZR80628.1|211858_213004_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.5	1.0e-43
AZR80629.1|213252_213429_-	hypothetical protein	NA	F2Y0Z1	Organic_Lake_phycodnavirus	47.7	3.8e-06
AZR80630.1|213552_213975_+	hypothetical protein	NA	NA	NA	NA	NA
AZR80631.1|214087_214360_+	DNA-binding protein	NA	A7KV42	Bacillus_phage	65.6	1.1e-23
AZR80632.1|214422_214701_-	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	57.4	1.5e-12
AZR80633.1|214791_215295_-	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	57.8	3.3e-42
>prophage 7
CP021437	Bacillus thuringiensis strain C15 plasmid pBMB240, complete sequence	240314	224970	231128	240314	transposase	Streptococcus_phage(40.0%)	9	NA	NA
AZR80640.1|224970_225249_+	DNA-binding protein	NA	A7KV42	Bacillus_phage	68.9	2.2e-24
AZR80641.1|225301_225535_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AZR80661.1|225715_226429_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80642.1|226741_226981_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80643.1|227017_227266_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80644.1|227630_228860_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	2.6e-85
AZR80645.1|229253_230117_-	antirestriction protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	44.7	2.1e-57
AZR80646.1|230269_230548_-	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	55.7	7.4e-12
AZR80647.1|230582_231128_-	hypothetical protein	NA	A0A1X9I6W8	Streptococcus_phage	34.7	4.1e-22
>prophage 8
CP021437	Bacillus thuringiensis strain C15 plasmid pBMB240, complete sequence	240314	235044	237618	240314		Planktothrix_phage(50.0%)	3	NA	NA
AZR80650.1|235044_235815_-	bacitracin ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	3.0e-34
AZR80651.1|236346_236823_-	hypothetical protein	NA	NA	NA	NA	NA
AZR80652.1|237066_237618_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	53.3	4.2e-43
