The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	27238	78099	4095467	tRNA,integrase	Planktothrix_phage(40.0%)	44	61445:61463	82184:82202
AZR83324.1|27238_28141_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR83325.1|28371_29145_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZR83326.1|29234_30044_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR86620.1|30054_31122_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AZR83327.1|31279_34888_+	indolepyruvate ferredoxin oxidoreductase	NA	NA	NA	NA	NA
AZR83328.1|34978_35659_-	chemotaxis protein CheD	NA	NA	NA	NA	NA
AZR83329.1|35870_36779_-	permease	NA	NA	NA	NA	NA
AZR83330.1|36775_37447_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	38.2	9.5e-29
AZR83331.1|37765_38782_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	42.1	1.0e-71
AZR83332.1|38901_40092_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZR83333.1|40093_41194_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZR83334.1|41248_41989_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	4.4e-35
AZR83335.1|42109_43132_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR83336.1|43131_43599_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83337.1|43617_45144_-	glycerol kinase	NA	NA	NA	NA	NA
AZR83338.1|45130_46588_-	MFS transporter	NA	NA	NA	NA	NA
AZR83339.1|46685_46874_+	DUF3460 domain-containing protein	NA	NA	NA	NA	NA
AZR83340.1|46900_47788_+	segregation and condensation protein A	NA	NA	NA	NA	NA
AZR83341.1|47832_48675_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AZR83342.1|48772_49120_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AZR83343.1|49202_49946_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83344.1|50186_51026_+	peptidase A24	NA	NA	NA	NA	NA
AZR86621.1|51034_51679_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
AZR86622.1|51720_52473_+	cell division protein ZapD	NA	NA	NA	NA	NA
AZR83345.1|52653_53904_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZR83346.1|53900_56969_+	multidrug transporter subunit MdtC	NA	NA	NA	NA	NA
AZR83347.1|56965_60073_+	multidrug transporter subunit MdtC	NA	NA	NA	NA	NA
AZR83348.1|60069_61572_+	RND transporter	NA	NA	NA	NA	NA
61445:61463	attL	GCCTGCTGGGCAGCCGGCT	NA	NA	NA	NA
AZR83349.1|61670_62621_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83350.1|62617_63568_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR83351.1|63668_64631_-	NUDIX hydrolase	NA	A0A221LFJ1	Barns_Ness_breadcrumb_sponge_sobemo-like_virus	53.4	1.9e-06
AZR83352.1|64623_65490_-	AAA family ATPase	NA	NA	NA	NA	NA
AZR83353.1|65689_66916_-	bifunctional ornithine acetyltransferase/N-acetylglutamate synthase	NA	NA	NA	NA	NA
AZR83354.1|67133_68036_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83355.1|69450_70362_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AZR83356.1|70363_72502_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AZR83357.1|72498_73038_+	D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AZR83358.1|73041_73770_+	acyl-phosphate glycerol 3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZR83359.1|73756_74650_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83360.1|74720_75116_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
AZR83361.1|75125_75656_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.4	3.7e-12
AZR83362.1|75784_76036_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83363.1|76099_77050_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83364.1|77148_78099_+|integrase	integrase	integrase	NA	NA	NA	NA
82184:82202	attR	AGCCGGCTGCCCAGCAGGC	NA	NA	NA	NA
>prophage 2
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	83099	143991	4095467	terminase,integrase	Pseudomonas_phage(25.0%)	51	100170:100188	147103:147121
AZR83369.1|83099_84050_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR83370.1|84207_85473_-	saccharopine dehydrogenase	NA	NA	NA	NA	NA
AZR83371.1|85506_86604_-	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
AZR83372.1|87306_88209_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83373.1|88209_88779_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR83374.1|88846_89662_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83375.1|89828_91448_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR83376.1|91526_92468_+	peptide ABC transporter	NA	NA	NA	NA	NA
AZR83377.1|92467_93352_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AZR83378.1|93355_95008_+	microcin ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	6.0e-16
AZR83379.1|95047_96445_+	amidase	NA	NA	NA	NA	NA
AZR83380.1|96486_97866_+	taurine--pyruvate aminotransferase	NA	NA	NA	NA	NA
AZR83381.1|97905_98124_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83382.1|98464_99337_+	carboxyvinyl-carboxyphosphonate phosphorylmutase	NA	NA	NA	NA	NA
AZR86624.1|99450_100098_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83383.1|100121_100499_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
100170:100188	attL	TTTCCGATGCGTATCGGCG	NA	NA	NA	NA
AZR83384.1|100483_101185_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83385.1|101328_102021_-	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AZR86625.1|102020_103061_-	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AZR83386.1|103239_105606_+	LPS biosynthesis protein	NA	NA	NA	NA	NA
AZR83387.1|105602_107162_+	molecular chaperone SurA	NA	NA	NA	NA	NA
AZR83388.1|107186_107984_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase	NA	NA	NA	NA	NA
AZR83389.1|108015_109161_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.2	1.7e-41
AZR83390.1|109265_110708_+	pyruvate kinase	NA	NA	NA	NA	NA
AZR83391.1|110710_111940_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83392.1|114077_115028_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR83393.1|115139_115862_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83394.1|115960_116704_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83395.1|118563_119295_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AZR83396.1|119341_120802_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AZR83397.1|120826_121306_+	CDP-alcohol phosphatidyltransferase	NA	NA	NA	NA	NA
AZR83398.1|121324_122335_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AZR83399.1|122549_123290_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR83400.1|123496_124471_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83401.1|124467_125418_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR83402.1|127376_128255_-	fatty acid desaturase	NA	NA	NA	NA	NA
AZR86626.1|129181_132160_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83403.1|132509_133460_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83404.1|133888_134491_-	hypothetical protein	NA	R9TF81	Synechococcus_phage	43.6	7.9e-27
AZR83405.1|134613_134856_-	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	54.5	1.5e-16
AZR83406.1|134861_135974_-	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	49.7	2.1e-102
AZR83407.1|135945_137364_-	hypothetical protein	NA	R9TF43	Synechococcus_phage	42.1	2.2e-99
AZR83408.1|137366_138644_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
AZR83409.1|138630_139116_-|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	61.5	7.3e-39
AZR83410.1|139666_140107_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86627.1|140306_141125_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	43.8	1.2e-22
AZR83411.1|141244_141721_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83412.1|141717_142473_-	hypothetical protein	NA	U6C6D0	Ralstonia_phage	38.0	1.0e-26
AZR86628.1|142472_143264_-	hypothetical protein	NA	A0A1B0YZZ0	Pseudomonas_phage	45.4	7.0e-15
AZR83413.1|143327_143543_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83414.1|143544_143991_-	hypothetical protein	NA	Q8W6N7	Burkholderia_virus	51.1	5.9e-19
147103:147121	attR	TTTCCGATGCGTATCGGCG	NA	NA	NA	NA
>prophage 3
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	148249	198089	4095467	integrase	Escherichia_phage(22.22%)	50	151157:151176	199278:199297
AZR83422.1|148249_149200_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR83423.1|149298_150372_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83424.1|150539_151334_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
151157:151176	attL	GCGCGACGCGCTGGCCCTGG	NA	NA	NA	NA
AZR83425.1|151373_151898_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83426.1|151890_153633_-	sulfite reductase	NA	NA	NA	NA	NA
AZR83427.1|153842_154601_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	4.4e-14
AZR83428.1|154603_155311_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	8.2e-07
AZR83429.1|155327_156209_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZR83430.1|156219_157206_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZR83431.1|157307_158225_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83432.1|158346_159579_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR83433.1|159648_161067_+	amidase	NA	NA	NA	NA	NA
AZR83434.1|161088_161739_-	carbonate dehydratase	NA	NA	NA	NA	NA
AZR83435.1|161872_162208_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83436.1|162296_163247_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83437.1|163243_165118_-	capsular biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	26.9	8.8e-24
AZR83438.1|166567_167518_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83439.1|167514_168219_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZR83440.1|168215_169322_-	glycosyl transferase	NA	NA	NA	NA	NA
AZR83441.1|169583_170177_-	sugar transferase	NA	NA	NA	NA	NA
AZR83442.1|170173_171361_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	NA	NA	NA	NA
AZR83443.1|171423_172683_-	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AZR83444.1|172706_173795_-	UDP-N-acetylglucosamine 2-epimerase	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	36.3	4.8e-46
AZR83445.1|173802_174903_-	aminotransferase DegT	NA	A0A2K9L0G1	Tupanvirus	29.7	3.3e-31
AZR83446.1|174906_175482_-	serine acetyltransferase	NA	NA	NA	NA	NA
AZR83447.1|175485_176538_-	oxidoreductase	NA	NA	NA	NA	NA
AZR86630.1|176668_177676_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
AZR83448.1|177677_178964_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AZR83449.1|178980_179136_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83450.1|179160_179964_-	pantothenate kinase	NA	NA	NA	NA	NA
AZR83451.1|179960_180827_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
AZR83452.1|180901_182032_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR83453.1|182031_182871_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	9.1e-21
AZR83454.1|183024_183492_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83455.1|183581_183803_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83456.1|183803_184406_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83457.1|184435_185089_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZR83458.1|185316_186267_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86631.1|186348_187527_+	peptidase	NA	B6DZZ7	Stx2-converting_phage	40.5	5.8e-66
AZR83459.1|187607_188474_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
AZR83460.1|188549_188825_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83461.1|188832_189495_+	octanoyltransferase	NA	NA	NA	NA	NA
AZR83462.1|189556_190558_+	lipoyl synthase	NA	NA	NA	NA	NA
AZR83463.1|190572_191121_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.4	3.7e-47
AZR83464.1|191178_192075_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
AZR83465.1|192071_193133_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.8	1.6e-78
AZR83466.1|193168_194119_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR86632.1|194301_194649_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZR83467.1|194721_196917_+	DNA methylase	NA	NA	NA	NA	NA
AZR83468.1|197138_198089_+|integrase	integrase	integrase	NA	NA	NA	NA
199278:199297	attR	GCGCGACGCGCTGGCCCTGG	NA	NA	NA	NA
>prophage 4
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	260740	319266	4095467	integrase	Acinetobacter_phage(30.0%)	57	306442:306461	319282:319301
AZR83526.1|260740_261691_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86637.1|261840_262824_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83527.1|265000_265735_+	crotonase	NA	NA	NA	NA	NA
AZR83528.1|265810_266791_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83529.1|267251_267851_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83530.1|267919_268912_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83531.1|268961_270551_+	sulfurtransferase	NA	NA	NA	NA	NA
AZR83532.1|270591_271488_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83533.1|271484_273191_+	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
AZR83534.1|273358_274537_+	carnitine dehydratase	NA	NA	NA	NA	NA
AZR83535.1|274580_275180_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83536.1|275978_276962_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR83537.1|277419_278343_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83538.1|278351_278750_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83539.1|278991_280971_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83540.1|283443_283644_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83541.1|283644_283764_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83542.1|283756_284098_-	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	45.3	1.0e-10
AZR83543.1|284108_285293_-	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	37.8	1.5e-24
AZR83544.1|285329_285857_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83545.1|285914_286562_-	exonuclease	NA	A0A0U2BXF3	Paracoccus_phage	41.4	2.0e-31
AZR83546.1|286558_287545_-	DNA recombinase	NA	H9C0R8	Aeromonas_phage	57.3	2.0e-67
AZR83547.1|287548_287731_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83548.1|287727_288105_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83549.1|288338_288818_-	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	71.3	1.7e-43
AZR83550.1|289003_289906_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83551.1|289951_293338_-	molybdopterin oxidoreductase	NA	NA	NA	NA	NA
AZR83552.1|293479_293884_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83553.1|294027_295014_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83554.1|295000_295282_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83555.1|295368_295599_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83556.1|295668_295893_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83557.1|296027_297260_-	mesaconyl-CoA isomerase	NA	NA	NA	NA	NA
AZR83558.1|297259_297754_-	dehydratase	NA	NA	NA	NA	NA
AZR83559.1|297885_298848_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83560.1|298825_300079_-	carnitine dehydratase	NA	NA	NA	NA	NA
AZR83561.1|300200_301151_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83562.1|301163_302099_-	hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.7	6.4e-15
AZR83563.1|302158_302968_-	disulfide bond formation protein DsbC	NA	NA	NA	NA	NA
AZR83564.1|302994_304164_-	ubiquinone biosynthesis protein UbiH	NA	NA	NA	NA	NA
AZR83565.1|304160_305450_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83566.1|305492_305867_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
AZR83567.1|305981_306710_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
306442:306461	attL	CCGGCTTCGGCGGGCAGGCG	NA	NA	NA	NA
AZR83568.1|306717_307422_+	phosphoglycolate phosphatase, bacterial	NA	NA	NA	NA	NA
AZR83569.1|307685_309206_+	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	32.0	1.8e-43
AZR83570.1|309261_309825_+	anthranilate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	1.1e-65
AZR83571.1|309843_310875_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	7.4e-73
AZR83572.1|310871_311660_+	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	53.0	5.1e-66
AZR83573.1|311835_312825_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR83574.1|312917_313649_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZR83575.1|313685_314315_-	2-hydroxychromene-2-carboxylate isomerase	NA	NA	NA	NA	NA
AZR86638.1|314311_314578_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83576.1|314706_315621_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83577.1|315662_316649_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZR83578.1|316798_317047_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83579.1|317083_318217_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83580.1|318315_319266_+|integrase	integrase	integrase	NA	NA	NA	NA
319282:319301	attR	CCGGCTTCGGCGGGCAGGCG	NA	NA	NA	NA
>prophage 5
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	415758	480675	4095467	holin,tRNA,integrase	Acanthamoeba_polyphaga_mimivirus(18.18%)	52	464525:464542	483032:483049
AZR83660.1|415758_416709_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR83661.1|416807_417434_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83662.1|417456_418383_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
AZR83663.1|418391_419978_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR83664.1|419974_420979_-	acetylesterase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	31.5	7.5e-30
AZR83665.1|421178_422039_+	cupin	NA	NA	NA	NA	NA
AZR83666.1|422070_423072_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83667.1|423142_423952_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZR83668.1|424029_425889_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AZR83669.1|425998_427201_-	arabinose transporter permease	NA	NA	NA	NA	NA
AZR83670.1|427314_428196_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83671.1|428229_429567_-	flagellar biosynthesis protein FlgA	NA	NA	NA	NA	NA
AZR83672.1|429696_430257_-	5'-3'-deoxyribonucleotidase	NA	A0A1E1EUN3	Acanthamoeba_castellanii_mimivirus	30.8	3.2e-14
AZR83673.1|430316_431294_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR83674.1|432268_434128_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
AZR83675.1|434175_435345_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AZR86647.1|435445_437053_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	57.3	5.4e-22
AZR83676.1|437099_439121_+	3-methylcrotonyl-CoA carboxylase	NA	NA	NA	NA	NA
AZR83677.1|439149_439395_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83678.1|439408_440599_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.4e-21
AZR83679.1|440794_441760_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR83680.1|441782_442934_-	alanine racemase	NA	NA	NA	NA	NA
AZR83681.1|443145_444108_+	immunogenic protein	NA	NA	NA	NA	NA
AZR83682.1|444231_446256_+	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
AZR83683.1|446452_448696_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZR83684.1|448974_449433_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83685.1|449449_450409_+|tRNA	tRNA glutamyl-Q synthetase	tRNA	NA	NA	NA	NA
AZR83686.1|450395_453017_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83687.1|453080_455708_+	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	25.4	6.1e-23
AZR83688.1|455859_456924_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR83689.1|456923_457694_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	8.1e-24
AZR83690.1|457702_458536_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR83691.1|458548_459328_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AZR83692.1|459401_460835_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AZR83693.1|460862_461621_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AZR86648.1|461676_463518_-	acetolactate synthase, large subunit, biosynthetic type	NA	E4WLQ6	Ostreococcus_tauri_virus	30.4	2.2e-59
AZR83694.1|463620_464097_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZR83695.1|464113_465034_-	bestrophin	NA	NA	NA	NA	NA
464525:464542	attL	CAGGTCGCCGGTCACGGC	NA	NA	NA	NA
AZR83696.1|465140_465641_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AZR83697.1|466014_466707_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	41.6	6.3e-36
AZR83698.1|467015_468014_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83699.1|467976_468411_+	carbon monoxide dehydrogenase	NA	NA	NA	NA	NA
AZR83700.1|469927_470812_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83701.1|470808_471036_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83702.1|471053_472004_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83703.1|473059_473920_-	endonuclease	NA	NA	NA	NA	NA
AZR83704.1|474032_475823_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	25.5	6.5e-08
AZR86649.1|475863_476508_-	hypothetical protein	NA	A0A2I7S9X1	Vibrio_phage	28.4	8.5e-11
AZR83705.1|476529_476838_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
AZR86650.1|477003_478290_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83706.1|478416_479667_-|holin	choline dehydrogenase	holin	A0A2K9L353	Tupanvirus	31.9	3.7e-10
AZR83707.1|479724_480675_-|integrase	integrase	integrase	NA	NA	NA	NA
483032:483049	attR	CAGGTCGCCGGTCACGGC	NA	NA	NA	NA
>prophage 6
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	534906	602183	4095467	integrase	Bacillus_phage(44.44%)	59	549902:549961	602184:602280
AZR83748.1|534906_535857_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR83749.1|535955_536861_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	9.8e-21
AZR83750.1|536857_537691_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR83751.1|538536_539547_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR83752.1|539543_539933_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83753.1|539916_540528_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83754.1|540814_542080_+	amidase	NA	NA	NA	NA	NA
AZR83755.1|542170_543871_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
AZR83756.1|544297_544945_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83757.1|544943_546383_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AZR83758.1|546493_546778_+	bacterioferritin	NA	NA	NA	NA	NA
AZR83759.1|546805_547684_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83760.1|548950_549901_-|integrase	integrase	integrase	NA	NA	NA	NA
549902:549961	attL	CCGGCCGAGCTCCTTGAGTGAACTGGGGGGTTGGCGATTTCCAGTTTCTCAAATCCGGTT	NA	NA	NA	NA
AZR86653.1|549993_550560_-	2'-5' RNA ligase	NA	NA	NA	NA	NA
AZR83761.1|550649_551531_-	ferritin	NA	NA	NA	NA	NA
AZR86654.1|551705_553259_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	A0A2N9QVT9	Dishui_lake_phycodnavirus	28.7	1.3e-33
AZR83762.1|553264_553900_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83763.1|554128_555151_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83764.1|555316_556093_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase	NA	NA	NA	NA	NA
AZR83765.1|556256_556955_+	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	37.1	8.6e-33
AZR83766.1|556966_558277_+	phosphate regulon sensor histidine kinase PhoR	NA	A0A1V0SGX0	Hokovirus	25.5	6.2e-16
AZR83767.1|558332_559010_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	1.5e-29
AZR83768.1|559006_560404_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AZR83769.1|560509_560971_+	metal-binding protein	NA	NA	NA	NA	NA
AZR83770.1|561076_562276_+	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	42.6	3.1e-91
AZR83771.1|562325_563201_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83772.1|563302_563734_+	glyoxalase	NA	NA	NA	NA	NA
AZR83773.1|563758_564487_+	allophanate hydrolase	NA	NA	NA	NA	NA
AZR83774.1|564483_565464_+	carboxylase	NA	NA	NA	NA	NA
AZR83775.1|565460_566219_+	lactam utilization protein LamB	NA	NA	NA	NA	NA
AZR83776.1|567186_568158_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83777.1|568224_568983_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83778.1|569001_569445_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83779.1|569465_570278_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AZR86655.1|570283_571216_+	lipase	NA	NA	NA	NA	NA
AZR83780.1|571199_572423_+	CoA-transferase	NA	NA	NA	NA	NA
AZR83781.1|572510_573293_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83782.1|573345_577308_-	FAD-linked oxidase	NA	NA	NA	NA	NA
AZR83783.1|578045_579554_+	PLP-dependent threonine dehydratase	NA	NA	NA	NA	NA
AZR83784.1|579602_579845_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83785.1|579973_580924_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83786.1|581967_582246_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83787.1|583388_583937_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.1	1.3e-28
AZR83788.1|583999_585679_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	27.6	3.6e-16
AZR83789.1|585675_587427_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.8	3.4e-09
AZR83790.1|587423_587549_-	cyd operon protein YbgT	NA	NA	NA	NA	NA
AZR83791.1|587562_588717_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AZR83792.1|588732_590310_-	cytochrome d terminal oxidase subunit 1	NA	NA	NA	NA	NA
AZR83793.1|590435_590981_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83794.1|591154_591526_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83795.1|591540_592491_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR83796.1|592705_593401_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83797.1|593417_594830_+	hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
AZR83798.1|594942_596373_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AZR83799.1|596414_598328_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
AZR83800.1|598646_599213_+	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
AZR83801.1|599304_600306_+	restriction endonuclease	NA	NA	NA	NA	NA
AZR86656.1|600318_601260_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR83802.1|601232_602183_-|integrase	integrase	integrase	NA	NA	NA	NA
602184:602280	attR	CCGGCCGAGCTCCTTGAGTGAACTGGGGGGTTGGCGATTTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACA	NA	NA	NA	NA
>prophage 7
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	631412	691201	4095467	integrase	Staphylococcus_phage(16.67%)	56	622668:622685	695610:695627
622668:622685	attL	GTGGCCGCCGCGGTCGAG	NA	NA	NA	NA
AZR83824.1|631412_632363_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83825.1|632767_633412_-	urease accessory protein UreG	NA	NA	NA	NA	NA
AZR83826.1|633436_634021_-	Urease accessory protein UreF	NA	NA	NA	NA	NA
AZR83827.1|634121_634739_-	urease accessory protein UreE	NA	NA	NA	NA	NA
AZR83828.1|634741_636457_-	urease subunit alpha	NA	NA	NA	NA	NA
AZR83829.1|636453_636762_-	urease subunit beta	NA	NA	NA	NA	NA
AZR86659.1|636778_637396_-	urease accessory protein UreJ	NA	NA	NA	NA	NA
AZR83830.1|637440_637743_-	urease subunit gamma	NA	NA	NA	NA	NA
AZR83831.1|637843_638698_-	urease accessory protein ureD	NA	NA	NA	NA	NA
AZR83832.1|639969_640377_-	aldehyde-activating protein	NA	NA	NA	NA	NA
AZR83833.1|640746_641541_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83834.1|641584_642535_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR83835.1|643691_644738_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR83836.1|644836_645787_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83837.1|646017_647739_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
AZR83838.1|647787_648060_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	52.2	7.0e-15
AZR83839.1|648056_648428_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AZR83840.1|648523_648658_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AZR83841.1|649063_650473_+	chromosomal replication initiation protein DnaA	NA	NA	NA	NA	NA
AZR83842.1|650475_651585_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.6	1.2e-41
AZR83843.1|651679_654133_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.3e-112
AZR83844.1|654251_655043_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83845.1|655162_656590_+	amidase	NA	NA	NA	NA	NA
AZR86660.1|656628_657600_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR86661.1|657684_657888_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83846.1|658018_659182_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AZR83847.1|659269_660115_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZR83848.1|660208_661948_+	peptidase M14	NA	NA	NA	NA	NA
AZR83849.1|661968_662406_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AZR83850.1|662504_663455_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83851.1|663451_664603_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AZR83852.1|664750_665761_-	hypothetical protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.1	6.2e-16
AZR83853.1|665931_666897_-	MFS transporter	NA	NA	NA	NA	NA
AZR83854.1|667071_667902_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83855.1|667988_668255_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AZR83856.1|668259_669171_+	geranyl transferase	NA	NA	NA	NA	NA
AZR83857.1|669220_671083_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AZR83858.1|671239_672037_+	GTP cyclohydrolase	NA	NA	NA	NA	NA
AZR83859.1|672256_672637_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AZR83860.1|672684_673008_+	primosomal replication protein N	NA	NA	NA	NA	NA
AZR83861.1|673100_673373_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AZR83862.1|673388_673844_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AZR83863.1|673960_674797_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83864.1|674793_676167_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	58.2	4.0e-135
AZR83865.1|676187_677156_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
AZR83866.1|677235_678213_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AZR83867.1|678317_679997_-	phosphate starvation-inducible protein PhoH	NA	A0A2I7SAD7	Vibrio_phage	36.9	1.5e-70
AZR83868.1|680076_680541_-	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
AZR83869.1|680543_680996_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83870.1|681212_682400_+	alanine transaminase	NA	NA	NA	NA	NA
AZR83871.1|682396_683701_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AZR83872.1|683697_685104_+	threonine synthase	NA	NA	NA	NA	NA
AZR83873.1|685317_685539_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83874.1|685747_686698_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83875.1|686754_687867_+	malate dehydrogenase	NA	NA	NA	NA	NA
AZR83876.1|690250_691201_-|integrase	integrase	integrase	NA	NA	NA	NA
695610:695627	attR	GTGGCCGCCGCGGTCGAG	NA	NA	NA	NA
>prophage 8
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	700847	768114	4095467	protease,holin,transposase,integrase	uncultured_Mediterranean_phage(25.0%)	47	715328:715346	778884:778902
AZR83888.1|700847_701798_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83889.1|701965_703357_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	32.0	1.4e-29
AZR83890.1|703429_704008_+	superoxide dismutase	NA	NA	NA	NA	NA
AZR83891.1|704124_705522_+	chloride channel protein EriC	NA	NA	NA	NA	NA
AZR83892.1|705637_706843_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AZR83893.1|706942_707434_-	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	4.8e-14
AZR83894.1|707555_707801_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	76.6	1.3e-20
AZR83895.1|708028_708343_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.2e-10
AZR86663.1|709056_713622_+	alpha-2-macroglobulin	NA	NA	NA	NA	NA
AZR86662.1|713618_715787_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
715328:715346	attL	CATCGTGGCCGCGTTGCCG	NA	NA	NA	NA
AZR83896.1|715842_718158_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	3.1e-164
AZR83897.1|718162_719482_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AZR83898.1|719500_721174_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AZR83899.1|721178_721847_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83900.1|722003_725825_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZR83901.1|726155_727106_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83902.1|727127_728273_+	branched chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR83903.1|728421_729351_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR83904.1|729347_730436_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AZR83905.1|730432_731236_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	7.9e-14
AZR83906.1|731232_731964_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.4e-12
AZR83907.1|732021_733311_-	MFS transporter	NA	NA	NA	NA	NA
AZR83908.1|733407_734010_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83909.1|734952_737232_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AZR83910.1|738560_738899_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR83911.1|739606_739873_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83912.1|742525_743863_-	arabinose ABC transporter permease	NA	NA	NA	NA	NA
AZR86664.1|745123_747124_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AZR83913.1|747116_747758_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AZR83914.1|747754_748162_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
AZR83915.1|748158_748959_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83916.1|749033_749738_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AZR83917.1|749769_750564_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
AZR83918.1|750560_751511_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR83919.1|751651_752869_+	threonine ammonia-lyase	NA	NA	NA	NA	NA
AZR83920.1|752862_753474_-	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	32.5	3.3e-12
AZR83921.1|754107_755085_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
AZR83922.1|755228_755975_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
AZR83923.1|755996_756443_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AZR83924.1|757230_759462_+|holin	high-affinity choline transporter BetT	holin	NA	NA	NA	NA
AZR83925.1|759484_760285_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83926.1|760566_761799_+	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
AZR83927.1|761909_762899_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83928.1|762929_764318_+	hypothetical protein	NA	NA	NA	NA	NA
AZR83929.1|764365_765859_+	argininosuccinate lyase	NA	NA	NA	NA	NA
AZR83930.1|765917_766901_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR86665.1|767097_768114_+|transposase	transposase	transposase	NA	NA	NA	NA
778884:778902	attR	CATCGTGGCCGCGTTGCCG	NA	NA	NA	NA
>prophage 9
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	791104	852688	4095467	holin,integrase	Vibrio_phage(12.5%)	50	789005:789023	855346:855364
789005:789023	attL	GTGCCGCCGCCGGCGGCCA	NA	NA	NA	NA
AZR83946.1|791104_792055_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83947.1|792137_794096_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	30.3	8.0e-28
AZR83948.1|794123_794825_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83949.1|794829_795789_+	diacylglycerol kinase	NA	NA	NA	NA	NA
AZR83950.1|795785_796601_+	DNA repair exonuclease	NA	NA	NA	NA	NA
AZR83951.1|796665_797421_+	acid phosphatase	NA	NA	NA	NA	NA
AZR83952.1|797404_797839_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83953.1|797835_798270_-	thioesterase	NA	NA	NA	NA	NA
AZR86668.1|798271_798871_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83954.1|798843_799746_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR83955.1|800196_800904_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AZR83956.1|800878_802033_+	transferase	NA	NA	NA	NA	NA
AZR83957.1|802157_802430_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83958.1|802434_803199_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83959.1|803211_804177_-	heptosyltransferase	NA	NA	NA	NA	NA
AZR83960.1|804288_806064_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	29.5	4.0e-50
AZR83961.1|806036_807536_-	MFS transporter	NA	NA	NA	NA	NA
AZR83962.1|807619_808165_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZR83963.1|808161_809064_+	prephenate dehydratase	NA	NA	NA	NA	NA
AZR83964.1|809097_810561_-	ribonuclease	NA	NA	NA	NA	NA
AZR83965.1|810604_811555_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR83966.1|811541_811757_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83967.1|818033_820781_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AZR83968.1|820801_821425_-	septum formation protein Maf	NA	NA	NA	NA	NA
AZR83969.1|821436_821907_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AZR83970.1|821918_822305_-	ribosome silencing factor	NA	NA	NA	NA	NA
AZR86669.1|822366_822954_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AZR83971.1|822950_823862_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AZR83972.1|823877_825188_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AZR83973.1|825285_826017_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83974.1|826171_827692_+	ATP-binding protein	NA	A0A248XCZ8	Klebsiella_phage	44.9	1.7e-78
AZR86670.1|827764_829108_+	sodium:alanine symporter	NA	NA	NA	NA	NA
AZR83975.1|829142_830432_-	aminotransferase	NA	A0A1C9EHH3	Mycobacterium_phage	22.5	1.8e-07
AZR83976.1|830649_831582_+	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
AZR83977.1|831592_833086_-	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
AZR83978.1|833082_834006_-	hypothetical protein	NA	NA	NA	NA	NA
AZR83979.1|834008_835271_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AZR86671.1|835290_836304_-	acetylpolyamine aminohydrolase	NA	A0A2K9L4C2	Tupanvirus	35.2	1.7e-42
AZR83980.1|836376_836667_-	cupin	NA	NA	NA	NA	NA
AZR83981.1|836696_837971_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	1.2e-24
AZR83982.1|838113_839064_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR83983.1|839060_840692_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.7e-21
AZR83984.1|840702_841542_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR83985.1|841538_842555_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR83986.1|842662_844237_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR86672.1|844671_846201_+	DNA-binding protein	NA	A0A1X9I5H2	Streptococcus_phage	25.4	3.0e-14
AZR83987.1|846305_847373_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
AZR83988.1|847391_848978_-	multidrug resistance protein B	NA	NA	NA	NA	NA
AZR83989.1|848974_850165_-	hemolysin D	NA	NA	NA	NA	NA
AZR83990.1|851737_852688_-|integrase	integrase	integrase	NA	NA	NA	NA
855346:855364	attR	GTGCCGCCGCCGGCGGCCA	NA	NA	NA	NA
>prophage 10
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	1345957	1414949	4095467	tRNA,integrase	Klosneuvirus(10.0%)	56	1336431:1336447	1420680:1420696
1336431:1336447	attL	CCTGGCCGAGAACATCA	NA	NA	NA	NA
AZR84388.1|1345957_1346908_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR84389.1|1347006_1349607_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AZR84390.1|1349713_1350718_-	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR84391.1|1350826_1352167_-	hypothetical protein	NA	A0A1V0SKB7	Klosneuvirus	22.8	8.8e-18
AZR84392.1|1352207_1353236_-	silent information regulator protein Sir2	NA	NA	NA	NA	NA
AZR84393.1|1353431_1353977_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZR84394.1|1353973_1354534_+	diaminobutyrate acetyltransferase	NA	NA	NA	NA	NA
AZR86711.1|1354632_1355583_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR84395.1|1358323_1359613_-	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AZR84396.1|1359731_1360169_-	BadM/Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AZR84397.1|1360212_1361421_-	nitric oxide dioxygenase	NA	NA	NA	NA	NA
AZR84398.1|1361567_1362032_+|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A0K2FLI9	Brevibacillus_phage	32.4	3.9e-05
AZR84399.1|1362055_1363006_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR84400.1|1363104_1364121_-	glycine cleavage system protein T	NA	NA	NA	NA	NA
AZR84401.1|1364299_1365334_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
AZR84402.1|1365330_1365957_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	35.1	1.6e-22
AZR84403.1|1365953_1367012_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
AZR84404.1|1367061_1367832_+	DNAase	NA	NA	NA	NA	NA
AZR84405.1|1367882_1368719_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84406.1|1368915_1369656_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZR84407.1|1369730_1370474_+	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR84408.1|1371135_1371909_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.1e-31
AZR86712.1|1373046_1374336_+	glutamate dehydrogenase	NA	NA	NA	NA	NA
AZR84409.1|1375946_1377194_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AZR84410.1|1377203_1378913_-	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	27.3	5.9e-35
AZR84411.1|1378909_1379848_-	citrate lyase subunit beta	NA	NA	NA	NA	NA
AZR84412.1|1379844_1381128_-	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
AZR84413.1|1381131_1381614_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AZR84414.1|1381614_1382601_-	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR84415.1|1382773_1383493_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR84416.1|1383609_1384560_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR84417.1|1385230_1386220_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR84418.1|1387161_1388367_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR84419.1|1388562_1389048_+	glyoxalase	NA	NA	NA	NA	NA
AZR84420.1|1389031_1390249_+	monooxygenase	NA	NA	NA	NA	NA
AZR84421.1|1390425_1391352_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR84422.1|1393637_1394540_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR84423.1|1394569_1394752_-	addiction module toxin, HicA family	NA	A0A1L2JY37	Aeribacillus_phage	56.1	3.7e-12
AZR84424.1|1395524_1396706_-	MFS transporter	NA	NA	NA	NA	NA
AZR84425.1|1396921_1397599_-	phosphoglycolate phosphatase, bacterial	NA	NA	NA	NA	NA
AZR84426.1|1397595_1398321_-	bifunctional 3-demethylubiquinol 3-O-methyltransferase/2-polyprenyl-6-hydroxyphenol methylase	NA	NA	NA	NA	NA
AZR84427.1|1398446_1399028_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84428.1|1399398_1402116_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.5	3.3e-104
AZR86713.1|1402118_1403249_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	44.0	4.9e-78
AZR84429.1|1403241_1404327_+	chorismate mutase	NA	NA	NA	NA	NA
AZR84430.1|1404413_1405313_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
AZR84431.1|1405309_1406638_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZR84432.1|1406652_1407324_+	cytidylate kinase	NA	NA	NA	NA	NA
AZR84433.1|1407511_1409227_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AZR84434.1|1409228_1409588_+	integration host factor subunit beta	NA	NA	NA	NA	NA
AZR84435.1|1409779_1410094_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84436.1|1410136_1411357_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
AZR84437.1|1411353_1412295_+	hypothetical protein	NA	A0A2H4N7X4	Lake_Baikal_phage	28.1	1.5e-16
AZR84438.1|1412291_1413281_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SJ87	Synechococcus_phage	34.4	2.2e-26
AZR86714.1|1413570_1413900_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84439.1|1413998_1414949_+|integrase	integrase	integrase	NA	NA	NA	NA
1420680:1420696	attR	CCTGGCCGAGAACATCA	NA	NA	NA	NA
>prophage 11
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	1434351	1506502	4095467	transposase,integrase	Enterococcus_phage(20.0%)	59	1445903:1445925	1509934:1509956
AZR84457.1|1434351_1435302_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR84458.1|1435406_1436456_+	aldo/keto reductase	NA	NA	NA	NA	NA
AZR86716.1|1436552_1437569_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR84459.1|1439077_1439650_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AZR84460.1|1439709_1440441_+	pseudouridylate synthase	NA	NA	NA	NA	NA
AZR86717.1|1440492_1441410_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR84461.1|1445394_1446777_+	multidrug transporter	NA	NA	NA	NA	NA
1445903:1445925	attL	CGCTGACGCGCCAGACGCTGGCG	NA	NA	NA	NA
AZR84462.1|1446846_1447098_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84463.1|1447245_1447860_-	electron transporter	NA	NA	NA	NA	NA
AZR86718.1|1448046_1450107_-	oligopeptidase A	NA	NA	NA	NA	NA
AZR84464.1|1450236_1451088_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.1e-33
AZR84465.1|1451084_1451711_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZR84466.1|1451707_1453462_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AZR84467.1|1453754_1456460_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AZR84468.1|1456472_1458119_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AZR84469.1|1458131_1459907_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.2	2.4e-39
AZR84470.1|1460128_1461304_-	flagellin	NA	NA	NA	NA	NA
AZR84471.1|1461346_1462297_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR84472.1|1462395_1463136_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AZR84473.1|1463330_1465367_+	transketolase	NA	NA	NA	NA	NA
AZR84474.1|1465384_1466395_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZR84475.1|1466512_1467706_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
AZR84476.1|1467735_1468509_-	enoyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
AZR84477.1|1468505_1469696_-	acetate kinase	NA	NA	NA	NA	NA
AZR84478.1|1469721_1470660_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AZR86719.1|1470656_1473005_-	3-hydroxyalkanoate synthetase	NA	NA	NA	NA	NA
AZR84479.1|1473159_1473801_-	glutathione S-transferase	NA	NA	NA	NA	NA
AZR84480.1|1475314_1475863_-	diguanylate cyclase	NA	NA	NA	NA	NA
AZR84481.1|1475881_1476367_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AZR84482.1|1476544_1477483_+	cytochrome C biogenesis protein	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	24.1	5.6e-11
AZR84483.1|1477485_1477803_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AZR84484.1|1477848_1478793_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84485.1|1478813_1480289_-	nuclease PIN	NA	NA	NA	NA	NA
AZR84486.1|1480473_1481124_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AZR84487.1|1481177_1481513_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86720.1|1481527_1482370_+	peptidase	NA	A0A292GJG6	Xanthomonas_phage	35.4	4.4e-15
AZR84488.1|1482386_1482668_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84489.1|1482741_1483005_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZR84490.1|1483296_1484199_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR84491.1|1484195_1486061_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AZR86721.1|1486318_1487848_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AZR84492.1|1487959_1488610_-	NAD(P)H dehydrogenase	NA	NA	NA	NA	NA
AZR84493.1|1489662_1490958_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84494.1|1490979_1491864_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR86722.1|1491962_1492838_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
AZR84495.1|1492827_1493184_-	RNA signal recognition particle	NA	NA	NA	NA	NA
AZR84496.1|1493314_1494289_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZR84497.1|1494418_1494598_-	DUF3008 domain-containing protein	NA	NA	NA	NA	NA
AZR84498.1|1494740_1495220_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84499.1|1496179_1496551_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR84500.1|1496547_1497099_+	ATPase	NA	NA	NA	NA	NA
AZR84501.1|1498822_1499503_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR84502.1|1499750_1500215_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84503.1|1500384_1501314_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86723.1|1501326_1501920_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84504.1|1502047_1503865_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	2.3e-37
AZR84505.1|1503948_1504899_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR84506.1|1504997_1505534_-	acetyltransferase	NA	NA	NA	NA	NA
AZR84507.1|1505551_1506502_+|integrase	integrase	integrase	NA	NA	NA	NA
1509934:1509956	attR	CGCTGACGCGCCAGACGCTGGCG	NA	NA	NA	NA
>prophage 12
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	1519729	1567371	4095467	transposase,integrase	Erysipelothrix_phage(100.0%)	41	1511843:1511860	1574855:1574872
1511843:1511860	attL	CGGCGCCGACGACCAGCA	NA	NA	NA	NA
AZR86725.1|1519729_1520746_+|transposase	transposase	transposase	NA	NA	NA	NA
AZR84519.1|1520888_1522241_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.4	8.5e-45
AZR84520.1|1522415_1522712_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84521.1|1522858_1523761_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR84522.1|1524394_1525033_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84523.1|1525107_1526079_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84524.1|1526082_1526937_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AZR84525.1|1526955_1527774_+	hydrolase	NA	NA	NA	NA	NA
AZR84526.1|1527805_1529254_+	amidase	NA	NA	NA	NA	NA
AZR86726.1|1529250_1530045_+	oxidoreductase	NA	NA	NA	NA	NA
AZR84527.1|1530330_1531836_-	microcystin degradation protein MlrC	NA	NA	NA	NA	NA
AZR84528.1|1531877_1532660_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AZR84529.1|1532729_1533176_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84530.1|1533172_1534399_-	NnrS family protein	NA	NA	NA	NA	NA
AZR84531.1|1534391_1534796_-	preprotein translocase subunit TatC	NA	NA	NA	NA	NA
AZR84532.1|1534955_1535258_+	SelT/selW/selH domain protein	NA	NA	NA	NA	NA
AZR84533.1|1535254_1536205_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR84534.1|1536303_1536711_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84535.1|1536943_1537375_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84536.1|1537556_1537961_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR84537.1|1538165_1539203_+	peptidase M4	NA	NA	NA	NA	NA
AZR84538.1|1539199_1539523_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84539.1|1539525_1540413_-	aldo/keto reductase	NA	NA	NA	NA	NA
AZR84540.1|1540445_1540871_-	universal stress protein	NA	NA	NA	NA	NA
AZR84541.1|1540942_1541296_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84542.1|1541535_1542042_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84543.1|1542080_1543412_-	transcriptional regulator PtsJ	NA	NA	NA	NA	NA
AZR84544.1|1543471_1544287_+	YggS family pyridoxal phosphate enzyme	NA	NA	NA	NA	NA
AZR84545.1|1544283_1545138_+	bifunctional pyridoxal kinase/hydroxymethylpyrimidine kinase	NA	NA	NA	NA	NA
AZR86727.1|1548200_1550744_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
AZR84546.1|1550740_1551682_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84547.1|1551666_1552050_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84548.1|1552289_1553240_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR84549.1|1553219_1554914_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
AZR84550.1|1554910_1557031_-	glycogen debranching enzyme GlgX	NA	NA	NA	NA	NA
AZR84551.1|1557035_1559231_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
AZR84552.1|1559227_1560226_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84553.1|1560384_1561287_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR84554.1|1563629_1565162_-	alpha-amylase	NA	NA	NA	NA	NA
AZR84555.1|1565155_1566298_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84556.1|1566420_1567371_+|integrase	integrase	integrase	NA	NA	NA	NA
1574855:1574872	attR	TGCTGGTCGTCGGCGCCG	NA	NA	NA	NA
>prophage 13
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	1579537	1641312	4095467	transposase,integrase	Streptococcus_phage(16.67%)	51	1614135:1614151	1649203:1649219
AZR86728.1|1579537_1580554_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR84569.1|1580745_1583082_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	42.8	3.2e-124
AZR84570.1|1583164_1583599_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AZR84571.1|1583697_1584648_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR84572.1|1584644_1586477_-	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	1.3e-27
AZR84573.1|1586875_1587535_+	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
AZR84574.1|1587883_1588051_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84575.1|1588062_1588743_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84576.1|1589024_1589741_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84577.1|1589755_1591057_-	phospholipase	NA	NA	NA	NA	NA
AZR84578.1|1596321_1597674_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84579.1|1597702_1598224_+	acetyl-CoA carboxylase, biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AZR84580.1|1598220_1599675_+	carboxylase	NA	NA	NA	NA	NA
AZR84581.1|1599709_1599958_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84582.1|1600063_1600939_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84583.1|1600964_1602020_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84584.1|1602032_1602824_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR84585.1|1602856_1604227_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AZR84586.1|1605451_1606354_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR84587.1|1606353_1606827_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84588.1|1606872_1607094_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
AZR84589.1|1607105_1607816_+	acetyl-CoA synthetase	NA	NA	NA	NA	NA
AZR84590.1|1607823_1609320_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
AZR84591.1|1609358_1610366_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR84592.1|1610468_1611026_+	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
AZR84593.1|1611043_1612330_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84594.1|1612342_1613470_+	MFS transporter	NA	NA	NA	NA	NA
AZR84595.1|1613570_1614803_+	ferredoxin reductase	NA	NA	NA	NA	NA
1614135:1614151	attL	CTGTCCGAGACGCTGGC	NA	NA	NA	NA
AZR84596.1|1614901_1615312_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86729.1|1615344_1616148_+	2-oxo-hepta-3-ene-1,7-dioic acid hydratase	NA	NA	NA	NA	NA
AZR84597.1|1616204_1617155_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR84598.1|1617306_1617909_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84599.1|1617927_1618560_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AZR84600.1|1618797_1620684_+	cell division protein FtsH	NA	M4QMW8	Micromonas_pusilla_virus	41.5	1.4e-109
AZR84601.1|1620702_1621545_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.2	2.7e-25
AZR84602.1|1621541_1622900_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AZR84603.1|1623120_1623915_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84604.1|1624145_1625639_-	exopolyphosphatase	NA	NA	NA	NA	NA
AZR84605.1|1625874_1627956_+	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
AZR84606.1|1628150_1629191_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	40.2	2.1e-51
AZR84607.1|1629325_1630342_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AZR84608.1|1630384_1631221_+	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AZR86730.1|1631265_1632042_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	4.3e-17
AZR84609.1|1632409_1633360_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR84610.1|1633891_1634860_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR84611.1|1635181_1636189_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84612.1|1636248_1637043_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AZR84613.1|1637195_1638083_+	citryl-CoA lyase	NA	NA	NA	NA	NA
AZR84614.1|1638112_1638568_+	dehydratase	NA	NA	NA	NA	NA
AZR86731.1|1638646_1639879_+	formyl-CoA transferase	NA	NA	NA	NA	NA
AZR84615.1|1640361_1641312_+|integrase	integrase	integrase	NA	NA	NA	NA
1649203:1649219	attR	CTGTCCGAGACGCTGGC	NA	NA	NA	NA
>prophage 15
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	1793170	1854841	4095467	protease,integrase	Lake_Baikal_phage(20.0%)	56	1793172:1793231	1863651:1864697
AZR84736.1|1793170_1794121_-|integrase	integrase	integrase	NA	NA	NA	NA
1793172:1793231	attL	TAGCTGTGAACTGTCAATAGGTTGTATTCGTCCAGGTTGAGTCTGGAGATGGGTACAGCG	NA	NA	NA	NA
AZR84737.1|1794292_1794493_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.4	7.4e-14
AZR84738.1|1794604_1795165_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.7	1.0e-23
AZR84739.1|1795361_1796672_+	trigger factor	NA	NA	NA	NA	NA
AZR84740.1|1796674_1797328_+	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.5	6.8e-56
AZR84741.1|1797432_1798737_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.2e-129
AZR84742.1|1798925_1801379_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.0	1.5e-220
AZR84743.1|1801502_1802453_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR84744.1|1802680_1803904_+	CoA-transferase	NA	NA	NA	NA	NA
AZR84745.1|1803969_1804941_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR84746.1|1804945_1805410_+	oxidoreductase	NA	NA	NA	NA	NA
AZR86741.1|1805429_1806227_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AZR84747.1|1806223_1806655_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84748.1|1806651_1807809_+	thiolase	NA	NA	NA	NA	NA
AZR84749.1|1807830_1808607_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AZR84750.1|1810819_1811488_+	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AZR84751.1|1811480_1812122_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AZR84752.1|1812156_1812888_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84753.1|1812905_1813118_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84754.1|1813730_1814633_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR84755.1|1814629_1814989_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84756.1|1815621_1816524_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR84757.1|1817239_1817890_-	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	3.3e-10
AZR84758.1|1818018_1819221_-	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AZR84759.1|1819298_1821335_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AZR84760.1|1821587_1822079_+	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AZR84761.1|1822294_1822807_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AZR84762.1|1822824_1824036_+	cysteine desulfurase IscS	NA	NA	NA	NA	NA
AZR84763.1|1824069_1824480_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	7.5e-53
AZR84764.1|1824481_1824805_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	52.8	6.8e-25
AZR84765.1|1824807_1825320_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
AZR84766.1|1825449_1827312_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.4	5.2e-101
AZR84767.1|1827321_1827663_+	ferredoxin, 2Fe-2S type, ISC system	NA	NA	NA	NA	NA
AZR84768.1|1827662_1827857_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AZR84769.1|1827981_1828875_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AZR84770.1|1828897_1829707_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AZR84771.1|1829955_1830858_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR84772.1|1832130_1833348_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84773.1|1833344_1834400_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AZR84774.1|1834404_1835307_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR84775.1|1835383_1836256_+	molybdenum cofactor biosysynthesis protein	NA	NA	NA	NA	NA
AZR84776.1|1836386_1836755_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AZR84777.1|1836812_1837859_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AZR84778.1|1838054_1839311_+	amino acid dehydrogenase	NA	NA	NA	NA	NA
AZR84779.1|1839315_1840653_+	glycerol-3-phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR84780.1|1840802_1841759_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR84781.1|1841855_1843232_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84782.1|1843218_1843584_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84783.1|1843631_1845206_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR84784.1|1845258_1846203_+	peptide ABC transporter	NA	NA	NA	NA	NA
AZR86742.1|1846130_1847051_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AZR84785.1|1847043_1848678_+	microcin ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	8.2e-18
AZR84786.1|1848674_1850030_+	amidase	NA	NA	NA	NA	NA
AZR84787.1|1850936_1852514_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84788.1|1852517_1853792_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84789.1|1853938_1854841_+|integrase	integrase	integrase	NA	NA	NA	NA
1863651:1864697	attR	TAGCTGTGAACTGTCAATAGGTTGTATTCGTCCAGGTTGAGTCTGGAGATGGGTACAGCGCGCCCGATGCCTTGGTGGGGTCGATGCCAGTTGTAGTGGTGTAGCCAGGATTTCATGGCATCGGCTCGGTGTTGGGAGTTCTGGTAGGTGTGAGCGTAAGCCCACTCACGCAAGGCCGACTGGATGAAGCGTTCGGCCTTGCCATTGGTCTGTGGGCGGTAAGGTCGGGTAAAGCGGTGCTTGATGCCCAGCTCATGGCACAGCGCGGCGAAGGCGCGGCTGCGAAAGGCCGAGCCATTGTCGGTGAGCAAGCGCTGGATGGTCACGCCCAGGCGCTGGTAGTAGGCCACTGCGTCCTTGAGGAACTGGACGGCGCTGGGGAAGCGCTCGTCGGGGTGGATGTCGGTGAAGGCCACGCGGGCGTGGTCATCGATGGCCACGAAGACGAAGTCCCAGCCGGCCCCCTCAACGGTATCGCGTCGGTTGCCCGTGACCCGGTGGCCAGGGCGCTGGATACGTCCCAGCTTCTTGATGTCGATGTGCAGCAGATCGCCGGGGGCCTGATGCTCGTAGCGCACCACCGGCTCGGCCGGCTCCAGGTCGGCCAGGTGCGACAGACCGGCGCGGGCCAGGACGCGGCTGACGGTGCTGGCTGACACGCCCAGCGCCTGGGCGATGCGCGCTTGGGTCAGCCGCTTGCGGCGCAGCTCCACGATAGCCAGCGCCTTGGCCGGCGCAATCGCTCGGGGCGAGACCGTCGGGCGCGAGGACGCATCGGCCAAGCCCGCCTGGCCCTGAGCCAGGAAGCGGCCCAGCCATTTGCGCACAGTCGGCGCGGTGACCCCATAGGCGCGGGCCGCTTCAGGCACACAAACTTGATGGGCGATCAATTGCTGGACCATTTCGAGTCGACGTAGGAAGGTCAATCGGGCATGCTTATGGGTGTTCATCCGGCCGGGCTCCTTGAGTGAACTGGGGGGTCGGCGATTTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACA	NA	NA	NA	NA
>prophage 16
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	1859680	1922454	4095467	integrase,tRNA	Klosneuvirus(25.0%)	54	1874116:1874134	1922565:1922583
AZR84795.1|1859680_1862305_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.4	1.7e-81
AZR84796.1|1862291_1862546_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84797.1|1862702_1863653_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR84798.1|1863649_1864552_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR84799.1|1864698_1865601_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR84800.1|1866920_1867886_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR84801.1|1868023_1868935_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR84802.1|1869462_1871289_+	DUF3604 domain-containing protein	NA	NA	NA	NA	NA
AZR84803.1|1871646_1873017_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84804.1|1873027_1874224_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
1874116:1874134	attL	CCGCGCCGGCGCGCGCCAG	NA	NA	NA	NA
AZR84805.1|1874296_1875616_+	acyl--CoA ligase	NA	NA	NA	NA	NA
AZR84806.1|1875612_1876488_+	esterase	NA	NA	NA	NA	NA
AZR84807.1|1876518_1877667_-	carnitine dehydratase	NA	NA	NA	NA	NA
AZR84808.1|1877684_1877999_-	2Fe-2S ferredoxin	NA	NA	NA	NA	NA
AZR84809.1|1878020_1878743_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AZR84810.1|1878742_1879561_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AZR84811.1|1879565_1880093_-	ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
AZR84812.1|1880098_1881355_-	ring-hydroxylating oxygenase subunit alpha	NA	NA	NA	NA	NA
AZR84813.1|1881713_1882853_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR84814.1|1882930_1883803_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR84815.1|1884721_1885624_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR84816.1|1885583_1885997_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	59.0	3.8e-36
AZR84817.1|1886281_1886581_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84818.1|1886990_1889273_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.1	3.2e-36
AZR84819.1|1889958_1892010_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.9	1.0e-65
AZR84820.1|1892029_1892242_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AZR84821.1|1892519_1893059_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AZR84822.1|1893172_1894468_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	33.5	3.0e-63
AZR84823.1|1894544_1895702_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
AZR84824.1|1895885_1896785_-	HflC protein	NA	NA	NA	NA	NA
AZR84825.1|1896803_1898108_-	HflK protein	NA	NA	NA	NA	NA
AZR84826.1|1898073_1899180_-	GTPase HflX	NA	NA	NA	NA	NA
AZR84827.1|1899267_1899504_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AZR84828.1|1899642_1900713_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	25.7	2.5e-15
AZR84829.1|1900716_1902072_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AZR86743.1|1902098_1903256_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AZR84830.1|1903261_1903900_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84831.1|1903901_1905197_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AZR84832.1|1905246_1906533_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
AZR84833.1|1906548_1907055_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR84834.1|1907051_1908200_-	23S rRNA (adenine(2503)-C(2))-methyltransferase	NA	NA	NA	NA	NA
AZR84835.1|1908227_1908653_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.2	2.1e-21
AZR84836.1|1908975_1911858_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	3.7e-138
AZR84837.1|1911950_1912706_-	hypothetical protein	NA	NA	NA	NA	NA
AZR84838.1|1913471_1914821_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AZR84839.1|1914919_1915870_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR84840.1|1915943_1916417_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84841.1|1916442_1917651_+	class V aminotransferase	NA	NA	NA	NA	NA
AZR84842.1|1917647_1918421_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AZR84843.1|1918420_1919044_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AZR84844.1|1919209_1919470_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AZR84845.1|1919773_1920355_+	hypothetical protein	NA	NA	NA	NA	NA
AZR84846.1|1920502_1921405_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR84847.1|1921551_1922454_+|integrase	integrase	integrase	NA	NA	NA	NA
1922565:1922583	attR	CTGGCGCGCGCCGGCGCGG	NA	NA	NA	NA
>prophage 17
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	2169510	2225607	4095467	integrase	Salmonella_phage(33.33%)	51	2204992:2205011	2230529:2230548
AZR85042.1|2169510_2170461_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR85043.1|2170578_2170932_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86762.1|2170949_2171408_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZR85044.1|2171478_2172081_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85045.1|2172220_2172466_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86763.1|2172580_2174008_-	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AZR85046.1|2174082_2175033_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR85047.1|2175029_2175479_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	S4TNT3	Salmonella_phage	67.2	3.7e-45
AZR85048.1|2175743_2176523_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR85049.1|2177507_2178686_-	mandelate racemase	NA	NA	NA	NA	NA
AZR85050.1|2178705_2179701_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85051.1|2181287_2181896_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AZR85052.1|2181883_2182924_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZR85053.1|2182941_2183904_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85054.1|2183900_2185094_-	formyl-CoA transferase	NA	NA	NA	NA	NA
AZR85055.1|2185090_2185888_-	citryl-CoA lyase	NA	NA	NA	NA	NA
AZR85056.1|2185913_2186900_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85057.1|2186918_2188958_-	acetyl-CoA synthetase	NA	NA	NA	NA	NA
AZR86764.1|2189159_2189840_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR85058.1|2189853_2190765_-	malyl-CoA thiolesterase	NA	NA	NA	NA	NA
AZR85059.1|2190761_2191340_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AZR85060.1|2191478_2192384_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR85061.1|2192391_2195811_+	nuclease	NA	NA	NA	NA	NA
AZR85062.1|2195798_2198399_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AZR85063.1|2199354_2199987_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZR85064.1|2200380_2201139_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85065.1|2201135_2202338_+	cardiolipin synthase B	NA	NA	NA	NA	NA
AZR85066.1|2202334_2203282_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85067.1|2203335_2204481_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85068.1|2204467_2205223_+	permease	NA	NA	NA	NA	NA
2204992:2205011	attL	CGGCGACGTGCTGATCGTGG	NA	NA	NA	NA
AZR85069.1|2205339_2205519_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85070.1|2205584_2206535_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR85071.1|2206771_2207422_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85072.1|2207507_2207867_-	murein hydrolase transporter LrgA	NA	NA	NA	NA	NA
AZR85073.1|2207854_2209291_-	dethiobiotin synthase	NA	NA	NA	NA	NA
AZR85074.1|2209287_2209941_-	biotin synthase	NA	NA	NA	NA	NA
AZR85075.1|2209937_2211131_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AZR85076.1|2211234_2212509_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	9.6e-14
AZR85077.1|2213036_2213987_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR86765.1|2214593_2214737_+	cytochrome oxidase maturation protein, cbb3-type	NA	NA	NA	NA	NA
AZR85078.1|2216358_2217021_+	cytochrome c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
AZR85079.1|2217023_2217200_+	cytochrome oxidase	NA	NA	NA	NA	NA
AZR85080.1|2218222_2219713_+	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
AZR85081.1|2219798_2219951_+	lipoprotein	NA	NA	NA	NA	NA
AZR85082.1|2219964_2220204_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85083.1|2220299_2221043_+	permease	NA	NA	NA	NA	NA
AZR86766.1|2221075_2221576_+	GCN5 family acetyltransferase	NA	NA	NA	NA	NA
AZR85084.1|2221674_2222598_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.6	1.6e-23
AZR85085.1|2222594_2223356_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZR86767.1|2223371_2224454_-	AI-2E family transporter	NA	NA	NA	NA	NA
AZR85086.1|2224656_2225607_+|integrase	integrase	integrase	NA	NA	NA	NA
2230529:2230548	attR	CCACGATCAGCACGTCGCCG	NA	NA	NA	NA
>prophage 18
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	2286067	2340309	4095467	transposase,tRNA,integrase	uncultured_Mediterranean_phage(15.38%)	48	2316588:2316607	2343405:2343424
AZR85136.1|2286067_2287018_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR85137.1|2287116_2288202_-	DNA polymerase IV	NA	NA	NA	NA	NA
AZR85138.1|2288299_2288710_+	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AZR85139.1|2289323_2291237_+	peptidase	NA	NA	NA	NA	NA
AZR85140.1|2291372_2293985_+	penicillin-binding protein	NA	NA	NA	NA	NA
AZR85141.1|2294083_2295736_+	hypothetical protein	NA	A0A2H4PQR8	Staphylococcus_phage	47.1	1.5e-59
AZR85142.1|2295781_2296762_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZR85143.1|2296758_2296971_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85144.1|2296967_2298149_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85145.1|2298312_2299047_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	50.0	1.3e-63
AZR85146.1|2299048_2299999_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR85147.1|2300109_2300550_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85148.1|2300678_2301908_-	lytic transglycosylase	NA	NA	NA	NA	NA
AZR85149.1|2301946_2302768_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85150.1|2302821_2303973_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85151.1|2304064_2304535_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85152.1|2307103_2309653_+	cyanophycin synthetase	NA	NA	NA	NA	NA
AZR85153.1|2309723_2312297_+	cyanophycin synthetase	NA	NA	NA	NA	NA
AZR85154.1|2312562_2312763_+	general stress protein CsbD	NA	NA	NA	NA	NA
AZR85155.1|2312794_2312956_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
AZR85156.1|2313013_2313352_+	phospholipid-binding protein	NA	NA	NA	NA	NA
AZR85157.1|2313500_2314403_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR85158.1|2314549_2315455_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR85159.1|2315558_2316521_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86772.1|2316524_2317196_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	40.8	2.2e-33
2316588:2316607	attL	GTCGTGGGTGACCAGCACCA	NA	NA	NA	NA
AZR85160.1|2317194_2317863_+	arylesterase	NA	NA	NA	NA	NA
AZR86771.1|2317844_2319800_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AZR85161.1|2320042_2320792_+	glycerophosphodiester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	27.8	1.5e-14
AZR85162.1|2320804_2321668_+	competence protein ComJ	NA	NA	NA	NA	NA
AZR85163.1|2321671_2323087_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
AZR85164.1|2323220_2323949_-	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	56.8	9.6e-43
AZR85165.1|2324087_2324288_-	heavy metal transporter	NA	NA	NA	NA	NA
AZR85166.1|2324463_2324862_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AZR85167.1|2324885_2326286_-	23S rRNA (uracil(1939)-C(5))-methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	26.5	7.3e-31
AZR85168.1|2326404_2327157_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85169.1|2327445_2328045_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85170.1|2328149_2328929_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AZR85171.1|2328925_2329810_-	peptidase	NA	A0A292GJG6	Xanthomonas_phage	49.5	4.6e-15
AZR85172.1|2329827_2330607_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.9	4.8e-32
AZR85173.1|2330591_2331350_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.8	5.2e-68
AZR86773.1|2331487_2332123_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZR86774.1|2332390_2333407_+|transposase	transposase	transposase	NA	NA	NA	NA
AZR85174.1|2333504_2334455_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR85175.1|2334553_2335594_-|tRNA	tRNA N6-adenosine(37)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.6	9.3e-92
AZR85176.1|2335728_2337021_+	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	2.9e-66
AZR85177.1|2338380_2338764_+	thiol reductase thioredoxin	NA	V9SJ74	Achromobacter_phage	25.8	8.1e-09
AZR85178.1|2338781_2339369_-	thymidylate synthase	NA	A0A1X9I5T8	Streptococcus_phage	35.8	4.7e-16
AZR85179.1|2339406_2340309_-|integrase	integrase	integrase	NA	NA	NA	NA
2343405:2343424	attR	GTCGTGGGTGACCAGCACCA	NA	NA	NA	NA
>prophage 19
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	2351736	2408403	4095467	integrase,tRNA	uncultured_Caudovirales_phage(33.33%)	51	2364042:2364101	2403190:2403291
AZR86775.1|2351736_2352186_-|tRNA	tRNA-specific adenosine deaminase	tRNA	S4VYT2	Pandoravirus	38.2	2.0e-06
AZR85189.1|2352235_2353084_-	hydrolase	NA	NA	NA	NA	NA
AZR85190.1|2353247_2354198_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR85191.1|2354230_2354800_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85192.1|2354843_2355794_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR85193.1|2355949_2356276_-	cation:proton antiporter	NA	NA	NA	NA	NA
AZR85194.1|2356272_2356554_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
AZR85195.1|2356553_2357030_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
AZR85196.1|2357029_2358658_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
AZR85197.1|2358654_2358999_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
AZR85198.1|2358998_2361932_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
AZR85199.1|2363090_2364041_-|integrase	integrase	integrase	NA	NA	NA	NA
2364042:2364101	attL	CCGGCCGGGCTCCTTGAGTGAACTGGGGGATCGGCGATTTCCAGTTTCTCAAATCCGGTT	NA	NA	NA	NA
AZR85200.1|2364139_2364436_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85201.1|2364542_2365460_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR85202.1|2365464_2366178_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
AZR85203.1|2366191_2367163_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR85204.1|2367266_2368679_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85205.1|2368912_2369263_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR85206.1|2369266_2370454_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86776.1|2370892_2371615_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	1.3e-87
AZR85207.1|2371611_2371803_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85208.1|2371956_2372859_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR85209.1|2373720_2374716_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85210.1|2374755_2375961_+	monooxygenase	NA	NA	NA	NA	NA
AZR85211.1|2376304_2377516_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
AZR85212.1|2377546_2378014_-	thioesterase	NA	NA	NA	NA	NA
AZR85213.1|2378010_2379165_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZR85214.1|2379161_2380346_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AZR85215.1|2380342_2382427_-	crotonase	NA	NA	NA	NA	NA
AZR85216.1|2382437_2383412_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR85217.1|2383442_2384255_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AZR85218.1|2385661_2386633_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86777.1|2386794_2387595_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR85219.1|2387811_2388624_+	3-oxoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	36.8	1.1e-07
AZR85220.1|2388768_2389785_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85221.1|2389864_2390284_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85222.1|2390789_2391740_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR85223.1|2391743_2392910_+	carnitine dehydratase	NA	NA	NA	NA	NA
AZR85224.1|2393061_2393889_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZR86778.1|2393902_2394493_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZR85225.1|2394649_2395354_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	8.4e-12
AZR85226.1|2395532_2396435_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR86779.1|2398046_2399198_+	Bcr/CflA family drug resistance efflux transporter	NA	NA	NA	NA	NA
AZR85227.1|2399566_2399803_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AZR85228.1|2399866_2400034_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AZR85229.1|2400147_2401941_-	sulfate transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.5	4.8e-19
AZR85230.1|2402238_2403189_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR85231.1|2403465_2403903_+	DNA-binding protein	NA	NA	NA	NA	NA
2403190:2403291	attR	CCGGCCGGGCTCCTTGAGTGAACTGGGGGATCGGCGATTTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTAG	NA	NA	NA	NA
AZR85232.1|2404025_2404538_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZR85233.1|2404534_2405668_+	transporter	NA	NA	NA	NA	NA
AZR85234.1|2405745_2408403_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.1	1.1e-173
>prophage 20
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	2444146	2518876	4095467	tRNA,integrase	Catovirus(22.22%)	60	2440229:2440249	2524319:2524339
2440229:2440249	attL	GGATGGCGGCGGCCGGCGCGC	NA	NA	NA	NA
AZR85263.1|2444146_2445049_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR85264.1|2445125_2446742_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85265.1|2446720_2447833_-	transferase	NA	NA	NA	NA	NA
AZR85266.1|2447829_2448582_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AZR85267.1|2448578_2449430_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85268.1|2449422_2450526_-	glycosyl transferase	NA	NA	NA	NA	NA
AZR85269.1|2450525_2454017_-	DNA polymerase III subunit alpha	NA	A0A0K1Y9G6	Streptomyces_phage	37.6	1.7e-185
AZR86783.1|2454154_2455054_+	aspartyl beta-hydroxylase	NA	S4VR59	Pandoravirus	36.8	2.4e-35
AZR85270.1|2455185_2459070_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.7	4.5e-46
AZR85271.1|2459250_2460606_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AZR85272.1|2460679_2460952_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AZR85273.1|2461005_2462886_+	phospholipase	NA	NA	NA	NA	NA
AZR85274.1|2462899_2463679_-	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AZR85275.1|2463833_2464514_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
AZR85276.1|2464567_2466226_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZR85277.1|2466305_2467721_-	recombinase RmuC	NA	NA	NA	NA	NA
AZR85278.1|2467846_2468506_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85279.1|2468513_2469230_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AZR85280.1|2469234_2469591_-	arsenate reductase	NA	NA	NA	NA	NA
AZR85281.1|2469587_2470397_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AZR85282.1|2470393_2471308_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AZR85283.1|2471304_2472432_-	transporter	NA	Q6GZ03	Mycoplasma_phage	38.0	3.9e-27
AZR85284.1|2472438_2473542_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR85285.1|2473673_2474408_-	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
AZR85286.1|2474397_2474823_-	hemoglobin-like protein	NA	NA	NA	NA	NA
AZR86784.1|2474822_2477282_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR85287.1|2477468_2478443_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR85288.1|2478528_2479029_+	transporter	NA	NA	NA	NA	NA
AZR85289.1|2479093_2479462_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85290.1|2479554_2480505_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR85291.1|2480551_2481106_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
AZR85292.1|2481173_2482019_-	phosphatase	NA	NA	NA	NA	NA
AZR85293.1|2482088_2483057_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZR85294.1|2483056_2485531_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
AZR85295.1|2485703_2488550_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85296.1|2488840_2489017_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85297.1|2489201_2492432_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AZR85298.1|2492713_2493541_-	DNAase	NA	NA	NA	NA	NA
AZR85299.1|2493574_2494270_-	lipoprotein releasing system, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	7.0e-35
AZR86785.1|2494262_2495495_-	cell division protein FtsX	NA	NA	NA	NA	NA
AZR85300.1|2495588_2496530_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86786.1|2496511_2498212_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	1.3e-50
AZR85301.1|2498486_2499419_+	peptide chain release factor 2	NA	NA	NA	NA	NA
AZR85302.1|2499448_2500204_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AZR85303.1|2500210_2501731_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.0	1.2e-82
AZR85304.1|2501773_2502076_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85305.1|2502072_2502975_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR85306.1|2503235_2506088_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AZR85307.1|2506069_2506798_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85308.1|2506938_2508426_-	hypothetical protein	NA	A0A075BSJ0	Microcystis_phage	34.0	2.4e-48
AZR85309.1|2508422_2508794_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85310.1|2508811_2510125_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85311.1|2510161_2510620_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85312.1|2510732_2511683_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR85313.1|2511679_2512657_-|tRNA	tRNA dihydrouridine synthase DusA	tRNA	NA	NA	NA	NA
AZR85314.1|2512832_2513819_+	homoserine kinase	NA	NA	NA	NA	NA
AZR85315.1|2513862_2514663_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85316.1|2515465_2516368_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR85317.1|2516590_2517265_+	hypothetical protein	NA	A0A0U4J8W4	Pseudomonas_phage	41.8	9.5e-37
AZR85318.1|2517925_2518876_+|integrase	integrase	integrase	NA	NA	NA	NA
2524319:2524339	attR	GCGCGCCGGCCGCCGCCATCC	NA	NA	NA	NA
>prophage 21
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	2701627	2765686	4095467	transposase,tRNA,integrase	uncultured_Mediterranean_phage(50.0%)	56	2749717:2749734	2765765:2765782
AZR85457.1|2701627_2702578_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR85458.1|2702604_2703069_-	barstar family protein 2	NA	NA	NA	NA	NA
AZR85459.1|2704261_2706550_-	malate dehydrogenase	NA	NA	NA	NA	NA
AZR85460.1|2706666_2707539_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85461.1|2707581_2708736_+	aminotransferase	NA	NA	NA	NA	NA
AZR85462.1|2708770_2709601_-	lytic transglycosylase	NA	NA	NA	NA	NA
AZR85463.1|2709684_2711229_+	3-octaprenyl-4-hydroxybenzoate decarboxylase	NA	NA	NA	NA	NA
AZR85464.1|2711271_2711631_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85465.1|2711632_2712046_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85466.1|2712086_2712404_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86800.1|2712488_2713202_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86801.1|2713468_2714890_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AZR85467.1|2714956_2717680_-	pertactin	NA	NA	NA	NA	NA
AZR86802.1|2718012_2719029_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR86803.1|2719362_2720004_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AZR85468.1|2720094_2721531_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
AZR85469.1|2721688_2722762_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AZR85470.1|2722758_2723895_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	1.7e-86
AZR85471.1|2724039_2724384_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.4	1.0e-10
AZR85472.1|2724450_2726331_+	protein-export membrane protein SecD	NA	NA	NA	NA	NA
AZR85473.1|2726380_2727316_+	protein-export membrane protein SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.5	3.0e-41
AZR86804.1|2727647_2728664_+|transposase	transposase	transposase	NA	NA	NA	NA
AZR85474.1|2729585_2731013_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AZR85475.1|2731009_2732032_+	phosphate starvation-inducible protein PhoH	NA	A0A0S0MVD6	Pseudomonas_phage	45.4	8.7e-50
AZR85476.1|2732021_2732495_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
AZR85477.1|2732635_2733523_+	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AZR85478.1|2733519_2735163_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
AZR86805.1|2735159_2736167_-	aldo/keto reductase	NA	NA	NA	NA	NA
AZR86806.1|2736997_2738014_+|transposase	transposase	transposase	NA	NA	NA	NA
AZR85479.1|2738161_2738752_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZR85480.1|2738842_2739148_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86807.1|2739615_2740623_+	biotin synthase BioB	NA	NA	NA	NA	NA
AZR85481.1|2740619_2741495_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85482.1|2741569_2742970_-	MFS transporter	NA	NA	NA	NA	NA
AZR86808.1|2743047_2743551_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	44.1	1.8e-24
AZR85483.1|2743797_2744229_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85484.1|2744238_2745123_-	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
AZR85485.1|2745140_2748608_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85486.1|2748743_2749229_+	molybdenum cofactor biosynthesis protein C	NA	NA	NA	NA	NA
AZR85487.1|2749209_2749461_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
AZR86809.1|2749466_2749949_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
2749717:2749734	attL	GCGCCCTGCCGCGCGGCG	NA	NA	NA	NA
AZR85488.1|2749945_2750467_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
AZR85489.1|2750473_2751679_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AZR85490.1|2751823_2752921_-	cyclic pyranopterin phosphate synthase	NA	NA	NA	NA	NA
AZR85491.1|2752931_2754038_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR85492.1|2754172_2755123_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR85493.1|2755119_2755839_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85494.1|2755959_2758119_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
AZR85495.1|2758209_2758479_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
AZR86810.1|2758772_2759300_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85496.1|2759318_2760098_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AZR85497.1|2760265_2761282_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AZR85498.1|2761354_2761846_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AZR85499.1|2761856_2763572_-	acetolactate synthase, large subunit, biosynthetic type	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
AZR85500.1|2764042_2764654_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86811.1|2764735_2765686_+|integrase	integrase	integrase	NA	NA	NA	NA
2765765:2765782	attR	GCGCCCTGCCGCGCGGCG	NA	NA	NA	NA
>prophage 22
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	2847489	2907686	4095467	integrase	Staphylococcus_phage(20.0%)	55	2867543:2867561	2913163:2913181
AZR85572.1|2847489_2848440_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86814.1|2849214_2850072_-	permease	NA	NA	NA	NA	NA
AZR85573.1|2850250_2852230_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	44.2	5.5e-85
AZR85574.1|2852441_2853344_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR86816.1|2853490_2854714_-	MFS transporter	NA	NA	NA	NA	NA
AZR85575.1|2854827_2855235_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86815.1|2855231_2856770_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	32.2	9.7e-61
AZR85576.1|2857355_2858015_+	hypothetical protein	NA	A0A0A8WF62	Clostridium_phage	37.6	7.4e-18
AZR85577.1|2858119_2858461_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85578.1|2858817_2859720_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR85579.1|2859716_2860670_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR85580.1|2860769_2862236_-	methylmalonate-semialdehyde dehydrogenase (acylating)	NA	NA	NA	NA	NA
AZR85581.1|2862348_2863566_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR85582.1|2863705_2864626_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR85583.1|2864622_2865735_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AZR85584.1|2865788_2867288_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	39.3	1.0e-51
AZR85585.1|2867305_2867761_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
2867543:2867561	attL	GCCGCCGCCCTGGCGCTGG	NA	NA	NA	NA
AZR85586.1|2867791_2868118_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85587.1|2868216_2868927_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86817.1|2869126_2870062_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR85588.1|2870158_2871028_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
AZR85589.1|2871031_2872228_+	threonine synthase	NA	NA	NA	NA	NA
AZR85590.1|2872224_2873145_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR85591.1|2873164_2873752_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AZR85592.1|2873744_2874635_-	GTPase Era	NA	NA	NA	NA	NA
AZR85593.1|2874631_2875393_-	ribonuclease III	NA	M4QNJ2	Ostreococcus_lucimarinus_virus	33.0	3.1e-20
AZR85594.1|2876304_2878098_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.5	8.4e-24
AZR85595.1|2878228_2879716_-	serine peptidase	NA	W5SAB9	Pithovirus	31.5	1.2e-07
AZR85596.1|2879753_2880812_-	siderophore-interacting protein	NA	NA	NA	NA	NA
AZR85597.1|2880811_2881312_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85598.1|2881324_2881924_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	26.1	2.2e-05
AZR85599.1|2881920_2882421_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85600.1|2882422_2883652_-	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AZR86818.1|2883841_2884081_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	46.6	5.4e-11
AZR85601.1|2884263_2885016_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	6.9e-12
AZR85602.1|2885017_2885953_-	malonyl CoA-acyl carrier protein transacylase	NA	NA	NA	NA	NA
AZR85603.1|2886034_2887021_-	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
AZR85604.1|2887020_2888079_-	phosphate acyltransferase	NA	NA	NA	NA	NA
AZR85605.1|2888135_2888318_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AZR86819.1|2888369_2888963_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85606.1|2889071_2889671_+	septum formation protein Maf	NA	NA	NA	NA	NA
AZR85607.1|2889667_2890378_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZR85608.1|2890379_2891207_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AZR85609.1|2891353_2892256_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR85610.1|2892354_2893305_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR85611.1|2893301_2893964_-	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AZR85612.1|2893971_2894931_-	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AZR85613.1|2895087_2895759_-	HAD family hydrolase	NA	NA	NA	NA	NA
AZR85614.1|2895761_2896667_-	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AZR85615.1|2897234_2900357_+	ribonuclease E	NA	NA	NA	NA	NA
AZR85616.1|2900432_2901500_-	choloylglycine hydrolase	NA	NA	NA	NA	NA
AZR85617.1|2903560_2904439_-	acetyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
AZR85618.1|2904475_2905333_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AZR85619.1|2905336_2906536_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AZR85620.1|2906735_2907686_+|integrase	integrase	integrase	NA	NA	NA	NA
2913163:2913181	attR	GCCGCCGCCCTGGCGCTGG	NA	NA	NA	NA
>prophage 23
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	2950931	3014081	4095467	integrase	Paramecium_bursaria_Chlorella_virus(15.38%)	58	3000695:3000712	3019124:3019141
AZR85660.1|2950931_2951882_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR86822.1|2951980_2952745_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR85661.1|2952813_2953731_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AZR85662.1|2953938_2954130_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85663.1|2954210_2955182_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZR85664.1|2955284_2956238_+	hydroxyacid dehydrogenase	NA	Q89388	Paramecium_bursaria_Chlorella_virus	26.6	5.9e-16
AZR85665.1|2956384_2957110_+	short chain dehydrogenase	NA	NA	NA	NA	NA
AZR85666.1|2957221_2958130_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR86823.1|2958134_2958425_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85667.1|2958634_2959816_+	acetylornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.1	3.4e-21
AZR85668.1|2959867_2960809_+	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.4	1.1e-17
AZR85669.1|2960959_2962297_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	81.7	1.4e-55
AZR85670.1|2962381_2964292_-	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	32.4	5.4e-69
AZR85671.1|2964288_2965407_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.2	2.0e-15
AZR85672.1|2965465_2966137_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZR85673.1|2966219_2966687_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AZR85674.1|2966686_2967664_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
AZR85675.1|2967665_2968466_-	energy transducer TonB	NA	NA	NA	NA	NA
AZR85676.1|2968962_2969235_-	DNA-binding protein HU	NA	B5TA87	Burkholderia_phage	57.8	1.1e-20
AZR85677.1|2969555_2970236_-	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	29.1	4.9e-17
AZR85678.1|2970276_2971521_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85679.1|2971574_2972312_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AZR85680.1|2972436_2974866_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	31.6	3.0e-64
AZR85681.1|2975418_2976000_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AZR85682.1|2976339_2976783_-	GCN5 family acetyltransferase	NA	NA	NA	NA	NA
AZR85683.1|2976907_2977855_+	transporter	NA	NA	NA	NA	NA
AZR85684.1|2977996_2979223_+	hypothetical protein	NA	NA	NA	NA	NA
AZR85685.1|2979298_2980960_+	glutamate synthase	NA	NA	NA	NA	NA
AZR85686.1|2981106_2982009_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR85687.1|2982155_2983058_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR85688.1|2983067_2984498_-	cardiolipin synthase B	NA	NA	NA	NA	NA
AZR85689.1|2984485_2985085_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85690.1|2985416_2986391_+	dimethylhistidine N-methyltransferase	NA	NA	NA	NA	NA
AZR85691.1|2988004_2988262_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85692.1|2988278_2988515_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85693.1|2988844_2989111_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86824.1|2989132_2989456_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85694.1|2989491_2990097_+	HD family phosphohydrolase	NA	NA	NA	NA	NA
AZR85695.1|2990262_2991690_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	40.0	6.5e-19
AZR85696.1|2991704_2992352_-	nicotinamidase	NA	NA	NA	NA	NA
AZR85697.1|2992433_2993336_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR85698.1|2993482_2994601_-	Tat pathway signal protein	NA	NA	NA	NA	NA
AZR85699.1|2994590_2995592_-	aminopeptidase	NA	NA	NA	NA	NA
AZR85700.1|2995697_2997209_-	thiol oxidoreductase	NA	NA	NA	NA	NA
AZR85701.1|2997205_2998510_-	peptidase	NA	NA	NA	NA	NA
AZR86825.1|2998621_2999179_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AZR85702.1|2999449_3000004_+	NADPH-dependent FMN reductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.0	1.7e-15
AZR85703.1|3000459_3000675_-	hypothetical protein	NA	NA	NA	NA	NA
3000695:3000712	attL	TTGCTGGCCGCCGACCGG	NA	NA	NA	NA
AZR86826.1|3000929_3003527_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	22.6	2.0e-21
AZR85704.1|3003523_3004711_+	cupin	NA	NA	NA	NA	NA
AZR85705.1|3005368_3005983_+	fimbrial protein	NA	NA	NA	NA	NA
AZR85706.1|3006071_3007193_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85707.1|3007210_3008116_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AZR85708.1|3009056_3009959_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR85709.1|3009955_3010582_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AZR85710.1|3010643_3011495_+	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	35.3	7.0e-37
AZR85711.1|3012194_3012959_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AZR85712.1|3013130_3014081_+|integrase	integrase	integrase	NA	NA	NA	NA
3019124:3019141	attR	CCGGTCGGCGGCCAGCAA	NA	NA	NA	NA
>prophage 24
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	3343936	3382672	4095467	tRNA,integrase	Acinetobacter_phage(25.0%)	32	3379993:3380008	3384415:3384430
AZR85979.1|3343936_3344839_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86843.1|3344943_3345663_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85980.1|3345706_3348088_-	dehydrogenase	NA	NA	NA	NA	NA
AZR86842.1|3348080_3348590_-	4-hydroxybenzoyl-CoA reductase subunit gamma	NA	A0A0P0IVM8	Acinetobacter_phage	37.3	8.8e-19
AZR85981.1|3348808_3349711_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR85982.1|3350521_3351517_-	4,5-dihydroxyphthalate decarboxylase	NA	NA	NA	NA	NA
AZR85983.1|3351535_3352528_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR85984.1|3352768_3353329_-	3-octaprenyl-4-hydroxybenzoate carboxy-lyase	NA	NA	NA	NA	NA
AZR85985.1|3353333_3353660_-	monothiol glutaredoxin, Grx4 family	NA	NA	NA	NA	NA
AZR85986.1|3353696_3354509_-	protein-(glutamine-N5) methyltransferase, release factor-specific	NA	NA	NA	NA	NA
AZR85987.1|3354519_3355602_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.7	3.3e-07
AZR85988.1|3355688_3356963_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AZR85989.1|3357685_3358636_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR85990.1|3358831_3360304_-	magnesium transporter	NA	NA	NA	NA	NA
AZR85991.1|3360314_3360725_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AZR85992.1|3360788_3361835_-	hypothetical protein	NA	NA	NA	NA	NA
AZR85993.1|3361941_3362820_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR85994.1|3362833_3364015_-	amidohydrolase	NA	NA	NA	NA	NA
AZR85995.1|3364076_3365768_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	28.1	9.4e-33
AZR85996.1|3365764_3366715_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR85997.1|3366813_3367764_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR85998.1|3367872_3368769_-	inositol monophosphatase	NA	NA	NA	NA	NA
AZR85999.1|3371046_3373272_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AZR86000.1|3373436_3374525_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	8.7e-32
AZR86001.1|3374481_3375135_+	DL-methionine transporter permease subunit	NA	NA	NA	NA	NA
AZR86002.1|3375182_3375980_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR86003.1|3376493_3377642_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZR86004.1|3377698_3378004_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AZR86005.1|3378032_3378467_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86006.1|3379710_3380421_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
3379993:3380008	attL	CAAGCCCCGCGCGCCG	NA	NA	NA	NA
AZR86844.1|3380435_3381347_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86007.1|3381769_3382672_+|integrase	integrase	integrase	NA	NA	NA	NA
3384415:3384430	attR	CGGCGCGCGGGGCTTG	NA	NA	NA	NA
>prophage 25
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	3398978	3440661	4095467	tRNA,integrase	Bacillus_virus(16.67%)	38	3395577:3395602	3450537:3450562
3395577:3395602	attL	TCGATATCCTGGTCAACAACGCCGGC	NA	NA	NA	NA
AZR86022.1|3398978_3399929_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR86023.1|3400964_3401507_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86024.1|3401940_3402843_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86025.1|3403887_3404676_-	ABC transporter	NA	G3M9Y6	Bacillus_virus	40.0	1.1e-33
AZR86026.1|3405801_3406236_-	thioesterase	NA	NA	NA	NA	NA
AZR86027.1|3406232_3407243_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
AZR86028.1|3407286_3408213_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86029.1|3408497_3408866_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86030.1|3409130_3410033_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86031.1|3410077_3412504_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.6	3.1e-85
AZR86032.1|3412552_3413245_+	hydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.9	4.7e-07
AZR86033.1|3413317_3414517_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AZR86034.1|3414684_3415587_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86035.1|3415583_3416513_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR86036.1|3416639_3417476_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	33.3	1.6e-33
AZR86037.1|3417988_3419098_+	porin	NA	NA	NA	NA	NA
AZR86038.1|3419159_3420110_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR86039.1|3420272_3421085_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AZR86040.1|3421098_3421863_-	short-chain dehydrogenase	NA	A0A0M4JSW6	Mollivirus	26.5	3.1e-12
AZR86848.1|3421875_3423222_-	MFS transporter	NA	NA	NA	NA	NA
AZR86041.1|3423247_3424177_-	acetylxylan esterase	NA	NA	NA	NA	NA
AZR86042.1|3424292_3425198_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR86043.1|3425194_3426097_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR86044.1|3426256_3427039_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR86045.1|3427042_3428134_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86046.1|3428239_3429715_+	acid--CoA ligase	NA	Q75ZG1	Hepacivirus	25.6	3.0e-35
AZR86047.1|3429856_3430405_+	cysteine dioxygenase	NA	NA	NA	NA	NA
AZR86048.1|3430420_3430882_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR86049.1|3430982_3431972_-	MFS transporter	NA	NA	NA	NA	NA
AZR86050.1|3432270_3432972_+	riboflavin synthase subunit alpha	NA	NA	NA	NA	NA
AZR86051.1|3433010_3434384_-	amidase	NA	NA	NA	NA	NA
AZR86052.1|3434422_3435406_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86053.1|3435546_3436449_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR86054.1|3436396_3437617_-	MFS transporter	NA	NA	NA	NA	NA
AZR86055.1|3437613_3438123_-|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
AZR86056.1|3438112_3438808_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86057.1|3438878_3439748_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR86058.1|3439758_3440661_-|integrase	integrase	integrase	NA	NA	NA	NA
3450537:3450562	attR	GCCGGCGTTGTTGACCAGGATATCGA	NA	NA	NA	NA
>prophage 26
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	3507855	3555463	4095467	tRNA,integrase	Bovine_alphaherpesvirus(10.0%)	46	3535873:3535889	3556673:3556689
AZR86112.1|3507855_3508806_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86113.1|3509250_3509562_-	cell division protein ZapA	NA	NA	NA	NA	NA
AZR86114.1|3509561_3510092_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86115.1|3510302_3511205_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86116.1|3511494_3511959_+	tricarboxylate transporter	NA	NA	NA	NA	NA
AZR86117.1|3511973_3513479_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86118.1|3513735_3515340_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AZR86119.1|3515395_3516301_+	oxidoreductase	NA	NA	NA	NA	NA
AZR86120.1|3516741_3517644_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR86121.1|3517830_3518583_+	uracil-DNA glycosylase	NA	A0A1Y0B680	Bovine_alphaherpesvirus	47.5	2.5e-46
AZR86122.1|3518857_3520546_+	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.6e-48
AZR86123.1|3520634_3521825_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86124.1|3521839_3522934_-|tRNA	tRNA CCA-pyrophosphorylase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.0	7.1e-50
AZR86853.1|3522930_3524994_-	lytic transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	36.6	5.3e-14
AZR86125.1|3525069_3525750_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AZR86126.1|3526060_3527401_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR86127.1|3527402_3528422_+	acetylpolyamine aminohydrolase	NA	A0A2K9L473	Tupanvirus	31.7	3.4e-22
AZR86128.1|3528485_3529457_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR86129.1|3529521_3530424_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR86130.1|3530570_3531131_-	ATP:cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
AZR86854.1|3531555_3531861_+	RND transporter	NA	NA	NA	NA	NA
AZR86131.1|3531874_3533209_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.6	3.5e-43
AZR86132.1|3533388_3534291_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86133.1|3534270_3534819_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AZR86134.1|3534966_3535431_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AZR86135.1|3535573_3536683_-	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
3535873:3535889	attL	CATCGTGGTGGGCGTGG	NA	NA	NA	NA
AZR86136.1|3536959_3537463_-	transcriptional repressor	NA	NA	NA	NA	NA
AZR86137.1|3537600_3537801_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86138.1|3537791_3538514_+	ABC transporter	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	1.1e-11
AZR86139.1|3538510_3539407_+	zinc ABC transporter permease	NA	NA	NA	NA	NA
AZR86140.1|3539403_3540339_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR86141.1|3540299_3540968_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86142.1|3540958_3541927_+	nickel transporter	NA	NA	NA	NA	NA
AZR86143.1|3541975_3544117_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZR86144.1|3544129_3545110_-	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	30.5	3.3e-14
AZR86145.1|3545124_3545817_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86146.1|3545843_3546755_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
AZR86147.1|3546797_3547688_-	acyltransferase	NA	NA	NA	NA	NA
AZR86148.1|3547684_3548539_-	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
AZR86149.1|3548822_3549986_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	60.8	5.0e-126
AZR86150.1|3550096_3550348_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86151.1|3550427_3551468_+	alpha-mannosyltransferase	NA	NA	NA	NA	NA
AZR86152.1|3551747_3553166_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	29.4	8.7e-40
AZR86153.1|3553236_3553572_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86154.1|3553571_3554414_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
AZR86155.1|3554512_3555463_+|integrase	integrase	integrase	NA	NA	NA	NA
3556673:3556689	attR	CATCGTGGTGGGCGTGG	NA	NA	NA	NA
>prophage 27
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	3561870	3616552	4095467	transposase,tRNA,integrase	Orpheovirus(20.0%)	50	3610326:3610343	3621394:3621411
AZR86163.1|3561870_3562821_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR86164.1|3562956_3563571_-	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
AZR86165.1|3563567_3564815_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AZR86166.1|3566680_3566917_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AZR86855.1|3566888_3567413_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86167.1|3569116_3570028_+	reductase	NA	NA	NA	NA	NA
AZR86168.1|3570024_3570273_+	NrdH-redoxin	NA	NA	NA	NA	NA
AZR86169.1|3570269_3571475_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AZR86170.1|3571547_3572543_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86171.1|3572565_3573786_-	acyl-CoA transferase	NA	NA	NA	NA	NA
AZR86172.1|3573782_3574427_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86173.1|3574423_3574816_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86174.1|3574704_3576057_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86175.1|3576157_3576967_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZR86856.1|3577271_3578225_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	5.6e-59
AZR86176.1|3578371_3579274_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86177.1|3579374_3580196_+	phosphodiesterase	NA	NA	NA	NA	NA
AZR86178.1|3580301_3581342_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	6.0e-22
AZR86179.1|3581384_3582677_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR86180.1|3582687_3583563_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR86181.1|3583559_3584360_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR86857.1|3584435_3585452_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR86182.1|3585730_3586048_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86858.1|3586138_3586486_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86183.1|3586773_3588456_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
AZR86184.1|3588465_3589149_+	cell division protein	NA	NA	NA	NA	NA
AZR86185.1|3589210_3589840_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AZR86186.1|3589921_3591115_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
AZR86187.1|3592059_3592962_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86188.1|3593077_3593500_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZR86189.1|3593583_3594378_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR86859.1|3594543_3595680_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.8	3.4e-63
AZR86190.1|3595750_3596884_-	GTPase ObgE	NA	NA	NA	NA	NA
AZR86191.1|3597033_3597294_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AZR86192.1|3597327_3597639_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AZR86193.1|3598063_3599212_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AZR86194.1|3599326_3600292_+	octaprenyl diphosphate synthase	NA	NA	NA	NA	NA
AZR86195.1|3600560_3601427_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR86196.1|3601557_3603606_+	hydantoinase	NA	NA	NA	NA	NA
AZR86197.1|3603623_3605621_+	hydantoin utilization protein B	NA	NA	NA	NA	NA
AZR86198.1|3605655_3606993_+	amino acid deaminase	NA	NA	NA	NA	NA
AZR86199.1|3607255_3608206_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86200.1|3608348_3608687_+	ribosomal subunit interface protein	NA	NA	NA	NA	NA
AZR86201.1|3608963_3609419_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AZR86202.1|3609437_3610364_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
3610326:3610343	attL	GAACGCCAGGCCATGGCG	NA	NA	NA	NA
AZR86203.1|3610417_3611704_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZR86204.1|3612634_3613507_+	RNase adaptor protein RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	34.5	2.4e-08
AZR86205.1|3613503_3614454_+	hypothetical protein	NA	F5B3X9	Synechococcus_phage	47.2	6.9e-17
AZR86206.1|3614600_3615503_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86207.1|3615649_3616552_+|integrase	integrase	integrase	NA	NA	NA	NA
3621394:3621411	attR	CGCCATGGCCTGGCGTTC	NA	NA	NA	NA
>prophage 28
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	3656810	3711173	4095467	tRNA,integrase	Flavobacterium_phage(20.0%)	52	3710122:3710181	3716487:3716586
AZR86237.1|3656810_3657713_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR86238.1|3657859_3658315_-	thioesterase	NA	NA	NA	NA	NA
AZR86239.1|3659503_3660211_-	haloacid dehalogenase, type II	NA	NA	NA	NA	NA
AZR86240.1|3660439_3661384_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR86241.1|3661399_3662368_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86242.1|3662730_3664326_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	38.3	6.8e-09
AZR86243.1|3664353_3664899_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86244.1|3664930_3665641_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR86245.1|3665839_3667036_+	serine--glyoxylate aminotransferase	NA	NA	NA	NA	NA
AZR86246.1|3667891_3668584_+	cyclic nucleotide-binding protein	NA	NA	NA	NA	NA
AZR86247.1|3668730_3669633_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86864.1|3669629_3669995_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86248.1|3670000_3671680_-	ATP-dependent acyl-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.4	1.8e-20
AZR86249.1|3671689_3672706_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR86250.1|3672718_3673132_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86251.1|3673128_3674325_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AZR86252.1|3674411_3675296_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZR86253.1|3675308_3676286_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR86254.1|3677454_3678774_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86255.1|3678770_3679601_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86256.1|3680843_3681431_-	cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	39.5	1.4e-20
AZR86257.1|3681451_3682102_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	NA	NA	NA	NA
AZR86258.1|3682113_3682836_-	proline hydroxylase	NA	NA	NA	NA	NA
AZR86259.1|3682980_3683481_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
AZR86260.1|3683484_3684273_-	heme ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AZR86865.1|3684287_3685232_-	iron ABC transporter	NA	NA	NA	NA	NA
AZR86261.1|3685275_3686133_-	hemin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR86262.1|3686141_3687188_-	hemin transporter	NA	NA	NA	NA	NA
AZR86263.1|3687223_3689836_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZR86264.1|3689968_3690943_-	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AZR86265.1|3690921_3691431_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AZR86266.1|3691604_3691796_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86267.1|3692109_3692427_+	ferredoxin	NA	NA	NA	NA	NA
AZR86268.1|3692428_3692728_+	ferredoxin	NA	NA	NA	NA	NA
AZR86269.1|3692746_3693052_+	ferredoxin	NA	NA	NA	NA	NA
AZR86270.1|3693062_3693995_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AZR86271.1|3693991_3694894_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR86866.1|3695016_3695961_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86272.1|3697032_3697332_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86273.1|3697328_3698279_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR86274.1|3700110_3700938_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR86275.1|3700985_3701933_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
AZR86276.1|3703240_3704140_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR86277.1|3704233_3704998_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AZR86278.1|3704998_3705916_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
AZR86279.1|3705926_3706127_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AZR86280.1|3706268_3706718_+	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	46.9	2.0e-06
AZR86281.1|3706843_3708253_-	signal recognition particle protein	NA	NA	NA	NA	NA
AZR86282.1|3708358_3709201_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86283.1|3709202_3709454_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86284.1|3709542_3710124_+	N-acetyl-anhydromuranmyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	54.3	1.7e-05
3710122:3710181	attL	TAGCTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAACTG	NA	NA	NA	NA
AZR86285.1|3710222_3711173_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86285.1|3710222_3711173_+|integrase	integrase	integrase	NA	NA	NA	NA
3716487:3716586	attR	CAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGCTAGCGCGCCGTCGAACTGCTGCGCCAGGTCGGCATCGACGAG	NA	NA	NA	NA
>prophage 29
CP016339	Bordetella pertussis strain C927 chromosome, complete genome	4095467	3715086	3771996	4095467	protease,transposase,integrase	Diachasmimorpha_longicaudata_entomopoxvirus(14.29%)	50	3770088:3770104	3772317:3772333
AZR86288.1|3715086_3715401_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR86289.1|3715494_3716397_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR86290.1|3717888_3718797_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86291.1|3718774_3719404_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86292.1|3719686_3721117_+	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.8	5.8e-44
AZR86293.1|3721150_3721780_+	threonine transporter RhtB	NA	NA	NA	NA	NA
AZR86294.1|3721828_3723415_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	37.8	7.0e-14
AZR86295.1|3723451_3724123_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86867.1|3724204_3724681_-	bacterioferritin	NA	NA	NA	NA	NA
AZR86296.1|3724887_3725838_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86297.1|3725928_3726357_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZR86868.1|3728128_3728494_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86298.1|3728509_3728989_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86299.1|3729140_3729440_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86300.1|3729485_3729608_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86301.1|3729700_3730282_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86302.1|3730351_3731254_+	hydrolase	NA	NA	NA	NA	NA
AZR86303.1|3731389_3732145_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR86304.1|3732166_3732847_+	molybdenum ABC transporter permease subunit	NA	NA	NA	NA	NA
AZR86305.1|3732858_3733968_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	7.5e-23
AZR86869.1|3733974_3735453_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86306.1|3735765_3736668_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR86307.1|3737517_3738744_-	serine kinase HipA	NA	NA	NA	NA	NA
AZR86308.1|3738743_3739163_-	DNA-binding protein	NA	NA	NA	NA	NA
AZR86870.1|3739346_3740288_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86309.1|3740711_3741686_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86310.1|3741742_3742324_-|protease	protease	protease	NA	NA	NA	NA
AZR86311.1|3742336_3742639_-	ferredoxin	NA	NA	NA	NA	NA
AZR86312.1|3742757_3743816_-	oxidoreductase	NA	NA	NA	NA	NA
AZR86313.1|3743850_3745122_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86314.1|3745152_3745407_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86315.1|3745751_3746933_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86316.1|3747402_3748305_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86317.1|3748407_3749043_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	73.8	2.8e-83
AZR86318.1|3749039_3749933_+	divalent cation transporter	NA	NA	NA	NA	NA
AZR86319.1|3750327_3751428_+	glycine cleavage system protein T	NA	NA	NA	NA	NA
AZR86320.1|3751509_3751884_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
AZR86321.1|3751943_3754808_+	glycine dehydrogenase (aminomethyl-transferring)	NA	E3SN07	Prochlorococcus_phage	51.5	4.0e-262
AZR86322.1|3754952_3755693_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR86323.1|3755762_3756974_+	formyl-CoA transferase	NA	NA	NA	NA	NA
AZR86324.1|3757002_3757971_+	hypothetical protein	NA	NA	NA	NA	NA
AZR86325.1|3758482_3759433_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR86326.1|3761145_3762204_-	glycosyl transferase family 2	NA	I1TED8	Salmonella_phage	40.5	2.8e-59
AZR86327.1|3762333_3762849_+	acetyltransferase	NA	NA	NA	NA	NA
AZR86328.1|3763044_3764250_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
AZR86329.1|3764246_3765758_+	TRAP ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR86871.1|3765773_3767087_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AZR86330.1|3767277_3767457_-	hypothetical protein	NA	NA	NA	NA	NA
AZR86331.1|3767866_3768601_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	43.8	1.4e-41
3770088:3770104	attL	CGGCCGCCACCACGGCG	NA	NA	NA	NA
AZR86332.1|3771093_3771996_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR86332.1|3771093_3771996_+|integrase	integrase	integrase	NA	NA	NA	NA
3772317:3772333	attR	CGCCGTGGTGGCGGCCG	NA	NA	NA	NA
