The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034678	Klebsiella quasipneumoniae strain D120-1 chromosome, complete genome	5085788	1239233	1287998	5085788	holin,capsid,tail,transposase,terminase	Salmonella_phage(42.55%)	60	NA	NA
AZR62094.1|1239233_1240700_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AZR62095.1|1240767_1242345_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AZR62096.1|1242536_1243787_+	DUF4102 domain-containing protein	NA	A0A1X9TCT6	Enterobacter_phage	85.1	1.1e-206
AZR62097.1|1243803_1243995_-	hypothetical protein	NA	NA	NA	NA	NA
AZR62098.1|1243991_1244585_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	1.3e-109
AZR62099.1|1244581_1245235_-	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	47.7	2.1e-41
AZR62100.1|1245231_1245390_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.5e-17
AZR62101.1|1245382_1245676_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	70.1	1.2e-31
AZR62102.1|1245785_1246034_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
AZR62103.1|1246082_1247018_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	76.7	2.0e-141
AZR62104.1|1247014_1247836_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	83.2	9.2e-135
AZR62105.1|1247832_1248132_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
AZR62106.1|1248498_1249080_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	4.6e-64
AZR62107.1|1249234_1249468_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AZR62108.1|1249614_1249818_+	hypothetical protein	NA	Q858D5	Salmonella_phage	82.1	2.3e-23
AZR62109.1|1249814_1250780_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	67.4	1.1e-142
AZR62110.1|1250769_1251537_+	DNA replication domain protein	NA	G9L6A8	Escherichia_phage	90.4	1.4e-57
AZR62111.1|1251662_1252016_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	69.8	4.2e-36
AZR62112.1|1253688_1253949_+	eaa protein	NA	A0A077SLR0	Escherichia_phage	66.3	3.2e-25
AZR65570.1|1253948_1254137_+	hypothetical protein	NA	R9TNE4	Aeromonas_phage	79.7	8.5e-20
AZR65569.1|1254129_1254468_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	79.1	5.2e-44
AZR62113.1|1254544_1254874_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	55.1	8.7e-28
AZR62114.1|1254931_1255552_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	71.7	1.2e-75
AZR62115.1|1255548_1257024_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	91.6	8.7e-277
AZR62116.1|1257035_1257308_-	hypothetical protein	NA	NA	NA	NA	NA
AZR62117.1|1257387_1257648_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	60.2	3.7e-21
AZR62118.1|1257694_1257937_+	hypothetical protein	NA	NA	NA	NA	NA
AZR62119.1|1258190_1258379_+	hypothetical protein	NA	NA	NA	NA	NA
AZR62120.1|1258400_1258604_+	hypothetical protein	NA	NA	NA	NA	NA
AZR62121.1|1258607_1260287_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
AZR62122.1|1260283_1260589_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
AZR65572.1|1260631_1260829_+	hypothetical protein	NA	NA	NA	NA	NA
AZR65571.1|1260870_1261269_+	peptidase	NA	T1SAP9	Salmonella_phage	58.0	6.2e-36
AZR62123.1|1261281_1262289_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.2	1.4e-180
AZR62124.1|1262298_1262691_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
AZR62125.1|1262683_1262962_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
AZR62126.1|1263010_1263622_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
AZR62127.1|1263621_1266099_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.2	1.2e-265
AZR62128.1|1266100_1266571_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.9	3.9e-45
AZR62129.1|1266563_1267061_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	43.6	4.0e-24
AZR62130.1|1267073_1269539_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	60.6	2.6e-281
AZR62131.1|1269568_1271374_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	72.7	7.0e-236
AZR62132.1|1271847_1272771_-|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
AZR62133.1|1275113_1275410_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	89.6	9.8e-47
AZR62134.1|1275452_1275605_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	5.6e-14
AZR62135.1|1275699_1275897_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	63.5	3.7e-18
AZR62136.1|1275900_1276158_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
AZR62137.1|1276249_1276546_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	8.1e-25
AZR62138.1|1276697_1279112_+	hypothetical protein	NA	A0A1J0MGQ6	Serratia_phage	67.5	3.5e-214
AZR62139.1|1279111_1279333_+	hypothetical protein	NA	NA	NA	NA	NA
AZR62140.1|1279461_1280640_+	hypothetical protein	NA	NA	NA	NA	NA
AZR62141.1|1280675_1282130_+	hypothetical protein	NA	A0A0A0RSI3	Bacillus_phage	32.4	3.1e-24
AZR62142.1|1282140_1283280_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
AZR62143.1|1283444_1283849_+	hypothetical protein	NA	T1SA79	Salmonella_phage	82.6	3.5e-55
AZR62144.1|1283835_1284129_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.7	2.4e-37
AZR62145.1|1284130_1284760_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	77.4	3.7e-91
AZR62146.1|1284756_1285239_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	88.8	7.4e-68
AZR62147.1|1285502_1286723_-	MFS transporter	NA	NA	NA	NA	NA
AZR62148.1|1286821_1287709_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR62149.1|1287806_1287998_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	4.3e-19
>prophage 2
CP034678	Klebsiella quasipneumoniae strain D120-1 chromosome, complete genome	5085788	1372766	1379970	5085788	transposase	Enterobacteria_phage(33.33%)	9	NA	NA
AZR62222.1|1372766_1373225_-	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	39.4	3.6e-11
AZR62223.1|1373357_1374266_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.8	2.3e-09
AZR65575.1|1374296_1375157_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	8.5e-06
AZR62224.1|1375520_1376003_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AZR62225.1|1376121_1376568_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.8	2.2e-13
AZR65577.1|1376498_1377032_-	hypothetical protein	NA	NA	NA	NA	NA
AZR65576.1|1377118_1378042_+|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
AZR62226.1|1378083_1378524_-	hypothetical protein	NA	NA	NA	NA	NA
AZR62227.1|1379040_1379970_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	83.7	3.6e-135
>prophage 3
CP034678	Klebsiella quasipneumoniae strain D120-1 chromosome, complete genome	5085788	1606225	1613147	5085788		Planktothrix_phage(33.33%)	6	NA	NA
AZR65585.1|1606225_1607089_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	9.7e-10
AZR62424.1|1607099_1607873_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AZR65586.1|1608113_1609007_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.3	1.8e-14
AZR62425.1|1609252_1610614_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.0	9.7e-206
AZR62426.1|1610931_1611654_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AZR62427.1|1611650_1613147_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.6e-30
>prophage 4
CP034678	Klebsiella quasipneumoniae strain D120-1 chromosome, complete genome	5085788	1663491	1675525	5085788		Enterobacteria_phage(25.0%)	10	NA	NA
AZR62460.1|1663491_1664862_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.9	1.1e-31
AZR62461.1|1665025_1666192_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	2.4e-112
AZR62462.1|1667138_1668143_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.4e-31
AZR62463.1|1668989_1670054_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	1.4e-103
AZR62464.1|1670068_1670938_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.7	2.3e-112
AZR62465.1|1670969_1671860_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	6.2e-28
AZR62466.1|1671874_1672429_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.0	1.9e-51
AZR62467.1|1672519_1673350_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZR62468.1|1673379_1674213_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR62469.1|1674202_1675525_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	1.4e-12
>prophage 5
CP034678	Klebsiella quasipneumoniae strain D120-1 chromosome, complete genome	5085788	1730491	1740734	5085788	transposase,plate,tail	Enterobacteria_phage(25.0%)	12	NA	NA
AZR62517.1|1730491_1731415_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	94.1	2.7e-167
AZR62518.1|1731418_1731670_+	hypothetical protein	NA	NA	NA	NA	NA
AZR62519.1|1731671_1731950_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZR62520.1|1731907_1732099_+	hypothetical protein	NA	NA	NA	NA	NA
AZR62521.1|1732091_1733945_+	hypothetical protein	NA	A0A172JGI1	Citrobacter_phage	44.5	2.0e-20
AZR62522.1|1733992_1735393_+	hypothetical protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	42.0	4.0e-05
AZR62523.1|1735389_1736475_+|tail	phage tail protein	tail	Q8SBG7	Shigella_phage	30.2	1.4e-37
AZR62524.1|1736471_1737053_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
AZR62525.1|1737049_1737499_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	42.1	3.3e-17
AZR62526.1|1737488_1738637_+|plate	baseplate J/gp47 family protein	plate	R9TN81	Rhizobium_phage	25.4	2.7e-15
AZR62527.1|1738633_1739317_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	37.2	8.4e-33
AZR62528.1|1739810_1740734_+|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
>prophage 6
CP034678	Klebsiella quasipneumoniae strain D120-1 chromosome, complete genome	5085788	1748827	1758713	5085788	transposase	Enterobacteria_phage(30.0%)	13	NA	NA
AZR62532.1|1748827_1749751_+|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
AZR62533.1|1749979_1750912_-	hypothetical protein	NA	NA	NA	NA	NA
AZR62534.1|1750974_1751307_-	hypothetical protein	NA	K4MPY5	Escherichia_phage	59.2	5.0e-07
AZR62535.1|1751418_1751967_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	90.1	4.8e-87
AZR62536.1|1752044_1752467_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	1.8e-25
AZR62537.1|1752877_1753117_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	54.4	9.8e-21
AZR62538.1|1753119_1753446_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	2.8e-26
AZR62539.1|1754053_1755190_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.1	3.7e-118
AZR62540.1|1755547_1755847_-	hypothetical protein	NA	NA	NA	NA	NA
AZR62541.1|1755727_1756009_+	hypothetical protein	NA	NA	NA	NA	NA
AZR62542.1|1756050_1756761_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.4	2.2e-07
AZR62543.1|1756804_1758238_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.0	3.4e-100
AZR62544.1|1758218_1758713_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	52.9	2.7e-33
>prophage 7
CP034678	Klebsiella quasipneumoniae strain D120-1 chromosome, complete genome	5085788	2530805	2541691	5085788		Escherichia_phage(87.5%)	9	NA	NA
AZR63249.1|2530805_2533913_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.8	0.0e+00
AZR63250.1|2533967_2535233_+	MFS transporter	NA	NA	NA	NA	NA
AZR63251.1|2535263_2536352_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	97.0	5.0e-205
AZR63252.1|2536438_2536699_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AZR63253.1|2536995_2537856_+	class A broad-spectrum beta-lactamase OKP-B-3	NA	A0A077SL40	Escherichia_phage	88.8	1.8e-141
AZR63254.1|2537876_2538638_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	98.4	2.0e-131
AZR63255.1|2538898_2539801_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	97.3	1.8e-155
AZR63256.1|2539812_2541078_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	92.4	1.3e-217
AZR63257.1|2541070_2541691_+	aldolase	NA	A0A077SK32	Escherichia_phage	95.6	3.1e-111
>prophage 8
CP034678	Klebsiella quasipneumoniae strain D120-1 chromosome, complete genome	5085788	2577919	2659937	5085788	protease,holin,capsid,head,tail,integrase,portal,terminase	Enterobacterial_phage(15.69%)	88	2605539:2605555	2636860:2636876
AZR65647.1|2577919_2578657_+|protease	serine protease	protease	NA	NA	NA	NA
AZR63289.1|2578657_2580814_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	32.5	1.5e-14
AZR63290.1|2580919_2581249_-	multidrug efflux SMR transporter subunit KpnF	NA	NA	NA	NA	NA
AZR63291.1|2581235_2581598_-	multidrug efflux SMR transporter subunit KpnE	NA	NA	NA	NA	NA
AZR63292.1|2582033_2583068_+	AI-2E family transporter	NA	NA	NA	NA	NA
AZR63293.1|2583289_2584945_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
AZR63294.1|2584944_2585787_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
AZR63295.1|2585804_2586104_+	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
AZR63296.1|2586096_2586930_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
AZR63297.1|2586929_2587730_+	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
AZR63298.1|2587870_2588830_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	1.6e-53
AZR63299.1|2588833_2589451_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
AZR63300.1|2589450_2590353_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
AZR63301.1|2590342_2591269_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR63302.1|2591425_2593081_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AZR63303.1|2593343_2594264_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AZR63304.1|2594463_2594784_-	hypothetical protein	NA	NA	NA	NA	NA
AZR63305.1|2594939_2596556_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
AZR63306.1|2596552_2597272_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
AZR63307.1|2597252_2598203_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AZR63308.1|2598268_2601046_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	8.1e-66
AZR63309.1|2601131_2601263_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR63310.1|2601687_2603199_+	anion permease	NA	NA	NA	NA	NA
AZR63311.1|2603253_2604906_+	fumarate hydratase	NA	NA	NA	NA	NA
AZR63312.1|2605070_2606699_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
2605539:2605555	attL	CTGCTGCTGGCGCTGTT	NA	NA	NA	NA
AZR63313.1|2607309_2607699_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AZR65648.1|2607688_2608456_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AZR63314.1|2608445_2609798_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
AZR65649.1|2609807_2611010_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AZR63315.1|2611020_2611677_-	CoA transferase subunit B	NA	NA	NA	NA	NA
AZR63316.1|2611687_2612374_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
AZR63317.1|2612543_2613350_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZR63318.1|2613346_2613910_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
AZR63319.1|2614011_2614920_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR63320.1|2615086_2616397_+	amidohydrolase	NA	NA	NA	NA	NA
AZR63321.1|2616396_2617842_+	amidohydrolase	NA	NA	NA	NA	NA
AZR63322.1|2617964_2619083_+	aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
AZR63323.1|2619211_2620312_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.2	1.9e-114
AZR63324.1|2620704_2621127_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	4.7e-26
AZR65650.1|2621660_2621867_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.2	4.3e-09
AZR63325.1|2624633_2627711_-	kinase	NA	A0A286S259	Klebsiella_phage	62.3	0.0e+00
AZR63326.1|2627707_2628088_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	84.9	1.4e-61
AZR63327.1|2628100_2628577_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	64.6	5.3e-50
AZR63328.1|2628563_2629037_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.4	1.2e-54
AZR63329.1|2629058_2632445_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.7	1.2e-302
AZR63330.1|2632505_2632739_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
AZR63331.1|2632812_2633118_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
AZR63332.1|2633120_2633525_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	56.9	3.2e-32
AZR63333.1|2633555_2634260_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.5	9.5e-80
AZR63334.1|2634316_2634664_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
AZR63335.1|2634660_2635110_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
AZR63336.1|2635106_2635445_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	68.8	6.6e-39
AZR63337.1|2635453_2635771_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	4.8e-23
AZR63338.1|2635848_2637087_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
2636860:2636876	attR	CTGCTGCTGGCGCTGTT	NA	NA	NA	NA
AZR63339.1|2637096_2637696_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
AZR63340.1|2637688_2638915_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.0	5.5e-208
AZR63341.1|2639062_2640814_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	71.8	1.1e-249
AZR63342.1|2640817_2641315_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	73.9	5.7e-63
AZR63343.1|2641472_2641823_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	78.3	5.1e-50
AZR63344.1|2641810_2642044_-	hypothetical protein	NA	NA	NA	NA	NA
AZR63345.1|2642058_2642643_-	Fur-regulated protein	NA	M9NZE9	Enterobacteria_phage	56.1	8.2e-53
AZR63346.1|2643591_2643786_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	92.7	8.5e-23
AZR63347.1|2643736_2644012_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	50.6	9.2e-15
AZR63348.1|2644014_2644644_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	73.9	1.2e-86
AZR63349.1|2644643_2644925_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
AZR63350.1|2644911_2645307_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
AZR65651.1|2645869_2646316_+	hypothetical protein	NA	NA	NA	NA	NA
AZR63351.1|2646221_2646479_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	98.8	2.8e-42
AZR63352.1|2646791_2647370_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	2.2e-50
AZR63353.1|2647383_2648364_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	67.8	4.2e-134
AZR63354.1|2648376_2648754_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
AZR63355.1|2648763_2649573_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.5	8.5e-109
AZR63356.1|2649569_2650538_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.4	4.6e-85
AZR63357.1|2650527_2650707_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
AZR63358.1|2650944_2651397_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.5	7.0e-68
AZR63359.1|2651425_2651689_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	47.9	3.7e-13
AZR63360.1|2651790_2652267_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	45.3	2.0e-12
AZR63361.1|2652438_2653593_+	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	28.2	1.5e-34
AZR63362.1|2654501_2654801_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	48.6	1.1e-13
AZR63363.1|2654800_2655586_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	4.5e-62
AZR63364.1|2655582_2655786_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	1.5e-30
AZR63365.1|2655778_2656018_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	82.3	1.5e-29
AZR63366.1|2656014_2656416_+	chromosome partitioning protein ParB	NA	S4TTI6	Salmonella_phage	78.2	6.0e-55
AZR63367.1|2656933_2657122_+	diguanylate phosphodiesterase	NA	A0A192Y8X2	Salmonella_phage	88.7	3.7e-23
AZR63368.1|2657126_2657990_+	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	55.3	1.5e-18
AZR63369.1|2658123_2658384_+	pyocin activator protein PrtN	NA	A0A1L5C290	Pseudoalteromonas_phage	45.1	9.0e-12
AZR63370.1|2658995_2659154_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AZR63371.1|2659421_2659937_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	3.5e-23
>prophage 9
CP034678	Klebsiella quasipneumoniae strain D120-1 chromosome, complete genome	5085788	2767412	2801273	5085788	transposase,tRNA,plate,bacteriocin	Enterobacteria_phage(37.5%)	35	NA	NA
AZR63466.1|2767412_2768336_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
AZR65655.1|2768415_2768598_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
AZR65656.1|2768688_2769114_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	5.4e-30
AZR65657.1|2769911_2770169_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZR63467.1|2770665_2770989_-	TonB family protein	NA	NA	NA	NA	NA
AZR65658.1|2771013_2771937_+|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
AZR63468.1|2772981_2773917_+|tRNA	tRNA 2-thiocytidine biosynthesis protein TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.8	4.1e-139
AZR63469.1|2773962_2775336_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.6	5.1e-53
AZR63470.1|2775350_2775545_-	hypothetical protein	NA	NA	NA	NA	NA
AZR63471.1|2775861_2776845_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AZR63472.1|2777123_2777867_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	1.4e-17
AZR63473.1|2777829_2778948_+	oxidoreductase	NA	NA	NA	NA	NA
AZR63474.1|2779184_2779379_+	hypothetical protein	NA	NA	NA	NA	NA
AZR63475.1|2779788_2780712_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
AZR63476.1|2781555_2782935_-	amino acid permease	NA	NA	NA	NA	NA
AZR63477.1|2783269_2783749_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZR63478.1|2784000_2784615_+	YitT family protein	NA	NA	NA	NA	NA
AZR63479.1|2784653_2785853_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AZR63480.1|2785881_2786550_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR63481.1|2786542_2787556_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	2.9e-29
AZR63482.1|2787564_2788368_-	methionine-binding protein	NA	NA	NA	NA	NA
AZR63483.1|2788588_2789764_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AZR63484.1|2789783_2790143_-	hypothetical protein	NA	NA	NA	NA	NA
AZR63485.1|2790348_2791260_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
AZR63486.1|2791259_2792120_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZR63487.1|2792210_2793134_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR63488.1|2793155_2794061_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR63489.1|2794199_2795129_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
AZR63490.1|2795160_2795367_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZR63491.1|2795417_2796296_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZR63492.1|2796454_2797210_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZR63493.1|2797328_2797823_-	hypothetical protein	NA	NA	NA	NA	NA
AZR63494.1|2797949_2798492_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AZR63495.1|2798469_2799555_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AZR63496.1|2799518_2801273_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 10
CP034678	Klebsiella quasipneumoniae strain D120-1 chromosome, complete genome	5085788	3267315	3280223	5085788	transposase,protease,tRNA	Bacillus_phage(14.29%)	10	NA	NA
AZR63909.1|3267315_3269037_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.6	4.5e-14
AZR63910.1|3269076_3269781_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZR63911.1|3270131_3270350_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZR63912.1|3270473_3272753_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	2.1e-165
AZR63913.1|3272783_3273101_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AZR63914.1|3273426_3273648_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AZR63915.1|3273724_3275665_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.5	2.5e-37
AZR63916.1|3275661_3276777_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AZR63917.1|3276923_3278582_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AZR65681.1|3279299_3280223_+|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
>prophage 11
CP034678	Klebsiella quasipneumoniae strain D120-1 chromosome, complete genome	5085788	3733468	3801887	5085788	coat,holin,tRNA,integrase,head,transposase,terminase	Cronobacter_phage(23.33%)	84	3735700:3735716	3809032:3809048
AZR64312.1|3733468_3734986_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	35.7	1.2e-84
AZR64313.1|3735305_3736781_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.2	5.3e-48
3735700:3735716	attL	AGCGCCAGCAGCATAAA	NA	NA	NA	NA
AZR64314.1|3736840_3738988_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
AZR64315.1|3739070_3740405_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
AZR64316.1|3740770_3742339_-	transcriptional regulator CadC	NA	NA	NA	NA	NA
AZR64317.1|3742628_3742901_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZR64318.1|3743001_3743922_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.1	1.6e-50
AZR64319.1|3744430_3745297_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZR64320.1|3745369_3746674_-	citrate synthase	NA	NA	NA	NA	NA
AZR64321.1|3747228_3747630_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AZR64322.1|3748023_3748317_-	hypothetical protein	NA	NA	NA	NA	NA
AZR64323.1|3749206_3750187_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	97.7	6.0e-173
AZR64324.1|3750179_3751103_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	94.1	2.7e-167
AZR65700.1|3751251_3752175_-|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
AZR64325.1|3755354_3757832_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	1.2e-198
AZR64326.1|3757818_3758214_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	1.4e-35
AZR64327.1|3758210_3758681_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	39.2	1.1e-26
AZR65701.1|3758680_3759100_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.1e-30
AZR64328.1|3759198_3762639_-	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	50.5	5.0e-182
AZR64329.1|3762729_3763515_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	2.4e-84
AZR64330.1|3763580_3764294_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	6.7e-49
AZR64331.1|3764283_3764454_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
AZR64332.1|3764553_3764913_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
AZR65702.1|3764929_3765400_-	hypothetical protein	NA	NA	NA	NA	NA
AZR64333.1|3765770_3766187_-	toxin YafO, type II toxin-antitoxin system family protein	NA	NA	NA	NA	NA
AZR64334.1|3766188_3766761_-	hypothetical protein	NA	NA	NA	NA	NA
AZR64335.1|3767076_3767760_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	59.7	2.3e-75
AZR64336.1|3767812_3768565_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.2	1.7e-42
AZR64337.1|3768633_3769026_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	3.3e-34
AZR64338.1|3769022_3769448_-	HK97 gp10 family phage protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
AZR64339.1|3769450_3769813_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	50.8	1.6e-27
AZR64340.1|3769812_3769986_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	54.4	5.4e-13
AZR64341.1|3769985_3770366_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	3.1e-29
AZR64342.1|3770368_3770635_-	hypothetical protein	NA	NA	NA	NA	NA
AZR64343.1|3770644_3771742_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	73.0	6.1e-150
AZR64344.1|3771753_3772185_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.8e-41
AZR64345.1|3772188_3773574_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.7	1.8e-167
AZR64346.1|3773586_3773769_-	hypothetical protein	NA	NA	NA	NA	NA
AZR64347.1|3773819_3774092_-	hypothetical protein	NA	NA	NA	NA	NA
AZR64348.1|3774118_3775126_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	3.6e-117
AZR64349.1|3775052_3776522_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.3	4.0e-149
AZR64350.1|3776534_3778007_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.7	1.5e-249
AZR64351.1|3778006_3778522_-	hypothetical protein	NA	A0A0H5AUE2	Pseudomonas_phage	61.5	1.2e-50
AZR64352.1|3778743_3779322_+	hypothetical protein	NA	NA	NA	NA	NA
AZR65703.1|3779608_3779806_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	76.9	2.1e-21
AZR64353.1|3779762_3780032_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	81.8	1.5e-06
AZR64354.1|3780028_3780376_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.0	1.4e-39
AZR64355.1|3780372_3780912_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
AZR65704.1|3780908_3781208_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
AZR64356.1|3781865_3782141_-	hypothetical protein	NA	NA	NA	NA	NA
AZR64357.1|3782386_3783076_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.1	5.1e-62
AZR64358.1|3783072_3783213_-	YlcG family protein	NA	NA	NA	NA	NA
AZR64359.1|3783209_3783848_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	67.9	9.2e-74
AZR64360.1|3783840_3784011_-	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
AZR64361.1|3784016_3784613_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	1.2e-56
AZR64362.1|3784734_3785004_-	hypothetical protein	NA	H6WRY4	Salmonella_phage	81.8	9.3e-36
AZR64363.1|3785801_3785990_-	diguanylate phosphodiesterase	NA	A0A192Y8X2	Salmonella_phage	87.1	8.2e-23
AZR64364.1|3785989_3786403_-	hypothetical protein	NA	A0A291LBK8	Klebsiella_phage	59.0	5.8e-13
AZR64365.1|3786399_3786606_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	98.5	8.1e-32
AZR64366.1|3786602_3786863_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	76.2	8.7e-31
AZR64367.1|3786859_3787321_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	36.8	1.4e-10
AZR64368.1|3787317_3787620_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZR64369.1|3787616_3788486_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	70.1	5.2e-96
AZR64370.1|3788470_3789361_-	replication protein	NA	K7PGT1	Enterobacteria_phage	48.7	1.2e-66
AZR64371.1|3789357_3790155_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	72.8	6.1e-91
AZR64372.1|3790241_3790562_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	69.8	1.0e-36
AZR64373.1|3790602_3790830_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	5.6e-18
AZR64374.1|3790898_3791621_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.7	3.2e-75
AZR64375.1|3791666_3791987_+	hypothetical protein	NA	NA	NA	NA	NA
AZR64376.1|3791986_3792685_+	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
AZR64377.1|3793188_3793383_+	hypothetical protein	NA	NA	NA	NA	NA
AZR64378.1|3793771_3794617_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	9.0e-69
AZR64379.1|3794613_3795294_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
AZR64380.1|3795290_3795719_+	regulator	NA	M9NYX4	Enterobacteria_phage	81.0	3.4e-64
AZR64381.1|3795715_3796372_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	88.4	5.5e-114
AZR64382.1|3796368_3797136_+	dcm methylase	NA	D5LH17	Escherichia_phage	53.4	2.9e-66
AZR64383.1|3797132_3797351_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.6e-09
AZR64384.1|3797352_3797568_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	58.6	3.2e-15
AZR64385.1|3797569_3797905_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZR64386.1|3797781_3798945_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	5.0e-203
AZR64387.1|3799014_3799338_-	hypothetical protein	NA	NA	NA	NA	NA
AZR64388.1|3799376_3800243_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AZR64389.1|3800244_3800457_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AZR64390.1|3800501_3801887_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
3809032:3809048	attR	AGCGCCAGCAGCATAAA	NA	NA	NA	NA
>prophage 1
CP034681	Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence	296653	7794	20100	296653	tail	Salmonella_phage(26.67%)	19	NA	NA
AZR65841.1|7794_8115_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
AZR65842.1|8195_8510_+	hypothetical protein	NA	NA	NA	NA	NA
AZR65843.1|8629_8881_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
AZR65844.1|9046_9265_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
AZR65845.1|9358_9856_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	57.0	1.5e-23
AZR65846.1|9852_10041_+	hypothetical protein	NA	NA	NA	NA	NA
AZR65847.1|10518_10746_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.5e-10
AZR65848.1|10742_11387_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
AZR65849.1|11387_11711_+	hypothetical protein	NA	E5AGF3	Erwinia_phage	46.9	1.6e-13
AZR65850.1|11803_12190_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
AZR65851.1|13440_13923_+	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	58.3	4.4e-12
AZR66112.1|14006_14609_+	DUF551 domain-containing protein	NA	A0A1V0E5M5	Salmonella_phage	31.1	2.1e-19
AZR65852.1|14608_14794_+	hypothetical protein	NA	NA	NA	NA	NA
AZR65853.1|15063_15336_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	47.8	5.5e-12
AZR65854.1|15909_16095_+	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	67.4	2.1e-10
AZR65855.1|16104_16554_+|tail	phage tail protein	tail	A0A1I9KFG8	Aeromonas_phage	45.2	2.9e-18
AZR65856.1|16623_17232_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	42.2	1.5e-25
AZR65857.1|17519_17975_+	hypothetical protein	NA	NA	NA	NA	NA
AZR65858.1|18858_20100_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
>prophage 2
CP034681	Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence	296653	100764	121017	296653	transposase	Enterobacteria_phage(25.0%)	17	NA	NA
AZR65936.1|100764_101688_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
AZR65937.1|101988_103108_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	3.9e-51
AZR65938.1|103336_104290_+	cation transporter	NA	NA	NA	NA	NA
AZR65939.1|104401_104776_+	hypothetical protein	NA	NA	NA	NA	NA
AZR65940.1|106538_106865_+	hypothetical protein	NA	NA	NA	NA	NA
AZR65941.1|107570_108440_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR65942.1|108433_109444_-	phosphonate dehydrogenase	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
AZR65943.1|109452_110280_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AZR65944.1|110288_111152_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR65945.1|111148_111976_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
AZR65946.1|112946_113651_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZR65947.1|115761_117000_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
AZR65948.1|117159_117372_-	hypothetical protein	NA	NA	NA	NA	NA
AZR65949.1|117475_118048_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
AZR65950.1|118247_119171_+	cation transporter	NA	NA	NA	NA	NA
AZR65951.1|119302_120007_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZR65952.1|120093_121017_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
>prophage 3
CP034681	Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence	296653	175295	189406	296653	transposase	Escherichia_phage(40.0%)	15	NA	NA
AZR66000.1|175295_176413_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	2.5e-50
AZR66001.1|176447_177470_+|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	84.7	6.2e-173
AZR66002.1|177466_178249_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	94.6	2.2e-133
AZR66124.1|178293_178479_+	hypothetical protein	NA	NA	NA	NA	NA
AZR66003.1|178829_179717_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AZR66004.1|179852_180281_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AZR66005.1|180825_181044_+	hypothetical protein	NA	NA	NA	NA	NA
AZR66006.1|181167_182136_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.5	6.9e-182
AZR66007.1|183250_184033_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.1	5.1e-135
AZR66008.1|184029_185052_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	84.7	6.2e-173
AZR66009.1|185151_185538_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	96.9	4.7e-65
AZR66010.1|185534_185882_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	98.3	2.2e-61
AZR66011.1|185930_187469_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	1.0e-280
AZR66012.1|187520_188459_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR66013.1|188491_189406_-	alpha/beta hydrolase	NA	A0A1D8EVD1	Mycobacterium_phage	28.0	9.0e-06
>prophage 4
CP034681	Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence	296653	274490	281682	296653		Burkholderia_phage(33.33%)	11	NA	NA
AZR66085.1|274490_275069_+	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	57.6	1.2e-40
AZR66086.1|275059_275374_-	hypothetical protein	NA	NA	NA	NA	NA
AZR66130.1|275498_275909_+	DNA-binding protein	NA	Q71TH9	Escherichia_phage	60.0	3.9e-41
AZR66087.1|276093_276453_-	hypothetical protein	NA	NA	NA	NA	NA
AZR66088.1|276683_277127_+	hypothetical protein	NA	NA	NA	NA	NA
AZR66089.1|277168_277372_+	hypothetical protein	NA	NA	NA	NA	NA
AZR66090.1|277380_277641_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
AZR66091.1|277673_278108_+	hypothetical protein	NA	NA	NA	NA	NA
AZR66092.1|278104_278848_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	1.8e-60
AZR66093.1|278974_280390_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	3.1e-106
AZR66094.1|280479_281682_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.1	1.1e-35
>prophage 1
CP034677	Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence	80476	5528	59934	80476	integrase,transposase	Escherichia_phage(38.46%)	56	50469:50528	65767:66586
AZR60957.1|5528_6920_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
AZR60881.1|6956_7529_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
AZR60882.1|7665_8256_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AZR60883.1|8360_9164_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
AZR60884.1|9138_9468_-	hypothetical protein	NA	NA	NA	NA	NA
AZR60885.1|9624_10296_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	57.7	1.8e-72
AZR60886.1|10262_10760_-	chromosome partitioning protein ParB	NA	A0A0R6PHV6	Moraxella_phage	36.0	3.3e-18
AZR60887.1|10925_12947_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	31.3	3.0e-38
AZR60888.1|13112_13766_-	hypothetical protein	NA	NA	NA	NA	NA
AZR60889.1|13762_14983_-	hypothetical protein	NA	NA	NA	NA	NA
AZR60890.1|14972_15257_-	hypothetical protein	NA	NA	NA	NA	NA
AZR60891.1|15572_18692_+	hypothetical protein	NA	NA	NA	NA	NA
AZR60892.1|18960_19161_+	hypothetical protein	NA	NA	NA	NA	NA
AZR60893.1|19185_19638_-	hypothetical protein	NA	NA	NA	NA	NA
AZR60894.1|19796_20033_-	hypothetical protein	NA	NA	NA	NA	NA
AZR60895.1|20445_20796_+	hypothetical protein	NA	NA	NA	NA	NA
AZR60896.1|20846_21590_+	hypothetical protein	NA	NA	NA	NA	NA
AZR60897.1|21586_22363_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AZR60898.1|22420_22678_-	hypothetical protein	NA	NA	NA	NA	NA
AZR60899.1|23445_24312_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AZR60900.1|24668_24938_-	hypothetical protein	NA	NA	NA	NA	NA
AZR60901.1|25352_26558_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AZR60902.1|26554_27532_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AZR60903.1|27613_28885_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
AZR60904.1|28884_29316_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
AZR60905.1|29473_29725_+	hypothetical protein	NA	NA	NA	NA	NA
AZR60958.1|29724_31209_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AZR60906.1|31201_31471_+	hypothetical protein	NA	NA	NA	NA	NA
AZR60907.1|31678_32644_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
AZR60908.1|33123_33555_+	hypothetical protein	NA	NA	NA	NA	NA
AZR60909.1|34000_34705_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZR60910.1|34716_35373_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZR60911.1|35468_36653_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AZR60912.1|36747_37857_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
AZR60913.1|38346_39051_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZR60914.1|39763_40840_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZR60915.1|41854_42445_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AZR60916.1|42581_43154_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
AZR60959.1|43190_44582_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
AZR60917.1|45361_46018_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
AZR60918.1|47614_48472_-	class A beta-lactamase LAP-2	NA	Q1MVP3	Enterobacteria_phage	61.1	2.0e-92
AZR60919.1|48536_48815_-	hypothetical protein	NA	NA	NA	NA	NA
AZR60920.1|48805_49510_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZR60921.1|49735_50377_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
50469:50528	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
AZR60922.1|50520_51225_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZR60960.1|51868_52153_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR60923.1|52121_53135_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZR60924.1|53290_53764_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AZR60961.1|53984_54251_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AZR60925.1|54393_55158_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AZR60926.1|55199_55412_+	resolvase	NA	NA	NA	NA	NA
AZR60927.1|55424_56633_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AZR60928.1|56666_58100_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AZR60929.1|58481_58688_-	hypothetical protein	NA	NA	NA	NA	NA
AZR60962.1|58692_59205_-	restriction endonuclease	NA	NA	NA	NA	NA
AZR60930.1|59229_59934_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
65767:66586	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGCGCGACGAGCAGCAGCACCAGGAGCAGAAGCACGTCGAGAAAAAGCAACAGCAGATCGAGCAGCGCCCACGGCGGGCCGCTCGCATCGGATAAGTCGAAAAATCCGGCTAAAGTGGCCGAGCTGCACATCAGGCCGCGCGGTTTTCCTCCCTGATCGCCGGCGCGGTTTCTTCCTCCCTGAACCGCATGCAGACTTGCCGCCTCGGACACCCCGAGGCGGTTTTTTTTCGCCTCGCTCGAGCATCGCCGCATCCGACGATGCCGAGACGACCAGGCCGCGCACGTCGAGCTGCAGCATCGCCATTGCCGACGATGGCACCAGGTCGCCGGCGGTGGCCACCGACCTCGAGCTCGCATCGCCACATCCGACGATGCGCGCCGGCGTCGACCATCGCCAGGTCTGACGATGGCGGCCGCCCTGCCCTGGATCTCGCATCGCCATTTCTGGCGATGAGATCCACGGAGCGGCCATTTAGACCCGCCAATAACGACCCGGCCAAGATAAATCGCATGACGGCCTTTTTGGCCGGGGGTAGCATGACCGGACACTTTGCGTATGCCCAAAGGAGCCCGCAAGTATGCGCAGGACGAAGCCAGTAGCCGCGCCGATGGTGGCGCGGGTCTATCTGCGCGTCAGCACCGACGCGCAGGACTTGGAACGCCAAGAGGCGATCACTACGGCCGCGAAGGCCGCCGGCTACTACGTCGCCGGCATCTACCGTGAGAAGGCATCCGGCGCACGCGCCGACCGGCCTGAGC	NA	NA	NA	NA
>prophage 1
CP034679	Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_83kb, complete sequence	83909	1719	66441	83909	transposase,integrase	Bacillus_phage(25.0%)	55	NA	NA
AZR65760.1|1719_2460_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AZR65761.1|4329_4449_-	hypothetical protein	NA	NA	NA	NA	NA
AZR65817.1|5298_5907_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AZR65762.1|6100_6802_+	molecular chaperone	NA	NA	NA	NA	NA
AZR65763.1|6813_9300_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AZR65764.1|9290_10265_+	fimbrial protein	NA	NA	NA	NA	NA
AZR65765.1|10279_10930_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AZR65766.1|10991_11708_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AZR65767.1|11849_12434_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AZR65768.1|12551_13262_-	flagellar brake protein	NA	NA	NA	NA	NA
AZR65769.1|15212_15557_-	hypothetical protein	NA	A0A1B0VFY5	Salmonella_phage	86.7	1.1e-44
AZR65770.1|17292_17583_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.9	1.2e-12
AZR65771.1|17726_18158_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AZR65818.1|19873_20524_-	response regulator	NA	W8CYM9	Bacillus_phage	34.6	2.3e-27
AZR65772.1|26942_27383_+	hypothetical protein	NA	NA	NA	NA	NA
AZR65773.1|27509_29957_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	5.8e-84
AZR65774.1|29997_30195_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AZR65775.1|30228_30966_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AZR65776.1|31254_31704_-	copper resistance protein	NA	NA	NA	NA	NA
AZR65777.1|31937_33755_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AZR65819.1|33754_34651_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
AZR65778.1|34690_35071_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AZR65779.1|35075_36005_+	copper resistance protein D	NA	NA	NA	NA	NA
AZR65780.1|36059_36740_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AZR65781.1|36736_38137_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
AZR65782.1|38352_38787_+	copper-binding protein	NA	NA	NA	NA	NA
AZR65783.1|39165_39285_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AZR65784.1|39250_39430_-	antitoxin	NA	NA	NA	NA	NA
AZR65785.1|39716_40298_+	hypothetical protein	NA	NA	NA	NA	NA
AZR65786.1|40458_41487_+	hypothetical protein	NA	NA	NA	NA	NA
AZR65820.1|41780_42461_+	hypothetical protein	NA	NA	NA	NA	NA
AZR65787.1|44927_46625_-	phosphoethanolamine--lipid A transferase MCR-8.2	NA	NA	NA	NA	NA
AZR65821.1|46832_48039_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	7.5e-101
AZR65788.1|48076_48772_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.0	1.7e-25
AZR65789.1|48793_50023_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
AZR65790.1|50136_50526_+	diacylglycerol kinase	NA	NA	NA	NA	NA
AZR65791.1|50973_51873_-	glycosyl transferase	NA	NA	NA	NA	NA
AZR65792.1|52070_52280_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR65793.1|52281_52815_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
AZR65794.1|52838_53195_-	hypothetical protein	NA	NA	NA	NA	NA
AZR65795.1|53214_53790_-	class A beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AZR65822.1|53894_54818_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
AZR65796.1|54884_55484_-	class A beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AZR65797.1|55847_56624_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AZR65798.1|56864_57188_-	hypothetical protein	NA	NA	NA	NA	NA
AZR65799.1|57366_58038_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	5.8e-79
AZR65800.1|58089_58338_+	hypothetical protein	NA	NA	NA	NA	NA
AZR65801.1|58482_58671_+	hypothetical protein	NA	NA	NA	NA	NA
AZR65802.1|58976_59900_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
AZR65803.1|60041_60899_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AZR65823.1|60891_60969_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
AZR65804.1|61185_61464_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
AZR65805.1|61748_62672_-|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
AZR65824.1|62850_63402_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	1.1e-19
AZR65825.1|65517_66441_+|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
