The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028318	Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 chromosome, complete genome	4884375	1618986	1631270	4884375	holin,tail	Salmonella_phage(40.0%)	10	NA	NA
AZR55064.1|1618986_1621353_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
AZR58196.1|1621681_1622671_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	5.4e-190
AZR55065.1|1622685_1623054_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
AZR55066.1|1623082_1624414_-	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
AZR55067.1|1624710_1625040_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
AZR55068.1|1625632_1626874_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
AZR55069.1|1626876_1627404_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
AZR55070.1|1627781_1628225_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
AZR55071.1|1630448_1630739_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
AZR55072.1|1630766_1631270_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 2
CP028318	Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 chromosome, complete genome	4884375	1703153	1712324	4884375	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AZR55140.1|1703153_1704101_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
AZR55141.1|1704084_1704816_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR55142.1|1704796_1704904_-	hypothetical protein	NA	NA	NA	NA	NA
AZR55143.1|1704963_1705695_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AZR55144.1|1705917_1707603_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
AZR55145.1|1707599_1708319_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AZR55146.1|1708365_1708833_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AZR55147.1|1708889_1709420_-	hypothetical protein	NA	NA	NA	NA	NA
AZR55148.1|1709591_1710050_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AZR55149.1|1710290_1712324_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
CP028318	Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 chromosome, complete genome	4884375	1780632	1791138	4884375		Enterobacteria_phage(37.5%)	10	NA	NA
AZR55204.1|1780632_1782036_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
AZR55205.1|1782213_1783107_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AZR55206.1|1783483_1784569_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
AZR55207.1|1784568_1785468_+	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
AZR55208.1|1785515_1786394_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
AZR55209.1|1786394_1786946_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
AZR55210.1|1786951_1787944_+	protein RfbI	NA	NA	NA	NA	NA
AZR55211.1|1787940_1788714_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZR55212.1|1788718_1789798_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
AZR55213.1|1789824_1791138_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
CP028318	Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 chromosome, complete genome	4884375	1877843	1927908	4884375	tail,protease,terminase,head,capsid,holin,integrase,portal,plate	Salmonella_phage(83.08%)	72	1872421:1872435	1888551:1888565
1872421:1872435	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
AZR55298.1|1877843_1878317_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
AZR55299.1|1878964_1879255_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
AZR55300.1|1879626_1880424_-	protein MtfA	NA	NA	NA	NA	NA
AZR55301.1|1880715_1881705_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
AZR55302.1|1881706_1881949_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
AZR55303.1|1881973_1882543_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
AZR55304.1|1882546_1883128_-	molecular chaperone DnaJ	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
AZR55305.1|1883138_1883396_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
AZR55306.1|1883397_1883931_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
AZR55307.1|1884001_1884541_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
AZR55308.1|1884677_1885505_-	DUF2303 domain-containing protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
AZR55309.1|1885562_1885934_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
AZR55310.1|1886031_1886217_+	hypothetical protein	NA	NA	NA	NA	NA
AZR55311.1|1886281_1886698_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	6.4e-76
AZR55312.1|1886660_1886999_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
AZR55313.1|1887204_1887900_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
AZR55314.1|1887873_1888059_+	amino acid permease	NA	NA	NA	NA	NA
AZR55315.1|1887997_1888222_+	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AZR55316.1|1888250_1888805_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1888551:1888565	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
AZR55317.1|1888801_1889959_+	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
AZR55318.1|1889955_1890180_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AZR55319.1|1890176_1890995_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
AZR55320.1|1890954_1891479_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	2.4e-96
AZR55321.1|1891478_1892372_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
AZR55322.1|1892368_1892758_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
AZR55323.1|1892729_1893635_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	1.1e-162
AZR58204.1|1893642_1894632_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
AZR55324.1|1894645_1895398_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
AZR58205.1|1895548_1895806_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
AZR55325.1|1895951_1896338_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
AZR55326.1|1896324_1896606_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
AZR55327.1|1896605_1897220_+	endolysin	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
AZR55328.1|1897427_1897772_+	Rz1 lytic protein	NA	Q8SBD8	Shigella_phage	80.0	3.0e-39
AZR58206.1|1898071_1898404_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
AZR55329.1|1898454_1898805_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
AZR55330.1|1898921_1899425_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.0e-88
AZR55331.1|1899421_1901155_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
AZR55332.1|1901166_1901349_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
AZR55333.1|1901348_1902590_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
AZR55334.1|1902531_1903218_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	6.5e-126
AZR55335.1|1903232_1904438_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
AZR55336.1|1904488_1904689_+	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
AZR55337.1|1904691_1905015_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
AZR55338.1|1905011_1905416_+|head,tail	head-tail adaptor protein	head,tail	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
AZR55339.1|1905387_1905900_+	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
AZR55340.1|1905896_1906457_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
AZR55341.1|1906460_1906625_+	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
AZR55342.1|1906614_1908111_+|tail	phage tail protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
AZR55343.1|1908110_1908467_+|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
AZR55344.1|1908463_1908790_+|tail	phage tail assembly protein	tail	A0A192Y6C5	Salmonella_phage	100.0	1.3e-52
AZR55345.1|1908874_1910803_+|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
AZR55346.1|1910836_1912177_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
AZR55347.1|1912173_1913232_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
AZR55348.1|1913231_1913765_+|plate	phage baseplate assembly protein V	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
AZR55349.1|1913769_1914183_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
AZR55350.1|1914732_1915254_+|tail	phage tail protein	tail	Q8HAB6	Salmonella_phage	100.0	2.9e-94
AZR55351.1|1915256_1915844_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
AZR55352.1|1915830_1917393_+|tail	phage tail protein	tail	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
AZR55353.1|1917362_1917968_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
AZR55354.1|1918081_1918315_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
AZR55355.1|1918550_1918964_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
AZR55356.1|1918960_1919173_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
AZR55357.1|1920146_1920389_+	hypothetical protein	NA	NA	NA	NA	NA
AZR55358.1|1920366_1920528_+	hypothetical protein	NA	NA	NA	NA	NA
AZR55359.1|1920654_1921074_+	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AZR55360.1|1921076_1922345_+	protein UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
AZR55361.1|1922799_1923012_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AZR58207.1|1923022_1923211_+	cold-shock protein	NA	NA	NA	NA	NA
AZR55362.1|1923471_1924668_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
AZR55363.1|1925317_1925617_+	hypothetical protein	NA	NA	NA	NA	NA
AZR55364.1|1925708_1926404_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AZR55365.1|1926477_1927908_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
CP028318	Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 chromosome, complete genome	4884375	2031951	2081760	4884375	tail,terminase,head,transposase,integrase,lysis	Edwardsiella_phage(19.57%)	72	2026396:2026410	2083261:2083275
2026396:2026410	attL	AATGACGTGTGAACG	NA	NA	NA	NA
AZR55473.1|2031951_2032182_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
AZR55474.1|2032319_2032694_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AZR55475.1|2032694_2033570_+	hypothetical protein	NA	NA	NA	NA	NA
AZR55476.1|2033586_2033940_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AZR58212.1|2033997_2034117_+	hypothetical protein	NA	NA	NA	NA	NA
AZR55477.1|2034322_2035402_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
AZR55478.1|2035376_2035655_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
AZR58213.1|2035715_2035952_-	hypothetical protein	NA	NA	NA	NA	NA
AZR55479.1|2036242_2036422_-	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	60.3	7.3e-13
AZR55480.1|2037032_2037365_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	72.7	8.5e-15
AZR55481.1|2037357_2037678_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
AZR55482.1|2037713_2038544_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
AZR55483.1|2038536_2041227_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	2.2e-116
AZR55484.1|2041367_2041703_-	hypothetical protein	NA	NA	NA	NA	NA
AZR55485.1|2041778_2041985_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
AZR55486.1|2041988_2042264_-	hypothetical protein	NA	NA	NA	NA	NA
AZR55487.1|2042524_2042704_+	hypothetical protein	NA	NA	NA	NA	NA
AZR55488.1|2042648_2042837_-	hypothetical protein	NA	NA	NA	NA	NA
AZR55489.1|2043134_2043533_-	transcriptional regulator	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
AZR55490.1|2043631_2043886_+	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
AZR55491.1|2043872_2044367_+	hypothetical protein	NA	NA	NA	NA	NA
AZR55492.1|2044410_2045418_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.5	1.8e-124
AZR55493.1|2045410_2045872_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
AZR55494.1|2045884_2046280_+	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	37.0	6.4e-17
AZR55495.1|2046276_2046549_+	hypothetical protein	NA	NA	NA	NA	NA
AZR55496.1|2046755_2046908_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AZR55497.1|2047157_2047406_+	hypothetical protein	NA	NA	NA	NA	NA
AZR55498.1|2047469_2048069_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
AZR55499.1|2048065_2048260_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
AZR55500.1|2048256_2048568_+	DUF1364 domain-containing protein	NA	K7P7Q1	Enterobacteria_phage	84.8	6.1e-39
AZR55501.1|2048907_2049249_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	1.1e-54
AZR55502.1|2049280_2049811_-	hypothetical protein	NA	NA	NA	NA	NA
AZR55503.1|2049797_2050727_-	hypothetical protein	NA	NA	NA	NA	NA
AZR55504.1|2050860_2051088_-	hypothetical protein	NA	NA	NA	NA	NA
AZR55505.1|2051204_2051411_+	hypothetical protein	NA	NA	NA	NA	NA
AZR55506.1|2052085_2052268_+	hypothetical protein	NA	NA	NA	NA	NA
AZR55507.1|2052224_2052683_+|transposase	IS200/IS605 family transposase IS200F	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
AZR58215.1|2052849_2053152_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZR55508.1|2053129_2053618_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	2.1e-57
AZR58214.1|2053638_2054079_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	84.3	3.5e-56
AZR55509.1|2054304_2054487_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
AZR55510.1|2054557_2055310_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	75.6	5.3e-12
AZR55511.1|2055275_2056697_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.0	1.8e-186
AZR55512.1|2056696_2058217_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.4	7.5e-106
AZR55513.1|2058257_2058947_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
AZR55514.1|2058943_2060290_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.4	3.2e-68
AZR55515.1|2060291_2060774_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
AZR55516.1|2060773_2061802_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
AZR55517.1|2061805_2062153_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
AZR55518.1|2062159_2062615_+	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	46.0	1.2e-19
AZR55519.1|2062608_2063193_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
AZR55520.1|2063189_2063555_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	8.8e-21
AZR55521.1|2063539_2064085_+	hypothetical protein	NA	NA	NA	NA	NA
AZR55522.1|2064065_2065550_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	4.0e-96
AZR55523.1|2065550_2065997_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
AZR55524.1|2065996_2066401_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
AZR55525.1|2066442_2066625_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AZR55526.1|2066608_2068780_+	transglycosylase	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
AZR55527.1|2068776_2069487_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	6.5e-28
AZR55528.1|2069486_2069789_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
AZR55529.1|2069785_2070655_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
AZR55530.1|2070635_2071313_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	35.5	4.6e-31
AZR55531.1|2071325_2071682_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
AZR55532.1|2071678_2072920_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.6	4.5e-101
AZR55533.1|2072921_2073524_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
AZR55534.1|2073513_2074965_+	short-chain dehydrogenase	NA	E5G6P0	Salmonella_phage	71.2	2.9e-43
AZR55535.1|2074964_2075540_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	2.9e-95
AZR55536.1|2075922_2076618_+	hypothetical protein	NA	NA	NA	NA	NA
AZR55537.1|2076618_2077275_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZR55538.1|2077693_2078593_-	regulator	NA	NA	NA	NA	NA
AZR55539.1|2078855_2079998_-	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AZR58216.1|2080905_2081760_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
2083261:2083275	attR	AATGACGTGTGAACG	NA	NA	NA	NA
>prophage 6
CP028318	Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 chromosome, complete genome	4884375	2872459	2971267	4884375	tRNA,tail,protease,terminase,holin,integrase,portal,lysis	Salmonella_phage(43.64%)	100	2896553:2896572	2968340:2968359
AZR56322.1|2872459_2873140_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
AZR56323.1|2873485_2873695_-	hypothetical protein	NA	NA	NA	NA	NA
AZR56324.1|2873760_2874420_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
AZR56325.1|2874506_2874836_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AZR56326.1|2874832_2875114_-	acylphosphatase	NA	NA	NA	NA	NA
AZR56327.1|2875162_2875942_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZR56328.1|2875967_2876516_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AZR56329.1|2876730_2877942_+	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AZR56330.1|2877999_2878317_+	heat-shock protein HspQ	NA	NA	NA	NA	NA
AZR56331.1|2878361_2878778_-	CoA-binding protein	NA	NA	NA	NA	NA
AZR56332.1|2878948_2879611_+	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AZR56333.1|2879705_2880164_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AZR56334.1|2880199_2882254_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
AZR56335.1|2882377_2882824_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AZR56336.1|2882842_2884996_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AZR56337.1|2884982_2885588_-	DNA transformation protein	NA	NA	NA	NA	NA
AZR56338.1|2885804_2886314_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AZR56339.1|2886670_2887723_+	outer membrane protein A	NA	NA	NA	NA	NA
AZR56340.1|2887794_2888247_-	macrodomain Ter protein	NA	NA	NA	NA	NA
AZR56341.1|2888432_2890193_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AZR56342.1|2890261_2890780_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AZR56343.1|2890879_2891047_-	ribosome modulation factor	NA	NA	NA	NA	NA
AZR56344.1|2891302_2891866_-	hypothetical protein	NA	NA	NA	NA	NA
AZR56345.1|2891862_2893503_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AZR56346.1|2893507_2894761_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AZR56347.1|2894775_2896683_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2896553:2896572	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
AZR56348.1|2896695_2898804_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AZR56349.1|2898902_2900012_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AZR56350.1|2900008_2900551_-	cell division protein ZapC	NA	NA	NA	NA	NA
AZR56351.1|2900716_2901727_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AZR56352.1|2901934_2904547_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
AZR56353.1|2904973_2905165_+	DNA-damage-inducible protein I	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
AZR56354.1|2905435_2906122_+	virulence protein	NA	NA	NA	NA	NA
AZR56355.1|2906473_2907100_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AZR56356.1|2907747_2908716_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
AZR56357.1|2909191_2909773_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.5	3.3e-94
AZR56358.1|2909772_2912211_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.6	1.7e-91
AZR56359.1|2912264_2912507_-	hypothetical protein	NA	NA	NA	NA	NA
AZR56360.1|2912545_2914051_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	63.9	6.9e-120
AZR56361.1|2915968_2916673_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
AZR56362.1|2917317_2918013_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.2	6.5e-89
AZR56363.1|2918102_2918636_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AZR56364.1|2918752_2919250_-	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
AZR56365.1|2919348_2919681_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
AZR58255.1|2919677_2922665_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
AZR56366.1|2922744_2923074_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AZR56367.1|2923070_2923469_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AZR56368.1|2923514_2924264_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
AZR56369.1|2924275_2924677_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
AZR56370.1|2924673_2925240_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
AZR56371.1|2925220_2925520_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AZR56372.1|2925512_2925836_-	recombinase RecA	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AZR58257.1|2925926_2928008_-	peptidase S14	NA	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
AZR58256.1|2927931_2929449_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
AZR56373.1|2929475_2929682_-	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AZR56374.1|2929678_2931817_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
AZR56375.1|2931773_2932307_-	DNA breaking-rejoining protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
AZR58259.1|2932514_2932994_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AZR56376.1|2933011_2933464_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AZR58258.1|2933447_2933777_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AZR56377.1|2934052_2934739_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
AZR56378.1|2935099_2935549_+	hypothetical protein	NA	NA	NA	NA	NA
AZR56379.1|2935684_2935810_-	hypothetical protein	NA	NA	NA	NA	NA
AZR56380.1|2935983_2936301_-	hypothetical protein	NA	NA	NA	NA	NA
AZR56381.1|2936367_2937165_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	5.2e-151
AZR56382.1|2937154_2937301_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AZR56383.1|2937297_2937909_-	protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
AZR56384.1|2937911_2938118_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AZR56385.1|2938802_2939024_-	hypothetical protein	NA	NA	NA	NA	NA
AZR56386.1|2939135_2939369_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
AZR56387.1|2939660_2939951_-	hypothetical protein	NA	NA	NA	NA	NA
AZR56388.1|2940028_2940340_-	hypothetical protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
AZR56389.1|2940336_2940684_-	DNA-binding protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
AZR56390.1|2940694_2941444_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AZR56391.1|2941446_2942430_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
AZR56392.1|2942514_2942889_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AZR56393.1|2942854_2943094_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
AZR56394.1|2943213_2943624_+	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
AZR56395.1|2943673_2943934_+	hypothetical protein	NA	NA	NA	NA	NA
AZR56396.1|2943926_2944085_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
AZR56397.1|2944106_2944406_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
AZR56398.1|2944532_2947418_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	97.3	0.0e+00
AZR56399.1|2947380_2948538_+	enterohemolysin	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
AZR56400.1|2948580_2948820_+	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AZR56401.1|2948860_2949109_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AZR56402.1|2949153_2950446_+|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
AZR56403.1|2950640_2951843_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AZR56404.1|2953600_2954815_-	PLP-dependent lyase/thiolase	NA	NA	NA	NA	NA
AZR56405.1|2954901_2955135_+	hypothetical protein	NA	NA	NA	NA	NA
AZR56406.1|2955131_2955593_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZR56407.1|2955793_2957194_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
AZR56408.1|2957800_2958892_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
AZR56409.1|2959076_2960267_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AZR56410.1|2960328_2960976_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZR56411.1|2961003_2961552_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
AZR56412.1|2961811_2963653_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AZR56413.1|2963997_2968464_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
2968340:2968359	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
AZR56414.1|2968463_2969168_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
AZR56415.1|2969148_2970471_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
AZR56416.1|2970463_2971267_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 7
CP028318	Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 chromosome, complete genome	4884375	3021330	3030062	4884375	protease,transposase	Enterobacteria_phage(14.29%)	9	NA	NA
AZR56456.1|3021330_3022585_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
AZR56457.1|3023048_3023507_-|transposase	IS200/IS605 family transposase IS200F	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
AZR56458.1|3023463_3023646_-	hypothetical protein	NA	NA	NA	NA	NA
AZR56459.1|3023698_3025975_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AZR56460.1|3026005_3026326_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AZR56461.1|3026649_3026871_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AZR56462.1|3026825_3027020_-	hypothetical protein	NA	NA	NA	NA	NA
AZR56463.1|3027000_3028947_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
AZR56464.1|3028943_3030062_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 8
CP028318	Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 chromosome, complete genome	4884375	3622704	3667948	4884375	tail,protease,terminase,integrase,portal,coat,lysis	Enterobacteria_phage(79.41%)	69	3614394:3614410	3677163:3677179
3614394:3614410	attL	ACGCGAATTTCAATATC	NA	NA	NA	NA
AZR57000.1|3622704_3622884_-	hypothetical protein	NA	M1E3P7	Enterobacteria_phage	92.3	4.3e-13
AZR57001.1|3623000_3623363_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
AZR57002.1|3623359_3624292_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
AZR57003.1|3624281_3625739_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
AZR57004.1|3625797_3627801_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
AZR57005.1|3627936_3628185_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
AZR58290.1|3628205_3628499_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
AZR57006.1|3628637_3630614_-	DNA transfer protein	NA	Q76H13	Enterobacteria_phage	99.8	0.0e+00
AZR57007.1|3630613_3632050_-	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
AZR57008.1|3632060_3632750_-	DNA transfer protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
AZR57009.1|3632752_3633208_-	hypothetical protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
AZR57010.1|3633207_3633909_-|tail	phage tail protein	tail	Q76H17	Enterobacteria_phage	100.0	1.7e-76
AZR57011.1|3633912_3635331_-	hypothetical protein	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
AZR57012.1|3635290_3635791_-	hypothetical protein	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
AZR57013.1|3635774_3636335_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
AZR57014.1|3636375_3637668_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
AZR57015.1|3637667_3638579_-	scaffolding protein	NA	Q76H22	Enterobacteria_phage	100.0	1.5e-162
AZR57016.1|3638592_3640770_-|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
AZR57017.1|3640769_3642269_-|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
AZR57018.1|3642246_3642735_-	DNA-packaging protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
AZR57019.1|3642738_3643143_-	Decoration protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
AZR57020.1|3643142_3643532_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
AZR57021.1|3643535_3643778_-	DUF2560 domain-containing protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
AZR57022.1|3644000_3644531_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
AZR57023.1|3644484_3644709_-	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	88.7	3.6e-25
AZR57024.1|3644743_3645211_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
AZR58291.1|3645207_3645705_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
AZR57025.1|3645682_3645886_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
AZR57026.1|3645970_3646204_-	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	87.0	1.1e-21
AZR57027.1|3646316_3647090_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
AZR57028.1|3647086_3647266_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
AZR57029.1|3647246_3647450_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
AZR57030.1|3647446_3647671_-	protein ninY	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
AZR57031.1|3647667_3648279_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
AZR57032.1|3648271_3648448_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
AZR57033.1|3648440_3648782_-	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
AZR57034.1|3648784_3648961_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
AZR57035.1|3648927_3649101_-	protein ninD	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
AZR57036.1|3649097_3649553_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.7e-80
AZR57037.1|3649608_3649878_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
AZR57038.1|3649874_3651251_-	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
AZR57039.1|3651247_3652069_-	replication of DNA	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
AZR57040.1|3652251_3652533_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
AZR57041.1|3652643_3652859_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
AZR57042.1|3652969_3653659_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
AZR57043.1|3653823_3654903_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
AZR57044.1|3654941_3655145_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
AZR57045.1|3655508_3655811_+	regulator	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
AZR57046.1|3655823_3656411_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
AZR57047.1|3656624_3656819_+	restriction endonuclease	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
AZR57048.1|3656902_3657547_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	100.0	6.5e-51
AZR57049.1|3657580_3657868_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
AZR57050.1|3658143_3658458_+	superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
AZR57051.1|3658542_3658701_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
AZR57052.1|3658681_3658870_+	protein kil	NA	I6S647	Salmonella_phage	100.0	3.7e-31
AZR57053.1|3658999_3659707_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
AZR57054.1|3659706_3659991_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
AZR57055.1|3660037_3660331_+	RecBCD nuclease inhibitor	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
AZR57056.1|3660341_3660512_+	DUF2737 domain-containing protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
AZR57057.1|3660508_3661018_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
AZR57058.1|3661014_3661248_+	hypothetical protein	NA	NA	NA	NA	NA
AZR57059.1|3661234_3661879_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
AZR57060.1|3661878_3662163_+	DUF4752 domain-containing protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
AZR57061.1|3662155_3662440_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
AZR57062.1|3662651_3663002_+	DNA-binding protein	NA	Q76H29	Enterobacteria_phage	100.0	3.7e-61
AZR58292.1|3663373_3664042_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	4.7e-129
AZR57063.1|3664247_3665498_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
AZR57064.1|3665509_3666613_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
AZR57065.1|3666895_3667948_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
3677163:3677179	attR	ACGCGAATTTCAATATC	NA	NA	NA	NA
>prophage 9
CP028318	Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 chromosome, complete genome	4884375	4421408	4468451	4884375	tRNA,tail,plate	Burkholderia_phage(42.86%)	49	NA	NA
AZR57715.1|4421408_4422407_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AZR57716.1|4422494_4423805_-	conjugal transfer protein	NA	NA	NA	NA	NA
AZR57717.1|4424051_4424567_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AZR57718.1|4424665_4424875_-	CsbD family protein	NA	NA	NA	NA	NA
AZR58326.1|4424896_4425010_-	hypothetical protein	NA	NA	NA	NA	NA
AZR57719.1|4425006_4426332_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AZR57720.1|4426510_4427119_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AZR57721.1|4427227_4427596_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AZR57722.1|4427766_4430187_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AZR57723.1|4430285_4431158_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AZR57724.1|4431171_4431669_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AZR57725.1|4431849_4432767_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AZR57726.1|4432930_4434289_-	maltoporin	NA	NA	NA	NA	NA
AZR57727.1|4434377_4435487_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AZR57728.1|4435848_4437039_+	maltose-binding periplasmic protein	NA	NA	NA	NA	NA
AZR57729.1|4437170_4438715_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AZR57730.1|4438729_4439620_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AZR57731.1|4439785_4440196_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AZR57732.1|4440338_4442435_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AZR57733.1|4442434_4443172_-	hypothetical protein	NA	NA	NA	NA	NA
AZR57734.1|4443168_4443807_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AZR57735.1|4443870_4444113_-	outer membrane protein	NA	NA	NA	NA	NA
AZR57736.1|4444556_4446206_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AZR57737.1|4446550_4447900_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AZR57738.1|4448032_4448380_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
AZR57739.1|4448955_4449243_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
AZR57740.1|4449245_4449851_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
AZR57741.1|4449863_4450178_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AZR57742.1|4450337_4450793_+	hypothetical protein	NA	NA	NA	NA	NA
AZR57743.1|4450789_4450987_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AZR57744.1|4450976_4452404_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
AZR57745.1|4452403_4452928_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AZR57746.1|4452979_4453297_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZR57747.1|4453256_4453385_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZR57748.1|4453481_4455836_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
AZR57749.1|4456787_4456997_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AZR57750.1|4456984_4458028_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
AZR57751.1|4458037_4458760_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
AZR57752.1|4459087_4459450_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
AZR57753.1|4459446_4460376_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
AZR57754.1|4460375_4461923_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
AZR57755.1|4462086_4462446_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AZR57756.1|4462436_4463552_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
AZR57757.1|4463544_4464177_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
AZR57758.1|4464179_4465925_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
AZR57759.1|4465929_4466535_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AZR57760.1|4466531_4466987_+	hypothetical protein	NA	NA	NA	NA	NA
AZR57761.1|4467235_4467526_+	hypothetical protein	NA	NA	NA	NA	NA
AZR57762.1|4467722_4468451_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 10
CP028318	Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 chromosome, complete genome	4884375	4838494	4879619	4884375	integrase,transposase	Escherichia_phage(25.0%)	41	4852545:4852557	4879833:4879845
AZR58084.1|4838494_4839259_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AZR58085.1|4839346_4839460_+	NTP-binding protein	NA	NA	NA	NA	NA
AZR58086.1|4839765_4840266_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZR58087.1|4840284_4840464_+	hypothetical protein	NA	NA	NA	NA	NA
AZR58088.1|4840393_4841233_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AZR58089.1|4841226_4841574_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AZR58342.1|4841790_4842657_-	PSE family carbenicillin-hydrolyzing class A beta-lactamase CARB-2	NA	A0A077SL40	Escherichia_phage	44.1	4.8e-57
AZR58090.1|4842862_4843516_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	1.1e-21
AZR58091.1|4843742_4845275_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZR58092.1|4845366_4846158_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR58093.1|4846178_4847354_-	tetracycline efflux MFS transporter Tet(G)	NA	NA	NA	NA	NA
AZR58094.1|4847457_4848084_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZR58095.1|4848080_4848263_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AZR58096.1|4848290_4849505_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	4.2e-19
AZR58097.1|4849721_4850693_-	sulfonamide-resistant dihydropteroate synthase Sul1-delta	NA	NA	NA	NA	NA
AZR58098.1|4850686_4851034_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AZR58343.1|4851197_4851989_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AZR58099.1|4852134_4853148_+|integrase	integrase/recombinase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.1	2.3e-71
4852545:4852557	attL	CCAGCTTCTGTAT	NA	NA	NA	NA
AZR58100.1|4853086_4853398_+|transposase	transposase	transposase	NA	NA	NA	NA
AZR58101.1|4853421_4854006_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	58.1	5.5e-49
AZR58102.1|4854084_4855074_+	ATP-binding protein	NA	NA	NA	NA	NA
AZR58103.1|4855094_4857638_+	subtilase	NA	NA	NA	NA	NA
AZR58104.1|4857715_4859641_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AZR58105.1|4859637_4861299_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	22.8	7.1e-09
AZR58106.1|4862367_4863240_+|integrase	integrase	integrase	NA	NA	NA	NA
AZR58107.1|4864125_4864311_+	hypothetical protein	NA	NA	NA	NA	NA
AZR58108.1|4864388_4864658_+	hypothetical protein	NA	NA	NA	NA	NA
AZR58109.1|4865072_4865468_-	hypothetical protein	NA	NA	NA	NA	NA
AZR58110.1|4865464_4866322_-	hypothetical protein	NA	NA	NA	NA	NA
AZR58111.1|4866565_4867990_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
AZR58112.1|4867993_4871398_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AZR58113.1|4871397_4871652_+	hypothetical protein	NA	NA	NA	NA	NA
AZR58114.1|4871671_4871962_-	hypothetical protein	NA	NA	NA	NA	NA
AZR58115.1|4872136_4872358_+	hypothetical protein	NA	NA	NA	NA	NA
AZR58116.1|4872357_4872969_+	hypothetical protein	NA	NA	NA	NA	NA
AZR58117.1|4872971_4873505_+	regulator	NA	NA	NA	NA	NA
AZR58118.1|4873601_4876361_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AZR58344.1|4876511_4876739_+	DNA-binding protein	NA	NA	NA	NA	NA
AZR58119.1|4876725_4877679_+	replication protein	NA	NA	NA	NA	NA
AZR58120.1|4878036_4878405_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZR58121.1|4878401_4879619_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	28.3	6.3e-15
4879833:4879845	attR	ATACAGAAGCTGG	NA	NA	NA	NA
>prophage 1
CP028319	Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067216 plasmid pSC-09-1, complete sequence	94045	72370	81666	94045	transposase	Escherichia_phage(28.57%)	12	NA	NA
AZR58427.1|72370_73051_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
AZR58428.1|73195_73384_-	hypothetical protein	NA	NA	NA	NA	NA
AZR58429.1|73432_73789_-	hypothetical protein	NA	NA	NA	NA	NA
AZR58430.1|73781_74252_-	hypothetical protein	NA	NA	NA	NA	NA
AZR58431.1|74762_75185_+	protein SamA	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
AZR58432.1|75184_76459_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.9	3.9e-156
AZR58433.1|76540_77518_-	chromosome partitioning protein ParB	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
AZR58434.1|77514_78720_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
AZR58435.1|79134_80076_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
AZR58436.1|80107_80674_-	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AZR58437.1|80730_81066_-	hypothetical protein	NA	NA	NA	NA	NA
AZR58452.1|81249_81666_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
