The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	29001	105854	2351263	transposase,protease	Streptococcus_phage(23.08%)	59	NA	NA
AZR16643.1|29001_29862_+|protease	protease	protease	NA	NA	NA	NA
AZR14556.1|29773_30166_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZR14557.1|30305_30506_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR14558.1|30502_31027_+	DUF3278 domain-containing protein	NA	NA	NA	NA	NA
AZR14559.1|31112_32252_+	amino acid permease	NA	NA	NA	NA	NA
AZR14560.1|32379_33447_+	peptidase	NA	NA	NA	NA	NA
AZR14561.1|33545_34319_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14562.1|34386_34551_-	ATP:cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
AZR14563.1|34543_34753_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14564.1|34847_35108_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14565.1|35436_36339_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16644.1|38707_39277_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14566.1|42693_43728_+	AI-2E family transporter	NA	NA	NA	NA	NA
AZR14567.1|43727_44300_+	esterase	NA	NA	NA	NA	NA
AZR14568.1|44333_44516_-	hypothetical protein	NA	NA	NA	NA	NA
AZR14569.1|44699_46034_+	MFS transporter	NA	NA	NA	NA	NA
AZR14570.1|46494_47256_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	8.3e-13
AZR14571.1|47252_48149_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZR14572.1|48145_49138_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR14573.1|49498_50212_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
AZR14574.1|50208_51078_-	Mg+2 and co2 transporter	NA	NA	NA	NA	NA
AZR14575.1|51192_52050_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.3	1.8e-56
AZR14576.1|52132_54058_+	GTP-binding protein	NA	A0A1S5SF82	Streptococcus_phage	30.4	7.3e-66
AZR14577.1|54255_55074_+	HAD family hydrolase	NA	NA	NA	NA	NA
AZR14578.1|55118_56288_-	MFS transporter	NA	NA	NA	NA	NA
AZR14579.1|56428_57442_-	lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	35.3	1.3e-50
AZR14580.1|57798_58050_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14581.1|59103_59931_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	63.1	1.0e-96
AZR14582.1|60004_61447_+	amino acid permease	NA	NA	NA	NA	NA
AZR14583.1|61512_64341_+	DUF3427 domain-containing protein	NA	U3PFS7	Lactobacillus_phage	27.8	3.0e-23
AZR14584.1|64375_65539_-	penicillin-binding protein	NA	NA	NA	NA	NA
AZR14585.1|65632_66850_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
AZR14586.1|66911_67325_+	peptide deformylase	NA	NA	NA	NA	NA
AZR14587.1|79847_80069_-	steroid-binding protein	NA	NA	NA	NA	NA
AZR14588.1|80161_81031_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZR14589.1|81027_81975_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
AZR14590.1|81988_82942_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
AZR14591.1|82959_83796_-	glycosyl transferase	NA	NA	NA	NA	NA
AZR14592.1|83812_84574_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZR14593.1|84958_85180_-	hypothetical protein	NA	NA	NA	NA	NA
AZR14594.1|85506_86223_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.2	6.7e-41
AZR14595.1|86293_88147_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.8	1.3e-32
AZR14596.1|88127_89489_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14597.1|89491_90316_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14598.1|90328_91126_+	MBL fold hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.4	6.0e-30
AZR14599.1|91205_92468_+	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	27.7	2.4e-09
AZR14600.1|92985_93465_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AZR14601.1|93806_95213_-|transposase	ISLre2 family transposase ISLcr2	transposase	NA	NA	NA	NA
AZR14602.1|95375_95636_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14603.1|95649_95769_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14604.1|95879_97022_+	peptidoglycan endopeptidase	NA	NA	NA	NA	NA
AZR14605.1|97030_97765_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14606.1|97788_98670_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZR14607.1|98678_99332_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR14608.1|99336_100689_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.4	3.4e-09
AZR14609.1|100777_101956_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
AZR14610.1|102358_103600_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	3.4e-80
AZR14611.1|103981_104923_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZR14612.1|104957_105854_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
>prophage 2
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	205228	270527	2351263	protease,tRNA,integrase,transposase	Phaeocystis_globosa_virus(10.53%)	59	223407:223423	278712:278728
AZR14704.1|205228_206455_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.1	1.1e-96
AZR14705.1|206784_208179_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
AZR14706.1|208432_209695_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.5	6.7e-84
AZR14707.1|210118_210523_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14708.1|210620_211934_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.2	1.4e-60
AZR14709.1|211933_212587_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.1	8.4e-06
AZR14710.1|212754_214374_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR14711.1|214563_216192_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR14712.1|216450_217821_+|transposase	IS4/IS5 family transposase	transposase	NA	NA	NA	NA
AZR14713.1|218044_219190_+	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	33.5	1.1e-61
AZR14714.1|219348_220278_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR14715.1|220286_221318_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR14716.1|221333_222392_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	2.8e-19
AZR14717.1|222412_223357_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	2.7e-21
223407:223423	attL	AAAGTGTCTGGGAAAAA	NA	NA	NA	NA
AZR14718.1|223544_225242_+|transposase	IS5/IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	38.3	1.9e-89
AZR14719.1|225252_226569_-	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	35.0	5.2e-63
AZR14720.1|226710_227136_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AZR14721.1|227377_227839_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AZR14722.1|227918_228581_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZR14723.1|228709_229303_-	DUF159 family protein	NA	NA	NA	NA	NA
AZR14724.1|229420_230443_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AZR14725.1|230458_230938_+	competence protein ComE	NA	A7KUY9	Bacillus_phage	60.7	1.8e-37
AZR14726.1|230918_231536_+	TPM domain-containing protein	NA	NA	NA	NA	NA
AZR14727.1|231833_232787_+	ATPase	NA	A7IUR5	Paramecium_bursaria_Chlorella_virus	23.3	2.2e-07
AZR14728.1|232737_234510_+	magnesium-importing ATPase	NA	NA	NA	NA	NA
AZR14729.1|234599_236576_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.0	2.4e-96
AZR14730.1|236575_237343_+	hydrolase TatD	NA	NA	NA	NA	NA
AZR14731.1|237329_237896_+	ribonuclease M5	NA	NA	NA	NA	NA
AZR14732.1|237885_238770_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
AZR14733.1|238831_239089_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14734.1|239197_240028_+	pur operon repressor	NA	NA	NA	NA	NA
AZR14735.1|240074_241460_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L277	Tupanvirus	32.7	1.3e-27
AZR14736.1|241588_242341_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14737.1|242449_244222_+	cell division protein	NA	NA	NA	NA	NA
AZR14738.1|244449_245424_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	35.8	1.2e-45
AZR14739.1|245586_246507_+	ROK family protein	NA	NA	NA	NA	NA
AZR16649.1|246567_246846_-	hypothetical protein	NA	NA	NA	NA	NA
AZR14740.1|246877_248251_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.5	8.4e-32
AZR14741.1|248365_248770_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
AZR14742.1|248816_249317_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
AZR14743.1|249433_251053_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.9	5.1e-137
AZR14744.1|251184_252480_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZR14745.1|252548_253073_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZR14746.1|253127_254552_-	dipeptidase	NA	NA	NA	NA	NA
AZR14747.1|254638_255451_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZR14748.1|255602_256889_-	purine permease	NA	NA	NA	NA	NA
AZR14749.1|256895_257474_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AZR14750.1|257707_258310_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZR14751.1|258532_260083_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	34.1	9.5e-24
AZR14752.1|260328_262281_+	site-specific DNA-methyltransferase	NA	A0A1B0XWD0	Campylobacter_phage	34.5	1.7e-46
AZR14753.1|262280_264944_+	restriction endonuclease subunit R	NA	NA	NA	NA	NA
AZR14754.1|265174_265546_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14755.1|265853_266123_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14756.1|266124_266970_+	cell division protein FtsK	NA	NA	NA	NA	NA
AZR14757.1|267085_267511_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14758.1|267461_267971_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14759.1|268049_268229_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
AZR14760.1|268240_269500_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AZR14761.1|269996_270527_-|transposase	transposase	transposase	A0A2K9VD29	Lactobacillus_phage	35.9	8.6e-17
278712:278728	attR	AAAGTGTCTGGGAAAAA	NA	NA	NA	NA
>prophage 4
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	459619	604035	2351263	protease,tRNA,bacteriocin,transposase	Staphylococcus_phage(15.15%)	118	NA	NA
AZR14954.1|459619_460969_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR14955.1|461315_462161_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AZR14956.1|462269_462695_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
AZR14957.1|462712_463081_+	DUF1269 domain-containing family protein	NA	NA	NA	NA	NA
AZR14958.1|463140_464247_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
AZR14959.1|464397_465399_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZR14960.1|465440_466811_-	glycerophosphodiester phosphodiesterase	NA	A0A173GBD0	Staphylococcus_phage	26.9	2.8e-11
AZR14961.1|466924_467245_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14962.1|467260_468643_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AZR14963.1|469226_469997_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
AZR14964.1|469993_470602_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
AZR14965.1|470613_471264_-	hypothetical protein	NA	NA	NA	NA	NA
AZR14966.1|471273_472266_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A249XZT7	Enterococcus_phage	27.0	7.0e-12
AZR14967.1|481152_482331_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
AZR14968.1|482331_483375_+	glycosyltransferase	NA	NA	NA	NA	NA
AZR14969.1|483374_484409_+	UPF0104 family protein	NA	NA	NA	NA	NA
AZR14970.1|484473_486534_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	46.1	7.7e-146
AZR14971.1|486601_486835_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AZR14972.1|486907_489247_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.7	2.0e-81
AZR14973.1|489259_489718_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	57.4	1.6e-43
AZR14974.1|495476_496358_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR14975.1|496822_498022_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	64.5	4.3e-141
AZR14976.1|498045_499506_+	MFS transporter	NA	NA	NA	NA	NA
AZR14977.1|499641_500496_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AZR14978.1|500497_501391_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AZR14979.1|501599_502499_+	esterase	NA	NA	NA	NA	NA
AZR14980.1|502511_503954_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AZR14981.1|503919_505062_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
AZR14982.1|505077_505923_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AZR14983.1|506570_507941_+|transposase	IS4/IS5 family transposase	transposase	NA	NA	NA	NA
AZR14984.1|508055_509342_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AZR14985.1|509343_510360_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AZR14986.1|510359_512078_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.6	1.7e-26
AZR14987.1|512067_513816_+	thiol reductant ABC exporter subunit CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	8.0e-19
AZR14988.1|513825_514527_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
AZR14989.1|514523_515513_-	farnesyl pyrophosphate synthetase	NA	NA	NA	NA	NA
AZR14990.1|515572_516472_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AZR14991.1|516486_517707_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AZR16653.1|517776_517872_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16652.1|517866_518166_+	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	75.9	3.6e-28
AZR14992.1|518390_519230_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14993.1|519289_520213_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	44.4	5.6e-64
AZR14994.1|520255_520921_-	PAP2 family protein	NA	NA	NA	NA	NA
AZR14995.1|521210_523625_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.3	1.2e-307
AZR14996.1|523711_525355_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZR14997.1|525806_527015_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR14998.1|527046_527289_+	hypothetical protein	NA	NA	NA	NA	NA
AZR14999.1|527403_527649_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15000.1|528078_528963_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR15001.1|528980_529889_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AZR15002.1|529888_530764_+	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AZR15003.1|530766_531522_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.0	5.3e-20
AZR15004.1|531562_532204_+	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AZR15005.1|532314_532992_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.7	2.1e-31
AZR15006.1|532991_534668_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	36.0	6.0e-32
AZR15007.1|535053_536232_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
AZR15008.1|536481_537708_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.4	2.3e-97
AZR15009.1|538640_539918_-|transposase	transposase	transposase	A0A2K9VD29	Lactobacillus_phage	28.4	2.7e-24
AZR15010.1|539856_540522_-|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	52.3	1.3e-57
AZR16654.1|541515_542772_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	44.0	2.7e-53
AZR16655.1|543269_543596_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15011.1|543863_545165_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AZR15012.1|545167_546016_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AZR15013.1|546141_546828_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
AZR15014.1|547191_548877_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	31.9	2.7e-72
AZR15015.1|548987_549905_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
AZR15016.1|550041_551076_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.8	3.1e-39
AZR15017.1|551228_551753_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15018.1|552348_552552_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15019.1|552703_553882_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	5.7e-37
AZR15020.1|554052_554931_+	prenyltransferase	NA	NA	NA	NA	NA
AZR15021.1|554923_555781_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZR15022.1|556002_556326_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZR15023.1|556564_557743_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZR15024.1|557899_558535_+	peptidoglycan-binding protein	NA	A0A0E3XCL7	Enterococcus_phage	60.8	4.2e-18
AZR15025.1|558558_559215_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15026.1|559294_560026_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15027.1|560022_560217_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15028.1|560417_560633_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15029.1|560763_561318_+	MFS transporter	NA	NA	NA	NA	NA
AZR15030.1|561438_562770_+|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	39.0	5.2e-63
AZR15031.1|562961_563795_+	MFS transporter	NA	NA	NA	NA	NA
AZR15032.1|563924_564698_+	ATP-binding protein	NA	NA	NA	NA	NA
AZR15033.1|564736_565915_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	2.0e-37
AZR15034.1|566085_566574_+	ATP-binding protein	NA	NA	NA	NA	NA
AZR15035.1|566728_567838_+	ATP-binding protein	NA	NA	NA	NA	NA
AZR15036.1|567834_568953_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15037.1|569058_569877_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
AZR15038.1|570473_571772_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.9	7.9e-40
AZR15039.1|572054_572807_-	aquaporin family protein	NA	M1GYI5	Paramecium_bursaria_Chlorella_virus	31.2	5.3e-20
AZR15040.1|573228_573795_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	35.4	1.4e-20
AZR15041.1|573925_575104_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	2.0e-37
AZR15042.1|575230_577603_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	31.6	2.3e-125
AZR15043.1|577657_578515_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AZR15044.1|578602_580660_+	carboxypeptidase	NA	NA	NA	NA	NA
AZR15045.1|580676_581027_+	YlbF family regulator	NA	NA	NA	NA	NA
AZR15046.1|581035_582253_+	DNA repair exonuclease	NA	NA	NA	NA	NA
AZR15047.1|582233_584729_+	DNA repair protein	NA	NA	NA	NA	NA
AZR15048.1|584721_585699_+	HD domain-containing protein	NA	NA	NA	NA	NA
AZR15049.1|585815_586301_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15050.1|586325_587105_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AZR15051.1|587465_588947_+|protease	serine protease	protease	NA	NA	NA	NA
AZR15052.1|589034_589517_+	aldolase	NA	NA	NA	NA	NA
AZR15053.1|589627_590524_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AZR15054.1|590642_590999_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15055.1|591008_591440_-	HIT family protein	NA	D7NW73	Streptomyces_phage	33.7	4.5e-08
AZR15056.1|591530_592274_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.2e-19
AZR15057.1|592266_593478_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR15058.1|593487_594144_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AZR15059.1|594445_594775_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AZR15060.1|594864_595185_+	thioredoxin	NA	NA	NA	NA	NA
AZR15061.1|595203_595851_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
AZR15062.1|596138_597452_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AZR15063.1|597508_598771_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AZR15064.1|598950_599928_-	cell surface protein	NA	NA	NA	NA	NA
AZR15065.1|600026_601541_-	aminopeptidase	NA	NA	NA	NA	NA
AZR15066.1|601761_602940_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.7	1.7e-36
AZR15067.1|603054_604035_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 5
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	612687	661467	2351263	protease,tRNA,transposase	Corynebacterium_phage(25.0%)	47	NA	NA
AZR15077.1|612687_614622_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.4	1.2e-95
AZR15078.1|614823_615303_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15079.1|615424_616603_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.8	6.7e-38
AZR15080.1|616841_617876_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	1.5e-41
AZR15081.1|618014_619274_+	DUF389 domain-containing protein	NA	NA	NA	NA	NA
AZR15082.1|621160_621388_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15083.1|621553_621988_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AZR15084.1|621984_622422_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
AZR15085.1|623736_625143_+|transposase	ISLre2 family transposase ISLcr2	transposase	NA	NA	NA	NA
AZR15086.1|625217_625754_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR15087.1|627716_629420_-	adenosine deaminase	NA	NA	NA	NA	NA
AZR15088.1|629488_630550_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR15089.1|630574_631615_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.7	1.4e-26
AZR15090.1|631616_632414_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR15091.1|632499_633678_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
AZR15092.1|633753_634620_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR15093.1|634814_635732_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
AZR15094.1|635939_636473_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	40.1	1.2e-15
AZR15095.1|636494_636695_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AZR15096.1|636739_637096_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AZR15097.1|637143_638145_-	adenosine deaminase	NA	NA	NA	NA	NA
AZR15098.1|638426_639578_+|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	42.5	1.1e-80
AZR15099.1|639769_640294_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
AZR15100.1|640286_641396_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
AZR15101.1|641406_642060_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AZR15102.1|642040_642634_+	HD domain-containing protein	NA	NA	NA	NA	NA
AZR15103.1|642651_642999_+	ribosome silencing factor	NA	NA	NA	NA	NA
AZR15104.1|643002_644154_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AZR15105.1|644156_644720_+	DNA-binding protein	NA	NA	NA	NA	NA
AZR15106.1|644888_645605_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	29.6	1.5e-24
AZR15107.1|645582_647160_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	29.3	1.0e-09
AZR15108.1|647332_647614_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15109.1|647607_648492_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZR15110.1|648560_649742_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15111.1|649949_650438_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AZR15112.1|650484_651450_-	insertase	NA	NA	NA	NA	NA
AZR15113.1|651493_651766_-	acylphosphatase	NA	NA	NA	NA	NA
AZR15114.1|651689_651878_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15115.1|651949_653128_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.2	4.4e-37
AZR15116.1|653245_654013_+	RNA methyltransferase	NA	NA	NA	NA	NA
AZR15117.1|654120_654471_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR15118.1|654773_655433_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZR15119.1|655413_656085_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZR15120.1|656094_656835_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.5e-35
AZR15121.1|656837_657710_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR15122.1|657993_659043_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.7	3.1e-34
AZR15123.1|659046_661467_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 6
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	673122	826707	2351263	protease,tRNA,integrase,transposase	Bacillus_phage(18.18%)	115	799946:799973	812241:812268
AZR15134.1|673122_673980_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZR15135.1|674189_674729_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15136.1|674813_675593_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15137.1|675788_676382_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15138.1|676497_677097_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15139.1|677096_677816_+	cell surface protein	NA	NA	NA	NA	NA
AZR15140.1|677812_678694_+	heme ABC transporter substrate-binding protein IsdE	NA	NA	NA	NA	NA
AZR15141.1|678699_679626_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AZR15142.1|679618_680392_+	ABC transporter ATP-binding protein	NA	A0A1V0SD74	Indivirus	29.0	1.1e-12
AZR15143.1|680436_680721_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	53.9	8.3e-19
AZR15144.1|681468_681762_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15145.1|681764_682013_-	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	NA	NA	NA	NA
AZR15146.1|682280_683204_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AZR15147.1|683266_685906_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR15148.1|685993_688102_+	cell division protein FtsI	NA	NA	NA	NA	NA
AZR15149.1|688177_688327_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AZR16656.1|688381_688945_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AZR15150.1|688979_689666_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AZR15151.1|689665_689905_+	DUF910 domain-containing protein	NA	NA	NA	NA	NA
AZR15152.1|689963_690365_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AZR16657.1|690442_691363_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AZR15153.1|691355_692606_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
AZR15154.1|692741_694079_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AZR15155.1|694368_695283_+	ABC transporter	NA	NA	NA	NA	NA
AZR15156.1|695427_696417_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15157.1|696819_697065_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AZR15158.1|697064_697400_+	type II toxin-antitoxin system HicB family antitoxin	NA	R4JJS9	Burkholderia_phage	36.2	1.6e-16
AZR15159.1|697447_697642_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15160.1|697651_697930_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15161.1|698091_699243_+|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	43.7	7.4e-82
AZR15162.1|699564_700692_+	endonuclease	NA	NA	NA	NA	NA
AZR15163.1|700778_700910_+	antitoxin HicB	NA	NA	NA	NA	NA
AZR15164.1|701445_703080_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR15165.1|704431_705880_-	amino acid permease	NA	NA	NA	NA	NA
AZR15166.1|705993_707043_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.6	8.1e-51
AZR15167.1|707271_709359_+	ornithine decarboxylase	NA	NA	NA	NA	NA
AZR15168.1|709692_710061_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15169.1|710053_711373_-	nucleotidyltransferase	NA	M1Q231	Streptococcus_phage	40.1	6.5e-90
AZR15170.1|711605_713813_+	alpha-xylosidase	NA	NA	NA	NA	NA
AZR15171.1|714371_715763_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR15172.1|716395_717613_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR15173.1|717845_722561_+	peptidase S8	NA	NA	NA	NA	NA
AZR15174.1|722810_723806_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
AZR15175.1|723818_724403_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
AZR15176.1|724399_724771_+	PTS mannose family transporter subunit IIA	NA	NA	NA	NA	NA
AZR15177.1|724786_725494_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.8	3.0e-25
AZR15178.1|726536_727412_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR15179.1|727692_729522_+	FAD-binding dehydrogenase	NA	NA	NA	NA	NA
AZR15180.1|729522_730407_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR15181.1|730633_732049_+	anion permease	NA	NA	NA	NA	NA
AZR15182.1|732064_733849_+	succinate dehydrogenase	NA	NA	NA	NA	NA
AZR16658.1|735679_736942_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.1	5.3e-57
AZR15183.1|740034_740892_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZR15184.1|742724_744074_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR15185.1|744484_745225_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
AZR15186.1|745409_745715_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15187.1|746212_747439_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.9	5.6e-96
AZR16659.1|747821_749084_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.7	1.0e-55
AZR15188.1|750197_750428_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15189.1|750512_751217_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZR15190.1|751260_753228_+	YSIRK signal domain/LPXTG anchor domain surface protein	NA	NA	NA	NA	NA
AZR15191.1|753402_756351_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15192.1|756835_758014_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.7	6.7e-38
AZR15193.1|758034_759348_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.0	2.3e-55
AZR15194.1|759399_760431_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZR15195.1|760785_761376_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR15196.1|761372_762248_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AZR15197.1|762358_763351_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.1	4.5e-51
AZR15198.1|763458_764412_-	beta-galactosidase small subunit	NA	NA	NA	NA	NA
AZR15199.1|764395_766276_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	33.8	1.6e-97
AZR15200.1|766504_767509_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZR15201.1|767700_769620_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AZR15202.1|769630_771634_+	beta-galactosidase	NA	NA	NA	NA	NA
AZR15203.1|771800_772964_+	galactokinase	NA	NA	NA	NA	NA
AZR15204.1|772982_774452_+	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AZR15205.1|774575_775571_+	galactose mutarotase	NA	NA	NA	NA	NA
AZR15206.1|775747_776926_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
AZR15207.1|777083_777317_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15208.1|777373_778330_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZR15209.1|779341_780520_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
AZR15210.1|780677_781238_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AZR15211.1|781918_783196_+	sensor histidine kinase	NA	NA	NA	NA	NA
AZR15212.1|783242_784415_+	MFS transporter	NA	NA	NA	NA	NA
AZR15213.1|784424_784829_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AZR15214.1|784832_785345_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AZR15215.1|785396_786149_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15216.1|786297_787797_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15217.1|788458_789955_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
AZR15218.1|790010_791210_-	acetate kinase	NA	NA	NA	NA	NA
AZR15219.1|791495_792776_+	lactate oxidase	NA	NA	NA	NA	NA
AZR15220.1|792926_794000_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AZR15221.1|795807_796122_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
AZR15222.1|796130_797012_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
AZR15223.1|797026_797689_-	serine dehydratase	NA	NA	NA	NA	NA
AZR15224.1|798162_799665_-	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	28.3	1.1e-35
799946:799973	attL	ATATTTTTATGATAATTCATTTGCAAGC	NA	NA	NA	NA
AZR15225.1|805644_806304_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZR15226.1|806399_807434_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.0	8.2e-40
AZR15227.1|807804_808050_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15228.1|808049_808427_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
AZR15229.1|808767_809331_+|integrase	site-specific integrase	integrase	A3F636	Streptococcus_phage	31.6	6.1e-13
AZR15230.1|809458_810637_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZR16660.1|810802_812173_+|transposase	transposase	transposase	NA	NA	NA	NA
AZR15231.1|813063_813504_-	sodium:proton antiporter	NA	NA	NA	NA	NA
812241:812268	attR	ATATTTTTATGATAATTCATTTGCAAGC	NA	NA	NA	NA
AZR15232.1|813639_814062_-	FCD domain-containing protein	NA	NA	NA	NA	NA
AZR15233.1|814052_814259_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR15234.1|814430_815078_+	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AZR16661.1|815132_815771_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	31.9	5.8e-28
AZR15235.1|815772_816477_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AZR15236.1|816727_817651_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AZR15237.1|817819_818362_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
AZR15238.1|818502_819459_+	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.7	9.4e-22
AZR15239.1|819458_820736_+	dihydroorotase	NA	NA	NA	NA	NA
AZR15240.1|820735_821821_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.0	1.9e-55
AZR15241.1|821813_825002_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
AZR15242.1|825849_826707_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 7
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	859400	914082	2351263	tRNA,transposase	Staphylococcus_phage(31.82%)	49	NA	NA
AZR15278.1|859400_860345_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.1	3.6e-10
AZR15279.1|860295_861657_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
AZR16662.1|861661_862417_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
AZR15280.1|862406_864437_+	serine/threonine protein kinase	NA	A0A1V0SD90	Indivirus	28.0	5.8e-21
AZR15281.1|864437_865328_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
AZR15282.1|865340_865991_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AZR15283.1|865990_866665_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
AZR15284.1|866801_867008_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15285.1|867124_867310_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AZR15286.1|867477_867840_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AZR15287.1|867861_869523_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15288.1|869525_871562_+	DNA helicase RecG	NA	NA	NA	NA	NA
AZR15289.1|871581_872583_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
AZR15290.1|872613_872856_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	56.1	1.6e-07
AZR15291.1|872974_873991_+	dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	5.8e-14
AZR15292.1|873994_874981_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	2.5e-17
AZR15293.1|874983_875943_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AZR15294.1|875957_876887_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR15295.1|877497_878796_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.3	2.6e-38
AZR15296.1|879985_881680_+|transposase	IS5/IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	38.1	7.1e-89
AZR15297.1|881690_882146_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.6	9.6e-25
AZR15298.1|882160_883339_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	1.1e-99
AZR15299.1|883340_883937_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.8	3.1e-31
AZR15300.1|883929_884991_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.5	3.4e-41
AZR15301.1|885617_886475_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZR15302.1|886639_887311_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15303.1|887800_888979_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.7	8.8e-38
AZR16663.1|889283_889901_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZR15304.1|890007_891264_+	AAA family ATPase	NA	NA	NA	NA	NA
AZR15305.1|891315_892017_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR15306.1|892160_893690_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AZR15307.1|893682_894378_+	oxidoreductase	NA	NA	NA	NA	NA
AZR15308.1|894518_895757_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.2	5.0e-84
AZR15309.1|896205_896637_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AZR15310.1|896758_897937_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.7	9.7e-37
AZR15311.1|898118_898913_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	27.3	4.0e-10
AZR15312.1|898928_900137_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AZR15313.1|900117_901356_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	43.9	1.2e-101
AZR15314.1|901342_901804_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2H4N7M4	Lake_Baikal_phage	27.9	1.0e-05
AZR15315.1|901796_903200_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AZR15316.1|903199_903523_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
AZR15317.1|903534_905043_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AZR15318.1|907058_907241_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15319.1|907291_907864_+	maturase	NA	NA	NA	NA	NA
AZR15320.1|907941_908406_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	41.7	2.0e-25
AZR15321.1|908420_909599_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.4	3.3e-101
AZR15322.1|909600_910197_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.3	3.3e-33
AZR15323.1|910189_911248_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.6	1.5e-41
AZR15324.1|912903_914082_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
>prophage 8
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	918363	982995	2351263	tRNA,transposase	Corynebacterium_phage(20.0%)	52	NA	NA
AZR15328.1|918363_919221_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZR16664.1|920554_921100_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AZR15329.1|921356_922586_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.5	1.4e-78
AZR15330.1|922825_923320_-	thiol peroxidase	NA	NA	NA	NA	NA
AZR15331.1|923749_924928_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
AZR15332.1|927107_928190_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AZR15333.1|928279_928771_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZR15334.1|928772_929429_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15335.1|929868_930108_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15336.1|930329_931925_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	21.2	1.2e-13
AZR15337.1|932141_933320_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
AZR15338.1|933406_934885_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	20.6	1.3e-14
AZR15339.1|935000_936392_+	amino acid permease	NA	NA	NA	NA	NA
AZR15340.1|936596_937775_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZR15341.1|937883_938840_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	59.6	1.2e-112
AZR15342.1|938849_939359_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.5	2.8e-25
AZR15343.1|939444_941847_+	ATPase P	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.3	1.0e-40
AZR15344.1|941888_942830_-	DNA-entry nuclease	NA	NA	NA	NA	NA
AZR15345.1|943248_944103_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR15346.1|944115_945180_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	9.7e-28
AZR15347.1|945172_945856_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR15348.1|945986_947390_+	class II fumarate hydratase	NA	NA	NA	NA	NA
AZR15349.1|947402_948779_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	32.8	2.1e-54
AZR15350.1|948975_949905_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AZR15351.1|950040_951357_+	aminopeptidase	NA	NA	NA	NA	NA
AZR15352.1|953415_954114_+	RraA family protein	NA	NA	NA	NA	NA
AZR15353.1|954130_955600_+	anion permease	NA	NA	NA	NA	NA
AZR15354.1|955681_956473_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZR15355.1|956553_957609_+	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
AZR15356.1|957598_957892_+	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
AZR15357.1|957892_958807_+	citrate lyase subunit beta	NA	NA	NA	NA	NA
AZR15358.1|958796_960338_+	citrate lyase subunit alpha	NA	NA	NA	NA	NA
AZR15359.1|960754_961210_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AZR15360.1|961418_962252_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AZR15361.1|962244_963954_-	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.7e-18
AZR15362.1|963957_964515_-	DUF3816 family protein	NA	NA	NA	NA	NA
AZR15363.1|964672_965053_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AZR15364.1|965353_965680_-	transporter	NA	NA	NA	NA	NA
AZR15365.1|965727_966666_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZR15366.1|966829_968176_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15367.1|968239_968479_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15368.1|970801_971311_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AZR15369.1|971371_972316_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AZR15370.1|972371_972734_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15371.1|972748_974989_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1X9SH80	Bradyrhizobium_phage	36.4	2.3e-10
AZR15372.1|974988_975426_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AZR15373.1|975721_977008_+|tRNA	histidine--tRNA ligase	tRNA	A0A1V0S921	Catovirus	26.3	1.2e-24
AZR15374.1|977013_978867_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AZR15375.1|978932_980117_-	amino acid aminotransferase	NA	NA	NA	NA	NA
AZR15376.1|980274_981453_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.7e-36
AZR15377.1|981615_981873_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15378.1|981960_982995_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.0	1.1e-39
>prophage 9
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	1023274	1108535	2351263	tRNA,transposase,terminase,portal,holin,tail,protease,capsid,integrase	Lactobacillus_phage(36.67%)	91	1070530:1070547	1105851:1105868
AZR15412.1|1023274_1024453_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.6	8.2e-36
AZR16665.1|1024561_1025062_+	uridine kinase	NA	NA	NA	NA	NA
AZR15413.1|1025531_1026296_+	phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	48.1	2.3e-39
AZR15414.1|1026337_1027153_-	AAC(3) family N-acetyltransferase	NA	NA	NA	NA	NA
AZR15415.1|1028901_1029402_+	lactocepin S-layer protein	NA	NA	NA	NA	NA
AZR15416.1|1029628_1030852_-|integrase	site-specific integrase	integrase	A9D9I9	Lactobacillus_prophage	41.2	1.5e-72
AZR15417.1|1031030_1031576_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15418.1|1031904_1032852_-	hypothetical protein	NA	O48432	Lactobacillus_phage	55.4	7.3e-51
AZR15419.1|1032873_1033500_-	XRE family transcriptional regulator	NA	Q9G0C2	Lactococcus_phage	47.1	6.1e-46
AZR15420.1|1033632_1033857_+	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
AZR15421.1|1033884_1034085_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15422.1|1034203_1034464_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15423.1|1034695_1034929_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15424.1|1035259_1036078_+	hypothetical protein	NA	Q6SE92	Lactobacillus_prophage	39.7	5.2e-29
AZR15425.1|1036070_1036370_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15426.1|1036366_1036699_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15427.1|1036682_1037132_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15428.1|1037121_1037361_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15429.1|1037387_1037648_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15430.1|1037658_1038144_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15431.1|1038133_1038379_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15432.1|1038378_1038690_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15433.1|1038699_1038978_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15434.1|1038949_1039273_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15435.1|1039265_1039814_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15436.1|1039835_1040276_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15437.1|1040830_1041319_+	restriction endonuclease	NA	Q2I8B2	Bacillus_phage	35.1	3.8e-11
AZR15438.1|1041486_1041669_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15439.1|1041849_1042446_+|terminase	phage terminase small subunit P27 family	terminase	Q6J1Y7	Lactobacillus_phage	45.1	1.3e-08
AZR15440.1|1042435_1044313_+|terminase	terminase	terminase	Q6J1Y6	Lactobacillus_phage	50.3	4.3e-180
AZR15441.1|1044316_1044508_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15442.1|1044512_1045652_+|portal	phage portal protein	portal	A8YQJ0	Lactobacillus_phage	48.7	1.1e-93
AZR15443.1|1045635_1046355_+	peptidase	NA	E9LUQ2	Lactobacillus_phage	44.2	4.4e-48
AZR16666.1|1046368_1047634_+|capsid	phage major capsid protein	capsid	Q6J1Y2	Lactobacillus_phage	44.3	2.9e-79
AZR15444.1|1047645_1047957_+	DNA packaging-like protein	NA	NA	NA	NA	NA
AZR15445.1|1047943_1048336_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15446.1|1048328_1048730_+	hypothetical protein	NA	A0A2P0ZLE6	Lactobacillus_phage	52.3	3.7e-28
AZR15447.1|1048732_1049143_+	DUF806 domain-containing protein	NA	A0A0M7RE53	Lactobacillus_phage	34.6	2.4e-14
AZR15448.1|1049144_1049885_+|tail	phage tail protein	tail	NA	NA	NA	NA
AZR15449.1|1049976_1050378_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15450.1|1050434_1050614_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15451.1|1050631_1057393_+|tail	phage tail protein	tail	A0A0A7DMV4	Lactobacillus_phage	29.3	2.6e-01
AZR16667.1|1057382_1058153_+|tail	phage tail protein	tail	NA	NA	NA	NA
AZR15452.1|1058134_1061878_+	hypothetical protein	NA	B8R659	Lactobacillus_phage	23.7	3.7e-29
AZR15453.1|1061888_1062119_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15454.1|1062072_1063713_+	DUF2479 domain-containing protein	NA	Q9T1E3	Lactobacillus_phage	33.1	1.6e-16
AZR15455.1|1063730_1064105_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15456.1|1064154_1064796_+	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	30.8	1.9e-18
AZR15457.1|1064785_1065061_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16668.1|1065066_1065711_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15458.1|1065710_1065872_+	XkdX family protein	NA	NA	NA	NA	NA
AZR15459.1|1065807_1066254_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15460.1|1066265_1066517_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15461.1|1066506_1066959_+|holin	phage holin	holin	NA	NA	NA	NA
AZR15462.1|1066948_1067851_+	lysin	NA	Q38359	Lactococcus_phage	52.8	8.4e-81
AZR15463.1|1068086_1068962_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.2	3.0e-51
AZR15464.1|1069050_1070250_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	41.5	1.8e-38
AZR15465.1|1070286_1070952_-	hemolysin III	NA	NA	NA	NA	NA
1070530:1070547	attL	TTTACCACGATTGAAGAT	NA	NA	NA	NA
AZR15466.1|1071065_1071917_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.3	7.3e-18
AZR15467.1|1071919_1072150_+	YozE family protein	NA	NA	NA	NA	NA
AZR15468.1|1072198_1072624_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AZR16669.1|1072789_1073146_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15469.1|1073811_1074651_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
AZR15470.1|1074647_1075400_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	39.9	6.7e-23
AZR15471.1|1075461_1076310_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AZR15472.1|1076379_1078491_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.7	1.9e-99
AZR15473.1|1078513_1079830_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
AZR15474.1|1079829_1080738_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	36.2	6.4e-20
AZR15475.1|1080746_1081271_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AZR15476.1|1081282_1082680_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	26.7	3.0e-29
AZR15477.1|1082918_1084148_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.5	3.1e-78
AZR15478.1|1084508_1085405_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
AZR15479.1|1086435_1087128_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15480.1|1087224_1088040_-|integrase	integrase	integrase	NA	NA	NA	NA
AZR15481.1|1088698_1089076_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
AZR15482.1|1089086_1089317_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15483.1|1089244_1090087_+	amino acid permease	NA	NA	NA	NA	NA
AZR15484.1|1090188_1091595_-	dipeptidase PepV	NA	NA	NA	NA	NA
AZR15485.1|1091781_1092288_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15486.1|1092335_1093808_-	APC family permease	NA	NA	NA	NA	NA
AZR15487.1|1094040_1096128_+	ornithine decarboxylase	NA	NA	NA	NA	NA
AZR15488.1|1096138_1097398_+	aluminum resistance protein	NA	NA	NA	NA	NA
AZR15489.1|1097517_1099287_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.6	2.2e-77
AZR15490.1|1099318_1100176_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZR15491.1|1100372_1101722_+|transposase	transposase	transposase	NA	NA	NA	NA
AZR15492.1|1101895_1102348_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR15493.1|1102758_1105272_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.1	1.9e-138
AZR15494.1|1105422_1106412_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
1105851:1105868	attR	TTTACCACGATTGAAGAT	NA	NA	NA	NA
AZR15495.1|1106408_1106636_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15496.1|1106667_1107300_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AZR15497.1|1107485_1108535_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.2	6.8e-50
>prophage 10
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	1160041	1169978	2351263	transposase	Lactobacillus_phage(33.33%)	7	NA	NA
AZR15537.1|1160041_1161919_+	DNA mismatch repair protein MutS	NA	F2QAG1	Chrysochromulina_ericina_virus	26.3	5.4e-21
AZR15538.1|1161972_1163040_-	tyrosine recombinase XerS	NA	A0A0E3T6W0	Gordonia_phage	31.9	5.2e-05
AZR15539.1|1163542_1164001_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15540.1|1164045_1164657_-	DUF5052 domain-containing protein	NA	A0A2K9VCV0	Lactobacillus_phage	43.6	3.0e-37
AZR15541.1|1164806_1165964_-	lysin	NA	Q38317	Lactobacillus_phage	52.4	6.8e-59
AZR15542.1|1166310_1167489_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
AZR15543.1|1168799_1169978_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
>prophage 11
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	1229956	1324291	2351263	tRNA,transposase,terminase,tail,head	Corynebacterium_phage(20.69%)	92	NA	NA
AZR15593.1|1229956_1232020_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AZR15594.1|1232012_1232930_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AZR15595.1|1233189_1233945_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AZR15596.1|1234314_1235217_-	GTPase Era	NA	NA	NA	NA	NA
AZR15597.1|1235216_1235741_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
AZR15598.1|1235743_1236703_-	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	46.1	1.7e-47
AZR15599.1|1236728_1237172_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	32.9	1.9e-14
AZR15600.1|1237332_1237509_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AZR15601.1|1237736_1238573_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AZR15602.1|1239191_1239440_-	type II-A CRISPR-associated protein Csn2	NA	NA	NA	NA	NA
AZR15603.1|1239502_1240681_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.5	3.0e-38
AZR15604.1|1240802_1241237_-	type II-A CRISPR-associated protein Csn2	NA	NA	NA	NA	NA
AZR15605.1|1241233_1241539_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
AZR16676.1|1241516_1242425_-	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
AZR15606.1|1242628_1243672_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15607.1|1243625_1244246_-	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
AZR15608.1|1244389_1246081_+|transposase	IS5/IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	38.3	1.9e-89
AZR15609.1|1246018_1248592_-	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
AZR15610.1|1248750_1249929_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.6	7.4e-37
AZR15611.1|1250271_1250895_+	M23 family peptidase	NA	NA	NA	NA	NA
AZR15612.1|1250965_1251532_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AZR15613.1|1252879_1253758_-	YitT family protein	NA	NA	NA	NA	NA
AZR15614.1|1253928_1254576_+	temperature-sensitive replication protein	NA	NA	NA	NA	NA
AZR15615.1|1254601_1255465_-	homoserine kinase	NA	NA	NA	NA	NA
AZR15616.1|1255478_1256714_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
AZR15617.1|1256825_1258316_+	threonine synthase	NA	NA	NA	NA	NA
AZR15618.1|1258335_1259703_+	aspartate kinase	NA	NA	NA	NA	NA
AZR15619.1|1259793_1260354_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AZR15620.1|1260507_1261686_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.4	1.1e-37
AZR15621.1|1261901_1264217_+	phospholipase	NA	NA	NA	NA	NA
AZR15622.1|1264274_1264646_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AZR15623.1|1264646_1265213_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15624.1|1265290_1265530_+	galactose-6-phosphate isomerase	NA	NA	NA	NA	NA
AZR15625.1|1265918_1266299_+	acetyltransferase	NA	NA	NA	NA	NA
AZR15626.1|1266337_1267516_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
AZR15627.1|1267963_1269505_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	24.4	2.0e-13
AZR15628.1|1269661_1270840_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	1.6e-39
AZR16677.1|1271115_1272156_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15629.1|1272547_1273726_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AZR15630.1|1274105_1274768_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AZR15631.1|1274863_1275412_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15632.1|1275501_1276119_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR15633.1|1276285_1277452_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZR15634.1|1277567_1278104_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
AZR15635.1|1278117_1279020_-	peptide transporter	NA	NA	NA	NA	NA
AZR15636.1|1278980_1279412_-	peptide transporter	NA	NA	NA	NA	NA
AZR15637.1|1279422_1280652_-	arginine deiminase	NA	NA	NA	NA	NA
AZR15638.1|1280725_1281574_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR15639.1|1281702_1283976_+	proton-efflux P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.3	7.6e-46
AZR15640.1|1284043_1284358_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15641.1|1284504_1285683_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	1.1e-37
AZR15642.1|1285824_1286196_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15643.1|1286177_1286369_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15644.1|1286601_1287696_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
AZR15645.1|1287959_1289186_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.4	5.6e-96
AZR15646.1|1289421_1289949_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	39.3	5.5e-24
AZR15647.1|1290053_1292327_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.6	4.3e-73
AZR15648.1|1292450_1293137_-	class A sortase	NA	NA	NA	NA	NA
AZR15649.1|1293612_1293969_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A9D9Y1	Lactobacillus_prophage	43.2	4.2e-20
AZR15650.1|1294002_1294284_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AZR15651.1|1295722_1296121_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15652.1|1296120_1296351_-	hypothetical protein	NA	L0P6E4	Lactobacillus_phage	61.8	1.3e-17
AZR15653.1|1296334_1296556_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15654.1|1296566_1296956_-	hypothetical protein	NA	B8R662	Lactobacillus_phage	28.8	3.7e-09
AZR15655.1|1296924_1297107_-	XkdX family protein	NA	NA	NA	NA	NA
AZR15656.1|1297125_1297743_-	hypothetical protein	NA	L0P6H5	Lactobacillus_phage	38.9	1.4e-23
AZR15657.1|1297831_1298254_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15658.1|1298311_1298602_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15659.1|1298964_1299309_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15660.1|1299776_1301489_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15661.1|1302243_1303428_-	hypothetical protein	NA	E5DV64	Deep-sea_thermophilic_phage	32.7	6.5e-49
AZR15662.1|1303414_1303801_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
AZR15663.1|1303793_1304273_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15664.1|1304285_1305353_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15665.1|1305349_1305760_-	hypothetical protein	NA	D6PSZ5	Lactobacillus_phage	36.7	5.2e-14
AZR15666.1|1305771_1306806_-	hypothetical protein	NA	A8ATH7	Listeria_phage	30.7	2.1e-11
AZR15667.1|1306823_1312472_-|tail	phage tail tape measure protein	tail	Q8LTK2	Lactococcus_phage	28.0	1.3e-62
AZR15668.1|1312541_1312802_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15669.1|1312743_1313190_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15670.1|1313210_1313642_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15671.1|1313656_1314850_-	hypothetical protein	NA	A8ATH2	Listeria_phage	37.5	4.1e-51
AZR15672.1|1314849_1315410_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15673.1|1315402_1315804_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15674.1|1315800_1316448_-	hypothetical protein	NA	H9C0F1	Vibrio_phage	32.6	5.4e-05
AZR15675.1|1316447_1316849_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15676.1|1316863_1317799_-	DUF2184 domain-containing protein	NA	A8ATG6	Listeria_phage	28.8	1.0e-25
AZR15677.1|1317798_1318404_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15678.1|1318416_1319541_-	DUF2213 domain-containing protein	NA	D6PSX5	Lactobacillus_phage	39.4	1.0e-43
AZR15679.1|1319542_1319929_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15680.1|1320091_1320889_-|head	phage head morphogenesis protein	head	A9DEG6	Yersinia_phage	27.7	9.2e-15
AZR15681.1|1320881_1322285_-	hypothetical protein	NA	D6PSX2	Lactobacillus_phage	32.9	1.2e-49
AZR15682.1|1323745_1324291_-|terminase	terminase small subunit	terminase	D7RWC4	Brochothrix_phage	49.2	3.1e-22
>prophage 12
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	1328358	1406052	2351263	tRNA,transposase,protease,head,integrase	Lactobacillus_phage(28.57%)	81	1321780:1321794	1344456:1344470
1321780:1321794	attL	ATCTTCAATTTTGAC	NA	NA	NA	NA
AZR15687.1|1328358_1328883_-	ArpU family transcriptional regulator	NA	U3PIU0	Lactobacillus_phage	37.2	2.7e-15
AZR15688.1|1328901_1329387_-	RusA family crossover junction endodeoxyribonuclease	NA	X2CXX1	Lactobacillus_phage	51.0	1.9e-31
AZR15689.1|1329383_1329797_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15690.1|1329805_1330090_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15691.1|1330076_1330478_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15692.1|1330686_1330923_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15693.1|1330909_1331245_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15694.1|1331248_1332055_-	ATP-binding protein	NA	L0P6I8	Lactobacillus_phage	36.7	1.6e-43
AZR15695.1|1332057_1332861_-	replication protein	NA	L0P704	Lactobacillus_phage	51.5	5.3e-26
AZR15696.1|1332863_1333640_-	DUF1071 domain-containing protein	NA	X2CXM9	Lactobacillus_phage	48.8	3.9e-42
AZR15697.1|1333632_1333890_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15698.1|1334412_1334628_-	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.9	8.0e-06
AZR15699.1|1334633_1334882_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15700.1|1335161_1335458_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15701.1|1335515_1335731_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15702.1|1335861_1336611_-	phage antirepressor Ant	NA	X2CXX0	Lactobacillus_phage	69.9	3.4e-96
AZR15703.1|1336666_1336942_+	hypothetical protein	NA	A0A1W6JPU7	Staphylococcus_phage	37.1	3.9e-05
AZR15704.1|1336947_1337190_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15705.1|1337249_1337600_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15706.1|1337760_1337967_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15707.1|1338000_1338804_-	phage repressor protein/antirepressor Ant	NA	L0P8P6	Lactobacillus_phage	59.5	2.3e-82
AZR15708.1|1338816_1339050_-	XRE family transcriptional regulator	NA	A9D9J9	Lactobacillus_prophage	38.4	7.8e-07
AZR15709.1|1339215_1339587_+	XRE family transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	36.5	1.2e-14
AZR15710.1|1339591_1340023_+	hypothetical protein	NA	F8J1D9	Lactobacillus_phage	34.5	2.3e-12
AZR15711.1|1340039_1340360_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15712.1|1340398_1340665_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15713.1|1340935_1341265_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15714.1|1341333_1341672_-|head	head protein	head	Q6SED4	Lactobacillus_prophage	47.3	3.6e-21
AZR15715.1|1341993_1343193_+|integrase	site-specific integrase	integrase	Q6SEG4	Lactobacillus_prophage	35.0	2.3e-62
AZR15716.1|1343285_1345124_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	8.9e-21
1344456:1344470	attR	ATCTTCAATTTTGAC	NA	NA	NA	NA
AZR15717.1|1345340_1346492_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	25.4	4.9e-25
AZR15718.1|1346574_1348428_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.8	3.3e-140
AZR15719.1|1348444_1349029_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AZR15720.1|1349041_1350091_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AZR16679.1|1350227_1351163_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AZR15721.1|1351183_1352077_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AZR15722.1|1352132_1352498_-	ribosome-binding factor A	NA	NA	NA	NA	NA
AZR15723.1|1352517_1355121_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.9	1.5e-21
AZR15724.1|1355125_1355437_-	50S ribosomal protein L7	NA	NA	NA	NA	NA
AZR15725.1|1355439_1355736_-	DUF448 domain-containing protein	NA	NA	NA	NA	NA
AZR16680.1|1355744_1356938_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AZR15726.1|1356957_1357434_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AZR15727.1|1357544_1361855_-	PolC-type DNA polymerase III	NA	Q8W6C3	Saccharomonospora_phage	22.1	3.3e-26
AZR15728.1|1361860_1363558_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AZR15729.1|1363585_1364842_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AZR15730.1|1364854_1365670_-	CDP-archaeol synthase	NA	A0A2K9L268	Tupanvirus	29.9	2.3e-05
AZR15731.1|1365672_1366407_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	39.0	2.5e-22
AZR15732.1|1366409_1366967_-	ribosome recycling factor	NA	NA	NA	NA	NA
AZR15733.1|1366966_1367692_-	UMP kinase	NA	NA	NA	NA	NA
AZR15734.1|1367836_1368862_-	elongation factor Ts	NA	NA	NA	NA	NA
AZR15735.1|1368895_1369669_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AZR15736.1|1369833_1370865_-	methyltransferase	NA	NA	NA	NA	NA
AZR15737.1|1370938_1371553_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZR15738.1|1371665_1372844_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZR15739.1|1372903_1374847_-	M13 family peptidase	NA	NA	NA	NA	NA
AZR16681.1|1374941_1376627_-	multidrug ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.4	3.6e-24
AZR15740.1|1376733_1378500_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	1.0e-45
AZR15741.1|1378578_1378797_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15742.1|1378863_1379130_-	DUF896 family protein	NA	NA	NA	NA	NA
AZR15743.1|1379286_1379913_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	50.7	6.8e-13
AZR15744.1|1379951_1380731_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
AZR15745.1|1380723_1381383_-	uracil-DNA glycosylase	NA	NA	NA	NA	NA
AZR15746.1|1381732_1382857_-	cell surface protein	NA	NA	NA	NA	NA
AZR15747.1|1382969_1383317_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZR15748.1|1383509_1384916_-|transposase	ISLre2-like element ISLcr2 family transposase	transposase	NA	NA	NA	NA
AZR15749.1|1385041_1385758_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AZR15750.1|1385747_1386263_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AZR15751.1|1386329_1386602_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AZR15752.1|1386689_1388120_-	signal recognition particle protein	NA	D6PHS7	uncultured_phage	27.0	8.3e-06
AZR15753.1|1388123_1388465_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR15754.1|1388638_1390069_+	amino acid permease	NA	NA	NA	NA	NA
AZR15755.1|1390125_1391952_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR15756.1|1391966_1392713_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.8	4.6e-32
AZR15757.1|1392844_1393093_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR15758.1|1393265_1394687_-	dipeptidase	NA	NA	NA	NA	NA
AZR15759.1|1394731_1396030_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
AZR15760.1|1396030_1399600_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AZR15761.1|1399612_1400302_-	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	31.7	2.7e-18
AZR15762.1|1400408_1402178_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR15763.1|1402409_1403588_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.4	1.1e-37
AZR15764.1|1404702_1406052_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	1409888	1470347	2351263	protease,transposase	unidentified_phage(27.27%)	53	NA	NA
AZR15767.1|1409888_1411238_-|transposase	transposase	transposase	NA	NA	NA	NA
AZR15768.1|1411566_1413015_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15769.1|1413081_1415010_-	plasma-membrane proton-efflux P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	25.1	5.9e-31
AZR15770.1|1415856_1416891_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	3.7e-40
AZR15771.1|1417207_1418557_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AZR15772.1|1418788_1419238_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZR15773.1|1420912_1421509_-	HAD family phosphatase	NA	NA	NA	NA	NA
AZR15774.1|1421679_1421916_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15775.1|1421798_1422839_-	FAD-binding protein	NA	NA	NA	NA	NA
AZR15776.1|1423109_1423577_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
AZR15777.1|1423703_1424735_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AZR15778.1|1425130_1426108_+	linear amide C-N hydrolase	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	30.7	8.1e-21
AZR15779.1|1426233_1427268_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.9	7.5e-41
AZR15780.1|1427388_1427964_+	PAP2 family protein	NA	NA	NA	NA	NA
AZR15781.1|1428003_1428837_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	38.0	8.1e-46
AZR15782.1|1429051_1430338_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	52.4	1.6e-109
AZR15783.1|1430417_1430951_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
AZR15784.1|1431021_1432056_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.9	7.5e-41
AZR15785.1|1432332_1432821_-	nitroreductase	NA	NA	NA	NA	NA
AZR15786.1|1432943_1433801_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZR15787.1|1433837_1435448_+	beta-carotene 15,15'-monooxygenase	NA	NA	NA	NA	NA
AZR15788.1|1435490_1436534_-	penicillin-binding protein	NA	NA	NA	NA	NA
AZR15789.1|1436696_1437755_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZR15790.1|1437754_1438930_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
AZR15791.1|1438941_1439721_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AZR15792.1|1439727_1440654_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AZR15793.1|1440655_1441810_-	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
AZR15794.1|1441811_1442519_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
AZR15795.1|1442533_1443844_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
AZR15796.1|1444302_1445658_+	aspartate kinase	NA	NA	NA	NA	NA
AZR15797.1|1445666_1446671_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
AZR15798.1|1448338_1448929_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AZR15799.1|1448918_1450184_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	1.6e-130
AZR15800.1|1450312_1451644_-	trigger factor	NA	NA	NA	NA	NA
AZR15801.1|1451790_1452981_-	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	26.4	1.2e-31
AZR15802.1|1453170_1454004_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15803.1|1454006_1455791_-	RNase J family beta-CASP ribonuclease	NA	NA	NA	NA	NA
AZR15804.1|1455948_1456218_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
AZR15805.1|1456419_1456677_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AZR15806.1|1456740_1457727_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AZR15807.1|1457723_1460012_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
AZR15808.1|1459980_1460670_-	competence protein	NA	NA	NA	NA	NA
AZR15809.1|1460744_1461788_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
AZR15810.1|1461780_1462266_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	33.8	3.6e-22
AZR15811.1|1462268_1462817_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AZR15812.1|1462813_1463158_-	DUF2129 domain-containing protein	NA	NA	NA	NA	NA
AZR15813.1|1463154_1464339_-	cell division protein FtsW	NA	NA	NA	NA	NA
AZR15814.1|1464438_1466283_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	42.0	8.1e-22
AZR15815.1|1466535_1467090_+	peptide deformylase	NA	NA	NA	NA	NA
AZR15816.1|1467090_1467297_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15817.1|1467420_1467642_+	hypothetical protein	NA	NA	NA	NA	NA
AZR15818.1|1467648_1469328_+	ribonuclease J	NA	NA	NA	NA	NA
AZR15819.1|1469489_1470347_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 14
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	1577252	1631440	2351263	head,terminase,tail,transposase	Lactobacillus_phage(50.0%)	59	NA	NA
AZR15930.1|1577252_1578431_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.5	5.2e-38
AZR15931.1|1578590_1579385_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15932.1|1580154_1581243_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
AZR15933.1|1581348_1582965_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15934.1|1583065_1583425_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15935.1|1583439_1583667_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15936.1|1583687_1584020_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15937.1|1584366_1585236_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15938.1|1585247_1585496_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15939.1|1585498_1585873_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AZR15940.1|1585888_1587067_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
AZR15941.1|1587281_1587923_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15942.1|1587924_1588503_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15943.1|1589985_1591995_-	ATPase	NA	NA	NA	NA	NA
AZR15944.1|1592005_1592629_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15945.1|1592606_1592933_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15946.1|1592936_1595651_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16683.1|1595695_1597474_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AZR15947.1|1597927_1598137_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15948.1|1598136_1598358_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15949.1|1599016_1600138_-	lysin	NA	Q71JA9	Lactobacillus_phage	86.1	4.1e-186
AZR15950.1|1600197_1600596_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15951.1|1600595_1600853_-	hypothetical protein	NA	L0P6E4	Lactobacillus_phage	65.2	2.1e-16
AZR15952.1|1600836_1601046_-	hypothetical protein	NA	L0P8N8	Lactobacillus_phage	72.5	2.8e-11
AZR15953.1|1601063_1601465_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15954.1|1601427_1601607_-	hypothetical protein	NA	L0P7C5	Lactobacillus_phage	60.0	6.4e-09
AZR15955.1|1601609_1602206_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15956.1|1602300_1602684_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15957.1|1602741_1603032_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15958.1|1603028_1603415_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15959.1|1603408_1603831_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15960.1|1603849_1606024_-	hypothetical protein	NA	L0P6E1	Lactobacillus_phage	60.4	1.7e-39
AZR15961.1|1606040_1607129_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15962.1|1607157_1608006_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15963.1|1607995_1609177_-	hypothetical protein	NA	A8ATI2	Listeria_phage	34.2	6.1e-55
AZR16684.1|1609173_1609518_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
AZR15964.1|1609528_1610002_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15965.1|1610014_1611142_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15966.1|1611141_1611552_-	hypothetical protein	NA	D6PSZ5	Lactobacillus_phage	33.3	6.4e-12
AZR15967.1|1611564_1612518_-	LysM domain-containing protein	NA	NA	NA	NA	NA
AZR15968.1|1612535_1618013_-|tail	phage tail tape measure protein	tail	Q9AZS0	Lactococcus_phage	31.9	1.1e-37
AZR15969.1|1618058_1618304_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15970.1|1618275_1618722_-	autotransporter	NA	NA	NA	NA	NA
AZR15971.1|1618780_1619212_-	hypothetical protein	NA	A8ATH3	Listeria_phage	29.8	1.7e-10
AZR15972.1|1619226_1620561_-	DUF3383 domain-containing protein	NA	A8ATH2	Listeria_phage	37.6	3.3e-49
AZR15973.1|1620564_1621110_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15974.1|1621087_1621507_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15975.1|1621516_1622188_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15976.1|1622184_1622571_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15977.1|1622587_1623547_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15978.1|1623561_1624098_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15979.1|1624097_1625309_-	hypothetical protein	NA	D6PSX5	Lactobacillus_phage	32.3	1.8e-33
AZR15980.1|1625305_1625662_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
AZR15981.1|1625672_1626476_-|head	phage head morphogenesis protein	head	L7TMD0	Rhizobium_phage	30.7	9.9e-17
AZR15982.1|1626462_1627848_-	DUF1073 domain-containing protein	NA	D6PSX2	Lactobacillus_phage	32.7	2.0e-49
AZR15983.1|1627860_1629333_-|terminase	terminase	terminase	A5GYP8	Lactococcus_phage	49.5	4.1e-125
AZR15984.1|1629329_1629902_-|terminase	terminase small subunit	terminase	A0A182BQ99	Lactococcus_phage	33.1	5.2e-12
AZR15985.1|1629948_1630167_-	hypothetical protein	NA	NA	NA	NA	NA
AZR15986.1|1630936_1631440_-	ArpU family transcriptional regulator	NA	B8R690	Lactobacillus_phage	38.2	2.3e-11
>prophage 15
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	1641084	1645978	2351263	integrase	Lactobacillus_phage(66.67%)	8	1640257:1640269	1647895:1647907
1640257:1640269	attL	GCTTTCGCAAATT	NA	NA	NA	NA
AZR16002.1|1641084_1641303_-	hypothetical protein	NA	Q9T1J1	Lactobacillus_phage	43.9	1.2e-06
AZR16003.1|1641315_1642059_-	phage antirepressor Ant	NA	A9D9L9	Lactobacillus_prophage	70.2	2.1e-93
AZR16004.1|1642094_1642304_-	transcriptional regulator	NA	A9D9J9	Lactobacillus_prophage	48.5	2.8e-11
AZR16005.1|1642480_1642864_+	XRE family transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	50.0	7.6e-15
AZR16006.1|1642853_1643309_+	hypothetical protein	NA	E9LUL3	Lactobacillus_phage	39.0	9.3e-12
AZR16007.1|1643371_1644223_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16008.1|1644401_1644743_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16009.1|1644829_1645978_+|integrase	site-specific integrase	integrase	U3PCM7	Lactobacillus_phage	35.7	1.4e-59
1647895:1647907	attR	GCTTTCGCAAATT	NA	NA	NA	NA
>prophage 16
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	1666576	1734798	2351263	tRNA,transposase,integrase	Streptococcus_phage(23.53%)	66	1665009:1665025	1685838:1685854
1665009:1665025	attL	TAATTTTTTCTTTTCAA	NA	NA	NA	NA
AZR16032.1|1666576_1667689_+|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	45.3	1.8e-80
AZR16033.1|1668180_1669365_-	acetate kinase	NA	NA	NA	NA	NA
AZR16034.1|1669409_1670411_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZR16035.1|1670605_1671133_-	competence protein ComGF	NA	NA	NA	NA	NA
AZR16036.1|1671086_1671356_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16037.1|1671352_1671778_-	prepilin-type cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AZR16038.1|1671752_1672094_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AZR16039.1|1672154_1673156_-	type II secretion system protein F	NA	NA	NA	NA	NA
AZR16040.1|1673124_1674099_-	competence protein	NA	NA	NA	NA	NA
AZR16041.1|1674298_1675027_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZR16042.1|1675111_1675633_-	VanZ family protein	NA	NA	NA	NA	NA
AZR16043.1|1675703_1676345_-	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AZR16044.1|1676357_1676543_-	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
AZR16045.1|1676824_1677757_-|integrase	integrase	integrase	A0A0C5AEA5	Paenibacillus_phage	43.0	1.0e-41
AZR16687.1|1677831_1678572_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	41.0	1.5e-35
AZR16046.1|1678779_1680405_+	APC family permease	NA	NA	NA	NA	NA
AZR16047.1|1680586_1681336_+	Firmicu-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
AZR16048.1|1681322_1682852_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16049.1|1682854_1683961_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	27.6	2.9e-06
AZR16050.1|1683980_1684568_+	exosortase family protein XrtG	NA	NA	NA	NA	NA
AZR16051.1|1684580_1685864_+	putative glycosyltransferase, exosortase G system-associated	NA	NA	NA	NA	NA
1685838:1685854	attR	TTGAAAAGAAAAAATTA	NA	NA	NA	NA
AZR16052.1|1685853_1686222_+	6-pyruvoyl tetrahydropterin synthase	NA	NA	NA	NA	NA
AZR16053.1|1686620_1687799_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
AZR16054.1|1688373_1689321_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZR16055.1|1689449_1690925_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AZR16056.1|1690966_1692988_-	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
AZR16057.1|1693115_1693949_-	PRD domain-containing protein	NA	NA	NA	NA	NA
AZR16058.1|1694158_1695304_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.6	1.7e-41
AZR16059.1|1695328_1695784_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AZR16060.1|1695783_1696500_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16061.1|1696514_1696955_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
AZR16688.1|1696985_1697801_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AZR16062.1|1697901_1699254_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AZR16063.1|1699276_1700236_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16064.1|1700232_1701075_-	TIGR00159 family protein	NA	NA	NA	NA	NA
AZR16065.1|1701113_1702187_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR16066.1|1702183_1702999_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR16067.1|1702995_1703808_-	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	29.6	3.6e-14
AZR16689.1|1703797_1704895_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	41.1	1.4e-34
AZR16068.1|1704961_1705858_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
AZR16069.1|1705953_1706487_+	exonuclease	NA	M1PFD8	Streptococcus_phage	35.3	1.7e-20
AZR16070.1|1706524_1707004_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AZR16071.1|1707003_1707993_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AZR16072.1|1708003_1708702_-	uracil-DNA glycosylase	NA	A0A0Y0A6W9	Macropodid_alphaherpesvirus	40.1	7.3e-40
AZR16073.1|1708769_1709645_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AZR16074.1|1709664_1710180_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16075.1|1710532_1711582_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.9	3.2e-47
AZR16076.1|1711866_1712625_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
AZR16077.1|1712649_1713861_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AZR16078.1|1713975_1714992_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZR16079.1|1715044_1716076_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16080.1|1716490_1718023_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16081.1|1718191_1719625_+	amino acid permease	NA	NA	NA	NA	NA
AZR16082.1|1719691_1720477_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16083.1|1720560_1720998_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AZR16084.1|1721158_1722631_+	MFS transporter	NA	NA	NA	NA	NA
AZR16085.1|1723036_1723894_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZR16086.1|1724411_1725170_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AZR16087.1|1725166_1725805_-	spermidine/putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	2.5e-18
AZR16088.1|1725913_1727542_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16089.1|1727736_1728321_+	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.4	1.1e-52
AZR16090.1|1728385_1729321_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	34.9	1.4e-46
AZR16091.1|1729313_1730357_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	49.2	2.6e-86
AZR16092.1|1730367_1731249_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.3	2.4e-08
AZR16093.1|1731342_1731885_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16690.1|1731957_1734798_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	7.0e-307
>prophage 17
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	1762074	1875213	2351263	protease,tRNA,bacteriocin,transposase	Corynebacterium_phage(16.0%)	98	NA	NA
AZR16116.1|1762074_1762635_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AZR16117.1|1762697_1763885_-	AI-2E family transporter	NA	NA	NA	NA	NA
AZR16118.1|1763901_1764282_-	PTS sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
AZR16119.1|1764461_1765490_+	lactonase family protein	NA	NA	NA	NA	NA
AZR16120.1|1765601_1766294_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
AZR16121.1|1766328_1768104_-	oleate hydratase	NA	NA	NA	NA	NA
AZR16122.1|1768209_1769115_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.0	4.0e-06
AZR16123.1|1769107_1769911_-	NAD kinase	NA	NA	NA	NA	NA
AZR16124.1|1769907_1770540_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AZR16125.1|1770616_1771225_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
AZR16126.1|1771311_1771929_+	DsbA family protein	NA	NA	NA	NA	NA
AZR16127.1|1771936_1772785_-	competence protein	NA	NA	NA	NA	NA
AZR16128.1|1772856_1773603_-	adaptor protein MecA	NA	NA	NA	NA	NA
AZR16129.1|1773707_1774106_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
AZR16130.1|1774329_1776063_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AZR16131.1|1776062_1776329_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AZR16132.1|1776441_1776636_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16133.1|1776739_1777918_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
AZR16134.1|1778424_1779663_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.2	5.0e-84
AZR16135.1|1779968_1782161_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.9	3.0e-124
AZR16136.1|1782306_1782588_+	DUF1827 domain-containing protein	NA	NA	NA	NA	NA
AZR16137.1|1782651_1784223_-	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	28.3	1.7e-12
AZR16138.1|1784222_1785089_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AZR16139.1|1785191_1785653_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16140.1|1785653_1786136_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16141.1|1786144_1786957_-	recombination regulator RecX	NA	NA	NA	NA	NA
AZR16142.1|1787081_1788470_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	D0R096	Streptococcus_phage	31.7	8.7e-61
AZR16143.1|1789922_1790207_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16144.1|1790345_1792118_+|transposase	IS5/IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	38.1	7.4e-89
AZR16145.1|1792037_1794401_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
AZR16146.1|1794397_1795561_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
AZR16147.1|1795678_1796581_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	49.2	1.1e-75
AZR16148.1|1796641_1797565_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
AZR16149.1|1797573_1798401_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AZR16150.1|1798613_1799060_+	flavodoxin	NA	NA	NA	NA	NA
AZR16151.1|1799052_1799580_+	GtrA family protein	NA	NA	NA	NA	NA
AZR16152.1|1799704_1801075_-|transposase	IS4/IS5 family transposase	transposase	NA	NA	NA	NA
AZR16153.1|1801272_1802415_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	29.9	1.2e-26
AZR16154.1|1802520_1802709_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16155.1|1802901_1804230_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AZR16156.1|1804226_1805462_-	ATP-dependent helicase	NA	A0A1V0SBR7	Catovirus	28.7	3.9e-28
AZR16157.1|1806363_1807542_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.7	8.8e-38
AZR16158.1|1807658_1808960_+	amino acid permease	NA	NA	NA	NA	NA
AZR16159.1|1809042_1810077_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	6.3e-40
AZR16160.1|1813321_1815091_-	FAD-binding dehydrogenase	NA	NA	NA	NA	NA
AZR16161.1|1815263_1815833_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	29.8	4.1e-09
AZR16162.1|1815939_1817298_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AZR16163.1|1817400_1818057_-	nitroreductase	NA	NA	NA	NA	NA
AZR16164.1|1818128_1818395_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16165.1|1818513_1818999_-	PTS glucose transporter subunit IIABC	NA	NA	NA	NA	NA
AZR16166.1|1819019_1819517_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16167.1|1819503_1820313_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AZR16168.1|1820374_1822255_-	PTS alpha-glucoside transporter subunit IICB	NA	NA	NA	NA	NA
AZR16169.1|1822865_1823672_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AZR16170.1|1823727_1824576_-	patatin family protein	NA	NA	NA	NA	NA
AZR16171.1|1824642_1827042_-	phosphoketolase family protein	NA	NA	NA	NA	NA
AZR16172.1|1827341_1828106_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AZR16173.1|1828111_1828471_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZR16174.1|1828592_1829420_+	HAD family hydrolase	NA	NA	NA	NA	NA
AZR16175.1|1829513_1830239_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZR16176.1|1830238_1831165_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AZR16177.1|1831246_1833256_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	34.5	1.6e-63
AZR16178.1|1833387_1834080_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
AZR16179.1|1834079_1835006_-	ribokinase	NA	NA	NA	NA	NA
AZR16180.1|1835095_1835899_-	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
AZR16181.1|1836062_1837367_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR16182.1|1837430_1838831_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16183.1|1838980_1839478_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16184.1|1839524_1840445_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
AZR16185.1|1840520_1841174_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZR16186.1|1841191_1841833_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZR16187.1|1841832_1842651_-	glutamine ABC transporter substrate-binding protein	NA	E3T502	Cafeteria_roenbergensis_virus	28.3	3.6e-06
AZR16188.1|1842662_1843403_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	1.2e-37
AZR16189.1|1844743_1846135_-	MFS transporter	NA	NA	NA	NA	NA
AZR16190.1|1846245_1846824_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16191.1|1847003_1848773_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	2.1e-51
AZR16192.1|1848773_1850507_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	1.4e-36
AZR16193.1|1850493_1850946_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZR16194.1|1851123_1851942_+	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR16195.1|1851983_1852652_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
AZR16196.1|1852813_1854145_+	amino acid permease	NA	NA	NA	NA	NA
AZR16197.1|1854371_1854611_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16198.1|1854576_1855692_+	APC family permease	NA	NA	NA	NA	NA
AZR16199.1|1855688_1856492_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZR16200.1|1856586_1857507_-	aldo/keto reductase	NA	NA	NA	NA	NA
AZR16201.1|1857594_1859217_-	ABC-F family ATPase	NA	A0A2K9L3Z8	Tupanvirus	25.4	2.6e-48
AZR16202.1|1859310_1860273_-	peptidase M42	NA	NA	NA	NA	NA
AZR16203.1|1860343_1861378_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	6.3e-40
AZR16204.1|1862438_1864199_+|transposase	IS5/IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	38.1	7.3e-89
AZR16205.1|1864130_1865600_-	MFS transporter	NA	NA	NA	NA	NA
AZR16206.1|1865884_1866412_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
AZR16207.1|1866421_1867753_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.7	4.7e-64
AZR16208.1|1868357_1869536_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	2.0e-37
AZR16209.1|1870411_1871269_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZR16210.1|1872009_1872282_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16211.1|1872363_1873200_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	37.5	1.9e-47
AZR16212.1|1873363_1873834_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZR16213.1|1874034_1875213_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.7	6.7e-38
>prophage 18
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	1946679	2074486	2351263	protease,tRNA,transposase	Streptococcus_phage(20.0%)	108	NA	NA
AZR16276.1|1946679_1947537_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZR16277.1|1948781_1950440_+	phosphoenolpyruvate carboxykinase (ATP)	NA	NA	NA	NA	NA
AZR16278.1|1950530_1952150_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AZR16279.1|1952538_1953393_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZR16280.1|1953538_1953952_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AZR16281.1|1954103_1954331_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16282.1|1955307_1956477_-	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AZR16283.1|1956479_1956932_-	PTS mannitol transporter subunit IIA	NA	NA	NA	NA	NA
AZR16284.1|1956947_1958729_-	PTS mannitol transporter subunit IICB	NA	NA	NA	NA	NA
AZR16285.1|1958863_1960918_-	HTH domain-containing protein	NA	NA	NA	NA	NA
AZR16286.1|1961018_1962830_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	38.4	1.6e-94
AZR16287.1|1965965_1967339_+	amino acid permease	NA	NA	NA	NA	NA
AZR16692.1|1967370_1967832_-	acetyltransferase	NA	NA	NA	NA	NA
AZR16288.1|1967997_1968879_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR16289.1|1968921_1969290_-	DUF956 domain-containing protein	NA	NA	NA	NA	NA
AZR16290.1|1969293_1970214_-	PTS mannose family transporter subunit IID	NA	NA	NA	NA	NA
AZR16291.1|1970242_1971052_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AZR16292.1|1971073_1972081_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AZR16293.1|1978056_1978764_+	transcriptional regulator	NA	A0A0C5AJ29	Paenibacillus_phage	40.2	4.8e-39
AZR16294.1|1979610_1980468_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZR16295.1|1980860_1981895_-	cell wall anchor protein	NA	NA	NA	NA	NA
AZR16693.1|1981920_1983255_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16296.1|1983505_1983850_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16297.1|1983900_1984389_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16298.1|1984537_1985845_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.1	2.4e-92
AZR16299.1|1986075_1986627_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZR16300.1|1986626_1987232_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	38.5	3.3e-33
AZR16301.1|1987389_1988184_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZR16302.1|1988739_1990110_+|transposase	IS4/IS5 family transposase	transposase	NA	NA	NA	NA
AZR16303.1|1991024_1991288_+	ATP-binding protein	NA	NA	NA	NA	NA
AZR16304.1|1991375_1991879_-	nucleoside 2-deoxyribosyltransferase	NA	K4I206	Lactobacillus_phage	29.7	8.4e-14
AZR16305.1|1992045_1993428_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZR16306.1|1993699_1994929_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.5	1.4e-78
AZR16307.1|1995163_1996180_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AZR16308.1|1996298_1996901_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZR16309.1|1997189_2000699_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16310.1|2000703_2001279_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZR16311.1|2001411_2002356_-	serine hydrolase	NA	NA	NA	NA	NA
AZR16312.1|2002371_2003289_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
AZR16313.1|2003407_2004709_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR16314.1|2004762_2006058_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZR16315.1|2006041_2006866_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AZR16316.1|2006869_2007736_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZR16317.1|2007735_2008824_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.9e-27
AZR16318.1|2009079_2010507_-	dipeptidase	NA	NA	NA	NA	NA
AZR16319.1|2010563_2011418_-	DNA nuclease	NA	NA	NA	NA	NA
AZR16320.1|2011427_2012384_-	DNA polymerase III subunit epsilon	NA	A0A0N9SJX9	Paenibacillus_phage	30.1	1.2e-08
AZR16321.1|2012399_2013221_-	Sir2 family NAD-dependent protein deacetylase	NA	NA	NA	NA	NA
AZR16322.1|2013222_2013870_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AZR16323.1|2013869_2014268_-	DUF3290 domain-containing protein	NA	NA	NA	NA	NA
AZR16324.1|2014300_2015479_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.9	7.7e-34
AZR16325.1|2015802_2016543_-	hypothetical protein	NA	A0A0A7NTY4	Lactobacillus_phage	85.8	1.5e-120
AZR16694.1|2016569_2017832_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.5	8.2e-58
AZR16326.1|2018214_2019441_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.4	5.6e-96
AZR16327.1|2019928_2020180_+	signal peptide protein	NA	NA	NA	NA	NA
AZR16328.1|2020179_2020893_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16329.1|2020867_2021800_+	choice-of-anchor A family protein	NA	NA	NA	NA	NA
AZR16330.1|2021867_2022164_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16331.1|2022207_2022942_-	oxidoreductase	NA	NA	NA	NA	NA
AZR16332.1|2023069_2023927_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZR16333.1|2024063_2025668_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.0	2.3e-17
AZR16334.1|2025789_2026707_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
AZR16335.1|2026764_2027484_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AZR16336.1|2027461_2028805_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.8	2.2e-21
AZR16337.1|2028924_2029473_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16338.1|2029497_2030115_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16339.1|2030177_2030702_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZR16340.1|2030701_2031157_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZR16341.1|2031252_2031762_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.8	7.5e-10
AZR16342.1|2031742_2032852_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AZR16343.1|2032970_2034617_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR16344.1|2034917_2035313_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
AZR16345.1|2035439_2035691_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16346.1|2035858_2037190_-|transposase	transposase	transposase	A0A286QMQ9	Streptococcus_phage	41.9	9.9e-62
AZR16347.1|2037571_2038813_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	3.4e-80
AZR16348.1|2039042_2039444_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16349.1|2039490_2040066_-	elongation factor P	NA	NA	NA	NA	NA
AZR16350.1|2040183_2041098_-	type I pantothenate kinase	NA	NA	NA	NA	NA
AZR16351.1|2041157_2041715_+	arylesterase	NA	NA	NA	NA	NA
AZR16352.1|2041711_2042161_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZR16353.1|2042162_2042978_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR16354.1|2042981_2043602_-	polar amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.1	7.6e-33
AZR16355.1|2043615_2044263_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZR16356.1|2044696_2047003_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AZR16357.1|2047155_2047848_+|protease	metalloprotease	protease	NA	NA	NA	NA
AZR16358.1|2047908_2048559_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	32.1	4.0e-08
AZR16359.1|2048702_2049737_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	1.3e-40
AZR16360.1|2049901_2051080_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.6	8.2e-36
AZR16361.1|2051258_2052530_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16362.1|2052670_2053357_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
AZR16363.1|2053536_2056188_+	cation-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	31.7	1.5e-93
AZR16364.1|2056234_2056633_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AZR16365.1|2056688_2056982_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16366.1|2057268_2058261_-	asparaginase	NA	NA	NA	NA	NA
AZR16367.1|2058272_2059046_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AZR16368.1|2059177_2060515_-	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
AZR16369.1|2061334_2062168_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
AZR16370.1|2062625_2063168_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZR16371.1|2063193_2063727_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	28.4	6.4e-12
AZR16372.1|2063965_2064529_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZR16373.1|2064545_2066693_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16374.1|2066800_2067076_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16375.1|2067151_2067553_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16376.1|2067748_2068039_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16377.1|2068321_2069500_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
AZR16378.1|2069583_2070021_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16379.1|2070088_2072563_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AZR16380.1|2073307_2074486_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	4.4e-37
>prophage 19
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	2091957	2190277	2351263	holin,bacteriocin,transposase	Corynebacterium_phage(14.29%)	104	NA	NA
AZR16397.1|2091957_2093109_-|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	43.2	9.7e-82
AZR16398.1|2093401_2093848_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
AZR16399.1|2093850_2094786_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	33.6	1.8e-46
AZR16400.1|2094825_2095356_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16401.1|2095472_2096186_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16402.1|2096382_2096868_-	threonine/serine exporter	NA	NA	NA	NA	NA
AZR16403.1|2096870_2097641_-	threonine/serine exporter	NA	NA	NA	NA	NA
AZR16404.1|2097651_2099193_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.9	1.7e-44
AZR16405.1|2099206_2099584_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16406.1|2099730_2100279_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZR16407.1|2100593_2100899_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16408.1|2100913_2101150_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16409.1|2101157_2101847_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AZR16410.1|2101913_2103149_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AZR16411.1|2103270_2104449_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
AZR16412.1|2104694_2106491_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AZR16413.1|2106642_2106858_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AZR16414.1|2106861_2107269_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
AZR16415.1|2107382_2107658_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16416.1|2107661_2107889_-	TIGR04139 family peptide modification target	NA	NA	NA	NA	NA
AZR16417.1|2108053_2108350_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZR16418.1|2108365_2108626_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AZR16419.1|2108813_2109992_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
AZR16420.1|2110217_2111075_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZR16421.1|2111659_2111866_-	transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	50.9	2.1e-08
AZR16422.1|2111862_2112348_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16423.1|2113039_2114158_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	40.2	4.4e-71
AZR16424.1|2114216_2114693_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AZR16425.1|2114778_2116293_-	L-lactate permease	NA	NA	NA	NA	NA
AZR16426.1|2116550_2117345_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AZR16427.1|2117344_2117992_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	3.6e-17
AZR16428.1|2118018_2118915_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZR16696.1|2119167_2119446_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZR16429.1|2119660_2121658_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
AZR16430.1|2121678_2122593_-	1-phosphofructokinase	NA	NA	NA	NA	NA
AZR16697.1|2122594_2123350_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AZR16431.1|2123657_2124881_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR16432.1|2124864_2125761_-	DUF4162 domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	30.5	7.5e-05
AZR16433.1|2125778_2126201_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16434.1|2126227_2126419_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16435.1|2126551_2126761_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR16436.1|2126775_2127315_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
AZR16437.1|2127319_2127502_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16438.1|2127669_2127885_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16439.1|2127954_2128305_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16440.1|2128858_2129056_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16441.1|2129056_2130361_-	cell wall anchor protein	NA	NA	NA	NA	NA
AZR16442.1|2130515_2131112_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16443.1|2131876_2132911_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	7.5e-41
AZR16444.1|2134585_2135410_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZR16445.1|2135378_2135843_-	histidine kinase	NA	NA	NA	NA	NA
AZR16446.1|2135907_2137086_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
AZR16447.1|2138074_2138206_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16448.1|2138323_2139721_-	ATP-binding protein	NA	NA	NA	NA	NA
AZR16449.1|2140035_2142342_-	DUF4968 domain-containing protein	NA	NA	NA	NA	NA
AZR16450.1|2142488_2143892_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AZR16451.1|2144099_2144285_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16452.1|2144299_2144491_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16453.1|2144566_2144791_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16454.1|2144939_2145263_-	enterocin immunity protein	NA	NA	NA	NA	NA
AZR16455.1|2145404_2146154_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
AZR16456.1|2146163_2147735_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AZR16457.1|2147787_2148942_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	33.8	1.6e-31
AZR16458.1|2148943_2149630_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.1	2.5e-37
AZR16459.1|2149805_2150138_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16698.1|2150201_2152055_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	5.2e-45
AZR16460.1|2153934_2154720_-	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
AZR16461.1|2154728_2155829_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AZR16462.1|2155882_2156146_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
AZR16463.1|2156138_2157026_-	helix-turn-helix domain-containing protein	NA	I3NLC2	Bifidobacterium_phage	31.7	1.4e-16
AZR16699.1|2157003_2157783_-	ParA family protein	NA	Q8JL10	Natrialba_phage	37.2	2.5e-25
AZR16464.1|2157801_2158638_-	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	33.9	6.1e-17
AZR16465.1|2158655_2159378_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
AZR16466.1|2160445_2160982_+	CvpA family protein	NA	NA	NA	NA	NA
AZR16467.1|2161141_2161261_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AZR16468.1|2161400_2162330_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AZR16469.1|2162332_2163124_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AZR16470.1|2163215_2163764_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	41.0	3.1e-30
AZR16471.1|2163777_2164317_-	NADPH-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	42.0	2.2e-28
AZR16472.1|2164469_2165093_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZR16473.1|2165223_2165463_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16474.1|2165607_2166642_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	4.8e-40
AZR16475.1|2166748_2168161_+	dipeptidase	NA	NA	NA	NA	NA
AZR16476.1|2168193_2168868_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	8.9e-35
AZR16477.1|2168869_2169931_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR16478.1|2169933_2170458_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZR16479.1|2170576_2171188_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AZR16480.1|2171218_2171974_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZR16481.1|2171970_2172732_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
AZR16482.1|2172924_2174166_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	3.4e-80
AZR16483.1|2175273_2176071_-	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
AZR16484.1|2176227_2177430_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16485.1|2177522_2177714_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16486.1|2177740_2178496_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16487.1|2178495_2178948_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AZR16700.1|2179089_2179368_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16488.1|2179428_2180922_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	36.6	7.9e-76
AZR16489.1|2181036_2183574_-	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.4	1.3e-67
AZR16490.1|2183787_2184150_+	aggregation promoting factor surface protein	NA	A0A0E3XCL7	Enterococcus_phage	67.1	1.5e-20
AZR16491.1|2184221_2185205_-	cytochrome C5	NA	NA	NA	NA	NA
AZR16492.1|2186772_2187807_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	7.5e-41
AZR16701.1|2187876_2188380_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	53.9	2.8e-41
AZR16493.1|2188552_2188882_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16494.1|2189098_2190277_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.8	3.3e-37
>prophage 20
CP026503	Lactobacillus crispatus strain AB70 chromosome, complete genome	2351263	2246426	2309669	2351263	transposase,protease	Planktothrix_phage(11.11%)	56	NA	NA
AZR16549.1|2246426_2248328_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	38.8	1.6e-105
AZR16550.1|2248658_2249549_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZR16551.1|2249529_2250837_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AZR16703.1|2250931_2251633_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	7.8e-34
AZR16552.1|2251633_2254183_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR16553.1|2254229_2254466_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16554.1|2254568_2256185_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZR16555.1|2256474_2257425_+	lysin	NA	Q6SE63	Lactobacillus_prophage	56.2	5.4e-62
AZR16556.1|2257496_2258213_-	DUF975 domain-containing protein	NA	NA	NA	NA	NA
AZR16557.1|2258528_2259470_-	penicillin-binding protein	NA	NA	NA	NA	NA
AZR16558.1|2259469_2260756_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
AZR16559.1|2260748_2260988_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
AZR16560.1|2261024_2262263_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.4	4.0e-25
AZR16561.1|2262262_2263777_-	D-alanine--poly(phosphoribitol) ligase subunit 1	NA	A0A2K9KZV5	Tupanvirus	28.3	4.0e-35
AZR16562.1|2263792_2263945_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
AZR16563.1|2264093_2264390_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16564.1|2264408_2265545_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16565.1|2265948_2266152_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16566.1|2266132_2266603_+	CBS domain-containing protein	NA	NA	NA	NA	NA
AZR16567.1|2266731_2268594_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.2	3.4e-68
AZR16568.1|2268717_2268834_-	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
AZR16569.1|2268828_2269998_+	cation:proton antiporter	NA	NA	NA	NA	NA
AZR16570.1|2270105_2270414_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AZR16571.1|2270400_2270670_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AZR16572.1|2270813_2272526_+|transposase	IS5/IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	38.1	7.1e-89
AZR16573.1|2272508_2274077_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	5.3e-14
AZR16574.1|2274172_2275033_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZR16575.1|2275110_2275467_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16576.1|2275693_2276962_-	MFS transporter	NA	NA	NA	NA	NA
AZR16577.1|2277068_2277938_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZR16578.1|2277966_2278620_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZR16579.1|2278711_2279815_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16580.1|2279829_2282169_+	sulfate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	4.2e-31
AZR16581.1|2282275_2285014_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AZR16582.1|2285105_2285711_-	ECF transporter S component	NA	NA	NA	NA	NA
AZR16583.1|2286016_2287111_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	46.7	4.1e-82
AZR16584.1|2287251_2288232_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	46.6	7.7e-72
AZR16585.1|2288418_2289957_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	1.6e-18
AZR16704.1|2289949_2291098_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR16586.1|2291097_2292054_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR16587.1|2292159_2292987_-	aldo/keto reductase	NA	NA	NA	NA	NA
AZR16588.1|2293113_2293833_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AZR16589.1|2294127_2294775_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	49.8	7.2e-50
AZR16590.1|2294792_2295479_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	52.2	4.6e-55
AZR16591.1|2295593_2296052_+	hypothetical protein	NA	NA	NA	NA	NA
AZR16592.1|2296099_2296900_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AZR16593.1|2297128_2298436_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.2	2.0e-38
AZR16594.1|2298722_2299493_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR16595.1|2299509_2300268_-	ABC transporter permease	NA	NA	NA	NA	NA
AZR16596.1|2300257_2301148_-	ABC transporter	NA	A0A2H4PQG7	Staphylococcus_phage	35.8	5.4e-32
AZR16597.1|2301319_2302726_-|transposase	ISLre2-like element ISLcr2 family transposase	transposase	NA	NA	NA	NA
AZR16598.1|2304080_2304395_-	hypothetical protein	NA	NA	NA	NA	NA
AZR16599.1|2304446_2305625_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.6	8.2e-36
AZR16600.1|2306532_2307261_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AZR16601.1|2307441_2308752_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.5	1.8e-44
AZR16602.1|2308811_2309669_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
