The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034662	Moraxella catarrhalis strain 46P58B1 chromosome, complete genome	2045324	808712	834905	2045324	tail,integrase	Moraxella_phage(26.09%)	32	808946:808961	816627:816642
AZQ94014.1|808712_809792_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	51.7	6.0e-09
808946:808961	attL	ACTTGATGAAATTGAG	NA	NA	NA	NA
AZQ93590.1|809836_810835_+|integrase	phage integrase family protein	integrase	A0A0R6PHH4	Moraxella_phage	42.2	5.8e-67
AZQ92708.1|810864_811950_-	ribonucleoside-diphosphate reductase 1 subunit beta	NA	W6AT53	Erwinia_phage	63.5	5.6e-132
AZQ93532.1|811964_812264_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ94258.1|812345_812822_-	hypothetical protein	NA	A0A0R6PHK6	Moraxella_phage	98.1	6.4e-88
AZQ93644.1|812826_813084_-	hypothetical protein	NA	A0A0R6PHP0	Moraxella_phage	63.5	2.4e-25
AZQ94322.1|813372_813726_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ93387.1|813737_814259_-	crossover junction endodeoxyribonuclease RuvC family protein	NA	U5PZY8	Acinetobacter_phage	36.6	5.6e-21
AZQ94015.1|814255_814456_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ93528.1|814465_815161_-	putative single-stranded DNA-binding protein	NA	E9NIH2	Enterobacter_phage	40.1	2.0e-37
AZQ92560.1|815193_815715_-	HNH endonuclease family protein	NA	A0A2P9J4Z6	Pectobacterium_phage	45.3	8.4e-33
AZQ92400.1|815777_816509_-	AAA domain protein	NA	M4SNJ2	Pseudoalteromonas_phage	53.9	2.1e-69
AZQ92650.1|816572_818594_-	hypothetical protein	NA	A0A2P0N9U7	Pectobacterium_phage	55.8	8.1e-217
816627:816642	attR	CTCAATTTCATCAAGT	NA	NA	NA	NA
AZQ94082.1|818988_819246_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ94108.1|819242_820208_-	PD-(D/E)XK nuclease superfamily protein	NA	C8ZKS3	Pseudomonas_phage	49.5	2.0e-88
AZQ93418.1|820384_820762_-	putative enoyl-CoA hydratase/carnithine racemase-like protein	NA	A0A0R6PGL8	Moraxella_phage	98.4	2.1e-70
AZQ93382.1|820826_821393_-	hypothetical protein	NA	A0A0R6PC75	Moraxella_phage	97.9	2.6e-104
AZQ94032.1|821394_824154_-|tail	phage tail fiber repeat family protein	tail	A0A0R6PGN6	Moraxella_phage	76.9	1.8e-174
AZQ93679.1|824201_824522_-	hypothetical protein	NA	A0A1W6DY16	Salmonella_phage	44.2	3.1e-14
AZQ93286.1|824729_824876_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ93440.1|824980_825127_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ93571.1|825302_825998_-	thymidylate synthase, flavin-dependent	NA	F2Y0N9	Organic_Lake_phycodnavirus	52.0	6.1e-47
AZQ93040.1|826128_826497_+	putative membrane protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	40.5	1.1e-15
AZQ93139.1|826505_827090_+	hypothetical protein	NA	U5PZP0	Acinetobacter_phage	48.7	2.6e-43
AZQ93031.1|827149_827605_-	phosphoribosyl-ATP pyrophosphohydrolase family protein	NA	A0A067Y175	Escherichia_phage	50.7	2.9e-29
AZQ93856.1|827591_827837_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ93474.1|827906_828512_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ92418.1|828514_831022_-	DNA polymerase A family protein	NA	S4TP25	Salmonella_phage	48.2	4.4e-220
AZQ93892.1|831014_831473_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ93920.1|831472_832729_-	AAA domain protein	NA	U5PWH9	Acinetobacter_phage	27.2	5.7e-35
AZQ92816.1|832712_833852_-	putative metallopeptidase domain protein	NA	A0A0A0YU59	Escherichia_phage	30.8	3.4e-47
AZQ93927.1|833897_834905_-	ATPase associated with various cellular activities family protein	NA	A0A2P0PB49	Pectobacterium_phage	40.1	8.5e-66
>prophage 2
CP034662	Moraxella catarrhalis strain 46P58B1 chromosome, complete genome	2045324	1031667	1050300	2045324	tail,head	Moraxella_phage(94.59%)	39	NA	NA
AZQ92843.1|1031667_1031847_-	hypothetical protein	NA	A0A0R6PH66	Moraxella_phage	83.1	1.9e-21
AZQ93882.1|1031898_1032549_-	peptidase S24-like family protein	NA	A0A0R6PHA8	Moraxella_phage	92.6	5.8e-116
AZQ94331.1|1032529_1032712_+	putative cro protein	NA	A0A0R6PKC6	Moraxella_phage	98.3	1.9e-29
AZQ93988.1|1032751_1033120_+	hypothetical protein	NA	A0A0R6PKG5	Moraxella_phage	99.2	6.3e-59
AZQ92706.1|1033116_1033467_+	hypothetical protein	NA	NA	NA	NA	NA
AZQ92870.1|1033417_1033660_+|head	putative phage head morphogenesis protein	head	A0A0R6PJT7	Moraxella_phage	97.5	2.9e-36
AZQ94352.1|1033656_1034331_+|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	A0A0R6PJT7	Moraxella_phage	95.1	2.6e-119
AZQ94330.1|1034403_1034964_+	hypothetical protein	NA	A0A0R6PK01	Moraxella_phage	100.0	3.4e-64
AZQ94244.1|1035002_1035137_+	hypothetical protein	NA	A0A0R6PK69	Moraxella_phage	100.0	8.1e-17
AZQ93412.1|1035139_1036093_+	hypothetical protein	NA	A0A0R6PJX4	Moraxella_phage	100.0	1.3e-177
AZQ93163.1|1036102_1036345_+	hypothetical protein	NA	A0A0R6PK16	Moraxella_phage	98.8	1.6e-39
AZQ92774.1|1036401_1036752_+	hypothetical protein	NA	A0A0R6PK23	Moraxella_phage	100.0	2.3e-58
AZQ92299.1|1036748_1037099_+	putative glutamate 5-kinase	NA	A0A0R6PFD9	Moraxella_phage	93.1	2.6e-54
AZQ93334.1|1037098_1037446_+	hypothetical protein	NA	A0A0R6PHN4	Moraxella_phage	88.7	2.9e-58
AZQ93039.1|1037442_1037643_-	hypothetical protein	NA	A0A0R6PK05	Moraxella_phage	98.5	2.0e-27
AZQ93070.1|1037843_1037981_+	hypothetical protein	NA	A0A0R6PK62	Moraxella_phage	100.0	3.6e-12
AZQ94297.1|1038022_1038409_+	bacteriophage related domain of unknown function family protein	NA	A0A0R6PK03	Moraxella_phage	83.6	6.8e-56
AZQ93043.1|1038417_1038936_+	hypothetical protein	NA	A0MZD8	Enterobacteria_phage	44.0	4.3e-29
AZQ93256.1|1038970_1039879_+	hypothetical protein	NA	A0A0R6PJY2	Moraxella_phage	95.0	1.3e-158
AZQ94299.1|1039962_1040109_+	hypothetical protein	NA	A0A0R6PKB8	Moraxella_phage	100.0	2.3e-17
AZQ92438.1|1040160_1040622_+	hypothetical protein	NA	A0A0R6PKF1	Moraxella_phage	98.7	1.7e-77
AZQ94058.1|1040657_1040906_+	hypothetical protein	NA	A0A0R6PJS2	Moraxella_phage	97.6	1.8e-41
AZQ93977.1|1041135_1041339_+	hypothetical protein	NA	A0A0R6PDL2	Moraxella_phage	98.4	1.2e-27
AZQ93840.1|1041307_1041439_+	hypothetical protein	NA	A0A0R6PDL2	Moraxella_phage	95.1	1.4e-13
AZQ93804.1|1041598_1041781_+	hypothetical protein	NA	A0A0R6PDJ5	Moraxella_phage	100.0	7.7e-26
AZQ93844.1|1041743_1042580_+	hypothetical protein	NA	A0A0R6PI23	Moraxella_phage	99.3	7.1e-151
AZQ92326.1|1042612_1045381_+	tape measure domain protein	NA	A0A0R6PHL3	Moraxella_phage	63.5	7.8e-77
AZQ94048.1|1045380_1046499_+|tail	tP901 family phage tail tape measure protein	tail	G3ENB0	Psychrobacter_phage	29.4	2.1e-36
AZQ93726.1|1046601_1046934_+|tail	phage minor tail family protein	tail	A0A0R6PHH7	Moraxella_phage	97.3	1.5e-56
AZQ93794.1|1047024_1047408_+	hypothetical protein	NA	A0A0R6PCZ3	Moraxella_phage	96.9	5.2e-64
AZQ94200.1|1047550_1048219_+|tail	phage minor tail protein L	tail	A0A0R6PDY9	Moraxella_phage	100.0	1.9e-130
AZQ92652.1|1048215_1048419_-	hypothetical protein	NA	A0A0R6PJ49	Moraxella_phage	100.0	9.8e-30
AZQ93665.1|1048562_1048688_+	hypothetical protein	NA	A0A0R6PI32	Moraxella_phage	100.0	2.3e-13
AZQ94138.1|1048801_1049053_+	hypothetical protein	NA	A0A0R6PIU2	Moraxella_phage	97.6	1.9e-43
AZQ92647.1|1049053_1049596_+	nlpC/P60 family protein	NA	A0A0R6PK44	Moraxella_phage	94.3	2.6e-101
AZQ94337.1|1049575_1049737_-	ydcQ family protein	NA	A0A0R6PJC0	Moraxella_phage	98.1	5.6e-20
AZQ93385.1|1049806_1049989_-	antitoxin HicB	NA	A0A0R6PHD4	Moraxella_phage	100.0	2.8e-28
AZQ92760.1|1050004_1050211_+	hypothetical protein	NA	NA	NA	NA	NA
AZQ92986.1|1050180_1050300_+	hypothetical protein	NA	A0A0R6PHM3	Moraxella_phage	76.9	5.9e-11
>prophage 3
CP034662	Moraxella catarrhalis strain 46P58B1 chromosome, complete genome	2045324	1068912	1074182	2045324		Moraxella_phage(83.33%)	10	NA	NA
AZQ93703.1|1068912_1069032_-	hypothetical protein	NA	A0A0R6PH00	Moraxella_phage	87.5	4.4e-06
AZQ94063.1|1069253_1069451_+	ribbon-helix-helix, copG family protein	NA	A0A0R6PK05	Moraxella_phage	47.7	9.2e-09
AZQ92965.1|1069777_1070068_+	dNA-binding protein, CopG family	NA	A0A0R6PJ17	Moraxella_phage	61.1	6.1e-25
AZQ93455.1|1070119_1070239_-	putative membrane protein	NA	NA	NA	NA	NA
AZQ93227.1|1070456_1070687_+	hypothetical protein	NA	A0A0R6PJ49	Moraxella_phage	74.2	1.1e-18
AZQ93339.1|1070702_1070834_-	hypothetical protein	NA	A0A0R6PH46	Moraxella_phage	85.3	1.6e-09
AZQ93891.1|1070802_1071348_-	spoU rRNA Methylase family protein	NA	NA	NA	NA	NA
AZQ93109.1|1071595_1071736_+	entericidin EcnA/B family protein	NA	NA	NA	NA	NA
AZQ93269.1|1071817_1072993_-	radical SAM superfamily protein	NA	NA	NA	NA	NA
AZQ92770.1|1073006_1074182_-	DEAD/DEAH box helicase family protein	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.1	1.4e-40
>prophage 4
CP034662	Moraxella catarrhalis strain 46P58B1 chromosome, complete genome	2045324	1470667	1599535	2045324	protease,portal,capsid,terminase,tail,head,integrase,tRNA	Moraxella_phage(91.18%)	189	1507721:1507780	1557034:1557229
AZQ93208.1|1470667_1472110_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.4	9.7e-47
AZQ92787.1|1472100_1472274_+	hypothetical protein	NA	NA	NA	NA	NA
AZQ94066.1|1472409_1474461_+|tRNA	methionine--tRNA ligase, beta subunit	tRNA	A0A1V0SDF2	Indivirus	27.8	2.1e-55
AZQ92504.1|1474518_1475907_-	O-acyltransferase WSD	NA	NA	NA	NA	NA
AZQ94254.1|1476054_1476825_-	thiazole synthase	NA	NA	NA	NA	NA
AZQ92714.1|1477245_1477593_+	hypothetical protein	NA	A0A0R6PH82	Moraxella_phage	98.3	3.7e-61
AZQ94284.1|1477655_1478624_+	hypothetical protein	NA	A0A0R6PGN5	Moraxella_phage	98.1	3.8e-180
AZQ93307.1|1478625_1478826_+	hypothetical protein	NA	A0A0R6PCD3	Moraxella_phage	87.9	2.2e-26
AZQ93423.1|1478960_1479332_+	hypothetical protein	NA	A0A0R6PCL0	Moraxella_phage	61.3	1.6e-33
AZQ92762.1|1479388_1479934_-	peptidase M15 family protein	NA	A0A0R6PGV9	Moraxella_phage	93.4	2.9e-92
AZQ93886.1|1479958_1480285_-	putative membrane protein	NA	A0A0R6PI95	Moraxella_phage	93.5	7.3e-51
AZQ93262.1|1480277_1480652_-	putative membrane protein	NA	A0A0R6PIH7	Moraxella_phage	98.4	9.2e-66
AZQ93101.1|1480662_1487364_-|tail	phage tail family protein	tail	A0A0R6PHL4	Moraxella_phage	72.7	0.0e+00
AZQ94271.1|1487372_1487837_-|tail	putative phage tail assembly protein	tail	A0A0R6PJT2	Moraxella_phage	99.4	7.2e-60
AZQ93955.1|1487836_1487965_-|tail	bacteriophage lambda tail assembly I family protein	tail	A0A0R6PJT2	Moraxella_phage	100.0	1.5e-12
AZQ94379.1|1488040_1488793_-	NlpC/P60 family protein	NA	A0A0R6PHD1	Moraxella_phage	94.7	1.4e-108
AZQ94059.1|1488808_1489135_-|terminase	putative phage terminase large subunit	terminase	A0A0R6PHH0	Moraxella_phage	99.1	8.0e-58
AZQ93151.1|1489157_1489391_-|terminase	phage terminase large subunit domain protein	terminase	A0A0R6PHB9	Moraxella_phage	83.6	1.1e-21
AZQ92807.1|1489380_1490055_-|terminase	putative phage terminase large subunit	terminase	A0A0R6PHB9	Moraxella_phage	89.6	6.7e-107
AZQ92828.1|1490054_1490474_-	hypothetical protein	NA	A0A0R6PH16	Moraxella_phage	63.6	1.1e-43
AZQ93080.1|1490510_1491038_-	formyl transferase family protein	NA	A4JWM2	Burkholderia_virus	40.0	9.4e-32
AZQ93215.1|1491030_1492008_-	ABC transporter family protein	NA	A4JWM1	Burkholderia_virus	61.0	1.0e-116
AZQ94165.1|1492165_1492339_-	hypothetical protein	NA	A4JWM0	Burkholderia_virus	51.1	6.8e-08
AZQ93898.1|1492367_1493234_-	DNA (cytosine-5-)-methyltransferase family protein	NA	A0A1P8DJM9	Virus_Rctr41k	51.8	5.6e-42
AZQ92771.1|1493340_1493472_-	hypothetical protein	NA	A0A0R6PKS8	Moraxella_phage	100.0	2.2e-19
AZQ92455.1|1493545_1493938_-	phage antitermination Q family protein	NA	A0A0R6PHJ2	Moraxella_phage	97.7	1.6e-68
AZQ94046.1|1493937_1494210_-	hypothetical protein	NA	A0A0R6PH23	Moraxella_phage	95.8	2.1e-35
AZQ92751.1|1494199_1494580_-	hypothetical protein	NA	A0A0R6PHQ0	Moraxella_phage	99.2	5.1e-64
AZQ92841.1|1494554_1494734_-	hypothetical protein	NA	A0A0R6PHI3	Moraxella_phage	100.0	2.3e-27
AZQ92490.1|1494743_1495232_-	ninB family protein	NA	A0A0R6PCZ2	Moraxella_phage	98.8	1.9e-87
AZQ93102.1|1495215_1495518_-	hypothetical protein	NA	A0A0R6PD09	Moraxella_phage	95.0	1.2e-52
AZQ92469.1|1495586_1496252_-	thymidylate synthase, flavin-dependent	NA	A0A0R6PHK2	Moraxella_phage	98.2	1.3e-123
AZQ92579.1|1496252_1496594_-	hypothetical protein	NA	A0A0R6PIZ9	Moraxella_phage	96.5	1.9e-54
AZQ93510.1|1496610_1497135_-	hypothetical protein	NA	A0A0R6PHI8	Moraxella_phage	97.1	3.8e-94
AZQ92548.1|1497112_1498165_-	helix-turn-helix domain protein	NA	A0A0R6PHP4	Moraxella_phage	88.1	1.6e-147
AZQ93814.1|1498154_1498589_-	hypothetical protein	NA	A0A0R6PHM4	Moraxella_phage	99.3	2.4e-73
AZQ92340.1|1498748_1498952_-	hypothetical protein	NA	A0A0R6PHI7	Moraxella_phage	83.6	3.5e-27
AZQ92617.1|1499087_1499804_+	bacteriophage CI repressor helix-turn-helix domain protein	NA	A0A2H4J597	uncultured_Caudovirales_phage	39.0	1.6e-45
AZQ94256.1|1499849_1500380_+	hypothetical protein	NA	A0A2H4JB10	uncultured_Caudovirales_phage	52.6	2.8e-07
AZQ93739.1|1500606_1501104_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ92910.1|1501150_1501303_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ92974.1|1501423_1501540_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ92316.1|1501676_1501838_+	hypothetical protein	NA	A0A0R6PHL0	Moraxella_phage	100.0	7.0e-23
AZQ93913.1|1502217_1502460_+	hypothetical protein	NA	A0A0R6PHK7	Moraxella_phage	93.8	1.9e-35
AZQ92223.1|1502474_1502627_+	hypothetical protein	NA	A0A0R6PHP2	Moraxella_phage	100.0	4.0e-20
AZQ92396.1|1502595_1503093_+	siphovirus Gp157 family protein	NA	A0A0R6PHR8	Moraxella_phage	100.0	6.2e-86
AZQ94087.1|1503192_1503822_+	putative phage protein	NA	A0A0R6PHJ4	Moraxella_phage	99.5	2.1e-118
AZQ92775.1|1503818_1504523_+	hypothetical protein	NA	A0A0R6PD08	Moraxella_phage	97.9	2.3e-126
AZQ92742.1|1504531_1504753_+	hypothetical protein	NA	A0A0R6PD26	Moraxella_phage	97.3	6.9e-37
AZQ94125.1|1504774_1504990_+	hypothetical protein	NA	A0A0R6PHL9	Moraxella_phage	98.6	1.8e-34
AZQ92552.1|1504956_1505145_+	hypothetical protein	NA	A0A0R6PHN2	Moraxella_phage	100.0	2.0e-29
AZQ93864.1|1505230_1505368_+	hypothetical protein	NA	A0A0R6PHK4	Moraxella_phage	93.3	4.4e-18
AZQ92964.1|1505357_1505627_+	hypothetical protein	NA	A0A0R6PHR5	Moraxella_phage	91.0	1.3e-40
AZQ94253.1|1505680_1506163_+	hypothetical protein	NA	A0A0R6PHK6	Moraxella_phage	80.0	1.7e-67
AZQ92439.1|1506350_1506524_+	prophage CP4-57 regulatory family protein	NA	A0A0R6PC61	Moraxella_phage	98.2	1.1e-26
AZQ92472.1|1506547_1507720_-	hypothetical protein	NA	A0A0R6PGM3	Moraxella_phage	99.0	4.1e-221
1507721:1507780	attL	AACAGTATATCCAATTCAATAACAGTACATTTGAGTTATGTACTGTCTACTATACTGTTA	NA	NA	NA	NA
AZQ94148.1|1508132_1508480_+	hypothetical protein	NA	A0A0R6PH82	Moraxella_phage	98.3	3.7e-61
AZQ93719.1|1508542_1509511_+	hypothetical protein	NA	A0A0R6PGN5	Moraxella_phage	98.1	3.8e-180
AZQ92863.1|1509512_1509713_+	hypothetical protein	NA	A0A0R6PCD3	Moraxella_phage	87.9	2.2e-26
AZQ93660.1|1509847_1510219_+	hypothetical protein	NA	A0A0R6PCL0	Moraxella_phage	61.3	1.6e-33
AZQ93934.1|1510275_1510821_-	peptidase M15 family protein	NA	A0A0R6PGV9	Moraxella_phage	93.4	2.9e-92
AZQ93128.1|1510845_1511172_-	putative membrane protein	NA	A0A0R6PI95	Moraxella_phage	93.5	7.3e-51
AZQ92494.1|1511164_1511539_-	putative membrane protein	NA	A0A0R6PIH7	Moraxella_phage	98.4	9.2e-66
AZQ93221.1|1511549_1518251_-|tail	phage tail family protein	tail	A0A0R6PHL4	Moraxella_phage	72.7	0.0e+00
AZQ92872.1|1518259_1518853_-|tail	bacteriophage lambda tail assembly I family protein	tail	A0A0R6PJT2	Moraxella_phage	99.0	2.2e-85
AZQ93594.1|1518918_1519707_-	hypothetical protein	NA	A0A0R6PK44	Moraxella_phage	92.3	1.4e-148
AZQ94238.1|1519764_1519995_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ92448.1|1520235_1520904_-|tail	phage minor tail protein L	tail	A0A0R6PDY9	Moraxella_phage	99.5	5.5e-130
AZQ93316.1|1521050_1521434_-	hypothetical protein	NA	A0A0R6PJ90	Moraxella_phage	99.2	2.1e-65
AZQ92371.1|1521537_1521870_-|tail	phage minor tail family protein	tail	A0A0R6PHH7	Moraxella_phage	92.7	7.1e-54
AZQ93032.1|1521856_1522024_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ93029.1|1522095_1526082_-|tail	phage tail tape measure protein, TP901 family, core region	tail	G3ENB0	Psychrobacter_phage	35.8	2.8e-88
AZQ93884.1|1526114_1526396_-	hypothetical protein	NA	A0A0R6PIN1	Moraxella_phage	100.0	6.5e-48
AZQ92620.1|1526467_1526650_-	hypothetical protein	NA	A0A0R6PDJ5	Moraxella_phage	100.0	7.7e-26
AZQ93700.1|1526807_1527608_-	BRO family, N-terminal domain protein	NA	A0A0R6PDL2	Moraxella_phage	73.2	1.5e-68
AZQ93908.1|1527904_1528357_-|tRNA	tRNA_anti-like family protein	tRNA	NA	NA	NA	NA
AZQ92561.1|1528438_1528687_-	hypothetical protein	NA	A0A0R6PJS2	Moraxella_phage	96.3	2.0e-40
AZQ93712.1|1528722_1529184_-	hypothetical protein	NA	A0A0R6PKF1	Moraxella_phage	98.7	4.4e-78
AZQ92765.1|1529235_1529382_-	hypothetical protein	NA	A0A0R6PKB8	Moraxella_phage	100.0	2.3e-17
AZQ94315.1|1529465_1530374_-	hypothetical protein	NA	A0A0R6PJY2	Moraxella_phage	99.7	9.4e-165
AZQ94190.1|1530377_1530566_-	hypothetical protein	NA	A0A0R6PFF0	Moraxella_phage	100.0	1.4e-30
AZQ93371.1|1530565_1530949_-	bacteriophage related domain of unknown function family protein	NA	A0A0R6PK03	Moraxella_phage	96.1	5.9e-68
AZQ94242.1|1531319_1531520_+	hypothetical protein	NA	A0A0R6PK05	Moraxella_phage	75.8	4.5e-19
AZQ94021.1|1531516_1531864_-	hypothetical protein	NA	A0A0R6PH46	Moraxella_phage	100.0	3.0e-63
AZQ93860.1|1531863_1532220_-	putative glutamate 5-kinase	NA	A0A0R6PH70	Moraxella_phage	99.2	4.2e-60
AZQ92320.1|1532221_1532581_-	hypothetical protein	NA	A0A0R6PGY9	Moraxella_phage	98.3	1.6e-59
AZQ92940.1|1532641_1532845_-	hypothetical protein	NA	A0A0R6PCI4	Moraxella_phage	100.0	3.4e-30
AZQ93745.1|1532855_1533872_-	putative phage-like protein	NA	A0A0R6PHI9	Moraxella_phage	96.4	5.0e-183
AZQ93872.1|1533874_1534510_-	hypothetical protein	NA	A0A0R6PH19	Moraxella_phage	96.7	1.0e-85
AZQ93837.1|1534625_1534745_-	hypothetical protein	NA	A0A0R6PHH2	Moraxella_phage	100.0	9.7e-14
AZQ92790.1|1534728_1536468_-|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	A0A0R6PHM5	Moraxella_phage	99.8	0.0e+00
AZQ93403.1|1536479_1537895_-	hypothetical protein	NA	A0A0R6PHK8	Moraxella_phage	99.2	2.5e-273
AZQ93758.1|1537894_1539367_-|terminase	putative terminase large subunit	terminase	A0A0R6PHB9	Moraxella_phage	95.3	2.2e-280
AZQ93332.1|1539366_1539786_-	hypothetical protein	NA	A0A0R6PH16	Moraxella_phage	63.6	1.1e-43
AZQ93317.1|1539822_1540350_-	formyl transferase family protein	NA	A4JWM2	Burkholderia_virus	40.0	9.4e-32
AZQ93090.1|1540342_1541482_-	ABC transporter family protein	NA	A4JWM1	Burkholderia_virus	58.4	1.1e-130
AZQ93144.1|1541478_1541652_-	hypothetical protein	NA	A4JWM0	Burkholderia_virus	51.1	6.8e-08
AZQ92985.1|1541680_1542547_-	DNA (cytosine-5-)-methyltransferase family protein	NA	A0A1P8DJM9	Virus_Rctr41k	51.8	5.6e-42
AZQ92479.1|1542653_1542785_-	hypothetical protein	NA	A0A0R6PKS8	Moraxella_phage	100.0	2.2e-19
AZQ93008.1|1542858_1543251_-	phage antitermination Q family protein	NA	A0A0R6PHJ2	Moraxella_phage	97.7	1.6e-68
AZQ92382.1|1543250_1543523_-	hypothetical protein	NA	A0A0R6PH23	Moraxella_phage	95.8	2.1e-35
AZQ93277.1|1543512_1543893_-	hypothetical protein	NA	A0A0R6PHQ0	Moraxella_phage	99.2	5.1e-64
AZQ93827.1|1543867_1544047_-	hypothetical protein	NA	A0A0R6PHI3	Moraxella_phage	100.0	2.3e-27
AZQ93156.1|1544056_1544545_-	ninB family protein	NA	A0A0R6PCZ2	Moraxella_phage	98.8	1.9e-87
AZQ93166.1|1544528_1544831_-	hypothetical protein	NA	A0A0R6PD09	Moraxella_phage	95.0	1.2e-52
AZQ94123.1|1544899_1545565_-	thymidylate synthase, flavin-dependent	NA	A0A0R6PHK2	Moraxella_phage	98.2	1.3e-123
AZQ92491.1|1545565_1545907_-	hypothetical protein	NA	A0A0R6PIZ9	Moraxella_phage	96.5	1.9e-54
AZQ93430.1|1545923_1546448_-	hypothetical protein	NA	A0A0R6PHI8	Moraxella_phage	97.1	3.8e-94
AZQ93518.1|1546425_1547478_-	helix-turn-helix domain protein	NA	A0A0R6PHP4	Moraxella_phage	88.1	1.6e-147
AZQ93885.1|1547467_1547902_-	hypothetical protein	NA	A0A0R6PHM4	Moraxella_phage	99.3	2.4e-73
AZQ93448.1|1548061_1548265_-	hypothetical protein	NA	A0A0R6PHI7	Moraxella_phage	83.6	3.5e-27
AZQ92467.1|1548400_1549117_+	bacteriophage CI repressor helix-turn-helix domain protein	NA	A0A2H4J597	uncultured_Caudovirales_phage	39.0	1.6e-45
AZQ94214.1|1549162_1549693_+	hypothetical protein	NA	A0A2H4JB10	uncultured_Caudovirales_phage	52.6	2.8e-07
AZQ94281.1|1549919_1550417_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ93135.1|1550463_1550616_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ93523.1|1550736_1550853_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ92919.1|1550989_1551151_+	hypothetical protein	NA	A0A0R6PHL0	Moraxella_phage	100.0	7.0e-23
AZQ92925.1|1551530_1551773_+	hypothetical protein	NA	A0A0R6PHK7	Moraxella_phage	93.8	1.9e-35
AZQ92685.1|1551787_1551940_+	hypothetical protein	NA	A0A0R6PHP2	Moraxella_phage	100.0	4.0e-20
AZQ92525.1|1551908_1552406_+	siphovirus Gp157 family protein	NA	A0A0R6PHR8	Moraxella_phage	100.0	6.2e-86
AZQ94229.1|1552505_1553135_+	putative phage protein	NA	A0A0R6PHJ4	Moraxella_phage	99.5	2.1e-118
AZQ93662.1|1553131_1553836_+	hypothetical protein	NA	A0A0R6PD08	Moraxella_phage	97.9	2.3e-126
AZQ94335.1|1553844_1554066_+	hypothetical protein	NA	A0A0R6PD26	Moraxella_phage	97.3	6.9e-37
AZQ94110.1|1554087_1554303_+	hypothetical protein	NA	A0A0R6PHL9	Moraxella_phage	98.6	1.8e-34
AZQ92610.1|1554269_1554458_+	hypothetical protein	NA	A0A0R6PHN2	Moraxella_phage	100.0	2.0e-29
AZQ93915.1|1554543_1554681_+	hypothetical protein	NA	A0A0R6PHK4	Moraxella_phage	93.3	4.4e-18
AZQ94117.1|1554670_1554940_+	hypothetical protein	NA	A0A0R6PHR5	Moraxella_phage	91.0	1.3e-40
AZQ92747.1|1554993_1555476_+	hypothetical protein	NA	A0A0R6PHK6	Moraxella_phage	80.0	1.7e-67
AZQ92238.1|1555663_1555837_+	prophage CP4-57 regulatory family protein	NA	A0A0R6PC61	Moraxella_phage	98.2	1.1e-26
AZQ93811.1|1555860_1557033_-|integrase	phage integrase family protein	integrase	A0A0R6PGM3	Moraxella_phage	99.0	4.1e-221
AZQ93792.1|1557651_1557975_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
1557034:1557229	attR	AACAGTATATCCAATTCAATAACAGTACATTTGAGTTATGTACTGTCTACTATACTGTTATTATTTATAGATTTCAATGGCTATTGATAGACTTTAAGAGACTTTAGAAGCAAATAAAAAAGCCCAAGGCATTGGTTTCCTTGGGCTTGATAGTCTTTAATAGACTTTAAGAGAATGTAAGATGGGGCGACTAATG	NA	NA	NA	NA
AZQ92492.1|1558080_1558383_+	hypothetical protein	NA	NA	NA	NA	NA
AZQ92826.1|1558492_1558621_+	hypothetical protein	NA	NA	NA	NA	NA
AZQ92880.1|1558809_1558938_+	hypothetical protein	NA	NA	NA	NA	NA
AZQ92820.1|1559632_1559980_+	hypothetical protein	NA	A0A0R6PH82	Moraxella_phage	100.0	9.7e-62
AZQ94018.1|1560045_1560540_+	hypothetical protein	NA	NA	NA	NA	NA
AZQ94354.1|1560532_1561099_+	hypothetical protein	NA	NA	NA	NA	NA
AZQ93378.1|1561091_1561700_+	hypothetical protein	NA	NA	NA	NA	NA
AZQ94355.1|1561722_1562268_-	peptidase M15 family protein	NA	A0A0R6PHB3	Moraxella_phage	93.9	1.2e-93
AZQ93042.1|1562291_1562612_-	putative membrane protein	NA	A0A0R6PIG0	Moraxella_phage	98.1	4.9e-52
AZQ93677.1|1562604_1562979_-	putative membrane protein	NA	A0A0R6PGL6	Moraxella_phage	100.0	3.2e-66
AZQ92972.1|1562988_1567782_-|tail	phage tail family protein	tail	A0A0R6PHD3	Moraxella_phage	68.5	0.0e+00
AZQ94375.1|1567790_1568393_-|tail	bacteriophage lambda tail assembly I family protein	tail	A0A0R6PD40	Moraxella_phage	99.0	2.2e-93
AZQ93074.1|1568389_1569172_-	hypothetical protein	NA	A0A0R6PI11	Moraxella_phage	97.7	1.3e-157
AZQ93966.1|1569285_1569411_-	hypothetical protein	NA	A0A0R6PI32	Moraxella_phage	100.0	2.3e-13
AZQ94264.1|1569554_1569758_+	hypothetical protein	NA	A0A0R6PJ49	Moraxella_phage	100.0	9.8e-30
AZQ94307.1|1569754_1570420_-|tail	phage minor tail protein L	tail	A0A0R6PJ75	Moraxella_phage	100.0	5.0e-131
AZQ94356.1|1570518_1570911_-	hypothetical protein	NA	A0A0R6PJT8	Moraxella_phage	97.7	1.6e-65
AZQ92451.1|1570967_1571345_-	putative enoyl-CoA hydratase/carnithine racemase-like protein	NA	A0A0R6PJJ0	Moraxella_phage	96.0	7.6e-68
AZQ92293.1|1571409_1571970_-	hypothetical protein	NA	A0A0R6PHE3	Moraxella_phage	93.5	5.7e-96
AZQ94236.1|1571969_1574231_-|tail	phage minor tail family protein	tail	A0A0R6PHF7	Moraxella_phage	97.4	0.0e+00
AZQ93951.1|1574381_1577930_-	tape measure domain protein	NA	A0A0R6PGQ1	Moraxella_phage	97.0	0.0e+00
AZQ93907.1|1578107_1578503_-	hypothetical protein	NA	A0A0R6PDC8	Moraxella_phage	100.0	5.5e-69
AZQ93052.1|1578597_1578720_-	hypothetical protein	NA	A0A0R6PCA7	Moraxella_phage	100.0	6.3e-16
AZQ92675.1|1578716_1579019_-	hypothetical protein	NA	A0A0R6PGJ8	Moraxella_phage	100.0	2.6e-50
AZQ92337.1|1579039_1579387_-	hypothetical protein	NA	A0A0R6PI67	Moraxella_phage	100.0	4.2e-57
AZQ92546.1|1579469_1579901_-	hypothetical protein	NA	A0A0R6PGW8	Moraxella_phage	99.3	1.6e-74
AZQ93100.1|1579928_1580285_-	hypothetical protein	NA	A0A0R6PHU3	Moraxella_phage	100.0	1.1e-65
AZQ93046.1|1580281_1580755_-	hypothetical protein	NA	A0A0R6PHX9	Moraxella_phage	100.0	8.3e-72
AZQ92666.1|1580738_1581080_-|head,tail	phage head-tail joining family protein	head,tail	A0A0R6PH38	Moraxella_phage	100.0	4.4e-59
AZQ93707.1|1581095_1581383_-|head,tail	phage gp6-like head-tail connector family protein	head,tail	A0A0R6PHI1	Moraxella_phage	100.0	1.7e-48
AZQ92346.1|1581379_1582690_-|portal	phage portal protein, HK97 family	portal	A0A0R6PHF0	Moraxella_phage	99.8	3.2e-254
AZQ93997.1|1582689_1582878_-	hypothetical protein	NA	A0A0R6PGJ0	Moraxella_phage	100.0	3.6e-26
AZQ92619.1|1582942_1584298_-|capsid	phage major capsid protein, HK97 family	capsid	A0A0R6PGW4	Moraxella_phage	99.8	4.1e-249
AZQ93022.1|1584294_1584912_-|head,protease	caudovirus prohead protease family protein	head,protease	A0A0R6PGU6	Moraxella_phage	94.6	2.4e-103
AZQ93602.1|1584978_1585182_-	hypothetical protein	NA	A0A0R6PH92	Moraxella_phage	100.0	3.4e-30
AZQ92374.1|1585284_1586118_-	D12 class N6 adenine-specific DNA methyltransferase family protein	NA	A0A0R6PGP7	Moraxella_phage	99.3	9.9e-161
AZQ92797.1|1586281_1586473_-	hypothetical protein	NA	A0A0R6PH35	Moraxella_phage	100.0	4.0e-33
AZQ92904.1|1586453_1588181_-	phage Terminase family protein	NA	A0A0R6PC34	Moraxella_phage	99.3	0.0e+00
AZQ93686.1|1588137_1588521_-	hypothetical protein	NA	A0A0R6PC49	Moraxella_phage	100.0	7.0e-69
AZQ93627.1|1588513_1588672_-	hypothetical protein	NA	A0A0R6PH30	Moraxella_phage	100.0	1.9e-25
AZQ93670.1|1588677_1589184_-	hypothetical protein	NA	A0A0R6PGM4	Moraxella_phage	95.2	1.9e-66
AZQ93463.1|1589320_1589629_-	HNH endonuclease family protein	NA	A0A0R6PHB7	Moraxella_phage	100.0	4.2e-56
AZQ93328.1|1589734_1590157_-	hypothetical protein	NA	A0A0R6PH86	Moraxella_phage	100.0	1.9e-75
AZQ93801.1|1590282_1590402_-	hypothetical protein	NA	A0A0R6PH88	Moraxella_phage	96.7	3.0e-07
AZQ93407.1|1590494_1593158_-	zinc-binding domain of primase-helicase family protein	NA	A0A0R6PHD2	Moraxella_phage	100.0	0.0e+00
AZQ92689.1|1593150_1593882_-	antA/AntB antirepressor family protein	NA	A0A0R6PGU3	Moraxella_phage	100.0	1.3e-137
AZQ92854.1|1593956_1594181_-	putative phage transcriptional regulator	NA	A0A0R6PGV0	Moraxella_phage	100.0	4.5e-36
AZQ94069.1|1594325_1594901_+	putative prophage repressor	NA	A0A0R6PGK2	Moraxella_phage	100.0	3.7e-106
AZQ92403.1|1594924_1595410_+	hypothetical protein	NA	A0A0R6PGY0	Moraxella_phage	99.4	6.3e-83
AZQ92367.1|1595389_1595710_-	hypothetical protein	NA	A0A0R6PGK1	Moraxella_phage	100.0	1.9e-56
AZQ93300.1|1595879_1596071_+	hypothetical protein	NA	A0A0R6PGS5	Moraxella_phage	100.0	6.4e-31
AZQ93367.1|1596073_1596358_+	hypothetical protein	NA	A0A0R6PH74	Moraxella_phage	100.0	3.3e-07
AZQ92743.1|1596348_1596645_+	hypothetical protein	NA	A0A0R6PGT5	Moraxella_phage	100.0	8.1e-49
AZQ92426.1|1596644_1596881_+	hypothetical protein	NA	A0A0R6PGJ4	Moraxella_phage	100.0	5.1e-38
AZQ92386.1|1596895_1597396_+	hypothetical protein	NA	A0A0R6PC46	Moraxella_phage	100.0	2.4e-93
AZQ94289.1|1597656_1597986_+	rare lipoA family protein	NA	A0A0R6PCU3	Moraxella_phage	100.0	3.2e-54
AZQ92777.1|1597987_1598275_+	hypothetical protein	NA	A0A0R6PH27	Moraxella_phage	100.0	2.1e-49
AZQ93636.1|1598269_1599535_-	hypothetical protein	NA	A0A0R6PHM8	Moraxella_phage	99.8	2.1e-242
