The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034589	Escherichia coli strain L37 chromosome, complete genome	4546245	1982094	1988403	4546245	transposase,lysis	Enterobacteria_phage(33.33%)	7	NA	NA
AZQ79953.1|1982094_1982794_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	99.1	4.0e-131
AZQ79954.1|1982804_1983230_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	94.9	3.0e-65
AZQ82275.1|1983367_1984825_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AZQ79955.1|1984962_1985754_+	transcriptional regulator	NA	R4TG31	Halovirus	40.2	2.8e-48
AZQ79956.1|1985746_1985965_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	81.4	3.6e-14
AZQ79957.1|1987824_1987977_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.0	1.4e-20
AZQ79958.1|1988079_1988403_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
>prophage 2
CP034589	Escherichia coli strain L37 chromosome, complete genome	4546245	2378223	2437774	4546245	protease,tail,portal,holin,terminase	Enterobacteria_phage(50.0%)	60	NA	NA
AZQ80288.1|2378223_2379684_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.1e-41
AZQ80289.1|2379772_2381056_-	MFS transporter	NA	NA	NA	NA	NA
AZQ80290.1|2381659_2381773_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
AZQ80291.1|2381841_2382075_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AZQ80292.1|2382391_2382982_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AZQ82293.1|2383079_2383199_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	84.6	3.1e-12
AZQ80293.1|2383253_2386559_-|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	69.0	5.0e-280
AZQ80294.1|2386623_2387223_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.1e-108
AZQ80295.1|2387293_2390707_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	98.5	0.0e+00
AZQ80296.1|2390766_2391414_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
AZQ80297.1|2392060_2392759_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.3e-133
AZQ80298.1|2392768_2393098_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AZQ80299.1|2393097_2396163_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.3	0.0e+00
AZQ80300.1|2396185_2396464_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	5.1e-45
AZQ82294.1|2396472_2396859_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	1.1e-61
AZQ80301.1|2396919_2397663_-|tail	phage tail protein	tail	K7PGT7	Enterobacteria_phage	99.2	2.0e-133
AZQ82295.1|2397673_2398075_-|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
AZQ80302.1|2398071_2398650_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	3.0e-100
AZQ80303.1|2398661_2398937_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AZQ80304.1|2398929_2399253_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	2.5e-51
AZQ80305.1|2401311_2402820_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	100.0	1.6e-289
AZQ80306.1|2402819_2403032_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AZQ80307.1|2403028_2405128_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	97.1	0.0e+00
AZQ82296.1|2405136_2405301_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	98.1	1.2e-22
AZQ82297.1|2406950_2407124_-	protein GnsB	NA	NA	NA	NA	NA
AZQ82298.1|2407296_2407452_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ82299.1|2407599_2407788_-	cold-shock protein	NA	NA	NA	NA	NA
AZQ80308.1|2407798_2408011_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AZQ80309.1|2408374_2408872_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AZQ80310.1|2408868_2409402_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	2.6e-98
AZQ80311.1|2409529_2409826_+	hypothetical protein	NA	NA	NA	NA	NA
AZQ80312.1|2409850_2410069_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	63.8	1.6e-17
AZQ80313.1|2410073_2410289_-|holin	holin	holin	A5LH82	Enterobacteria_phage	94.4	2.9e-32
AZQ80314.1|2410479_2411193_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZQ80315.1|2411599_2412559_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AZQ80316.1|2412751_2413276_+	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
AZQ80317.1|2414124_2416062_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.5e-58
AZQ82300.1|2416149_2416386_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
AZQ80318.1|2416420_2417701_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	8.6e-156
AZQ80319.1|2417720_2417831_-	transporter	NA	NA	NA	NA	NA
AZQ80320.1|2417888_2418908_-	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AZQ80321.1|2418919_2420134_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AZQ80322.1|2420339_2420666_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AZQ80323.1|2420800_2421142_+	DUF1283 family protein	NA	NA	NA	NA	NA
AZQ80324.1|2421176_2421737_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AZQ80325.1|2421739_2422450_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AZQ80326.1|2422557_2422863_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AZQ80327.1|2423061_2425488_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.2e-214
AZQ82301.1|2425548_2427972_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	3.7e-208
AZQ80328.1|2427982_2428600_+	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AZQ80329.1|2428601_2429456_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AZQ80330.1|2429498_2430113_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AZQ80331.1|2430271_2431564_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AZQ80332.1|2431516_2432212_-	dethiobiotin synthase	NA	NA	NA	NA	NA
AZQ80333.1|2432336_2433557_-	protein mlc	NA	NA	NA	NA	NA
AZQ80334.1|2433691_2434585_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZQ80335.1|2434691_2435945_+	MFS transporter	NA	NA	NA	NA	NA
AZQ80336.1|2436341_2436677_+	acid shock protein	NA	NA	NA	NA	NA
AZQ82302.1|2436769_2436853_+	hypothetical protein	NA	NA	NA	NA	NA
AZQ80337.1|2436952_2437774_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 3
CP034589	Escherichia coli strain L37 chromosome, complete genome	4546245	2755471	2764608	4546245	transposase	Escherichia_phage(42.86%)	9	NA	NA
AZQ80631.1|2755471_2756389_-|transposase	IS5-like element ISEc35 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	3.3e-101
AZQ80632.1|2756612_2757536_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
AZQ80633.1|2758071_2759136_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	1.3e-104
AZQ80634.1|2759150_2760020_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.4	5.2e-112
AZQ80635.1|2760051_2760942_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	4.8e-28
AZQ80636.1|2760956_2761511_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.0	1.9e-51
AZQ80637.1|2761602_2762433_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZQ80638.1|2762462_2763296_+	ABC transporter permease	NA	NA	NA	NA	NA
AZQ80639.1|2763285_2764608_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	1.4e-12
>prophage 4
CP034589	Escherichia coli strain L37 chromosome, complete genome	4546245	2807292	2852849	4546245	integrase,plate,transposase,tail	Escherichia_phage(13.33%)	49	2806751:2806765	2819204:2819218
2806751:2806765	attL	GCAAAAAGGCGCAAT	NA	NA	NA	NA
AZQ80679.1|2807292_2807607_+|integrase	integrase	integrase	A0A286S1S8	Klebsiella_phage	61.8	6.9e-06
AZQ80680.1|2807526_2807841_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AZQ80681.1|2808055_2809714_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
AZQ80682.1|2809706_2810702_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AZQ80683.1|2810694_2811381_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AZQ80684.1|2811380_2812754_+	flagellum-specific ATP synthase	NA	NA	NA	NA	NA
AZQ80685.1|2812772_2813216_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
AZQ80686.1|2813212_2814340_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
AZQ80687.1|2814444_2814909_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AZQ80688.1|2814913_2815918_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AZQ80689.1|2815914_2816328_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AZQ82318.1|2816330_2816696_+	flagellar protein FliO	NA	NA	NA	NA	NA
AZQ80690.1|2816695_2817433_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AZQ80691.1|2817442_2817712_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AZQ80692.1|2818386_2819085_+|transposase	IS1-like element IS1A family transposase	transposase	A0A077SLN4	Escherichia_phage	99.1	6.2e-132
AZQ80693.1|2819573_2820197_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
2819204:2819218	attR	ATTGCGCCTTTTTGC	NA	NA	NA	NA
AZQ80694.1|2820240_2820483_-	protein DsrB	NA	NA	NA	NA	NA
AZQ80695.1|2820415_2820604_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ80696.1|2820591_2820819_+	stress-induced protein YodD	NA	NA	NA	NA	NA
AZQ80697.1|2821116_2821932_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AZQ80698.1|2821928_2823623_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
AZQ80699.1|2823793_2823976_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AZQ80700.1|2824054_2825008_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AZQ80701.1|2825145_2826066_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AZQ80702.1|2826054_2826525_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	4.4e-33
AZQ80703.1|2826505_2827924_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
AZQ80704.1|2827990_2828686_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
AZQ80705.1|2828725_2829091_-	permease	NA	NA	NA	NA	NA
AZQ80706.1|2829656_2830730_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.6	8.1e-99
AZQ80707.1|2831322_2832174_+	Molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
AZQ80708.1|2832281_2833640_-	HAMP domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.2	5.1e-05
AZQ82319.1|2833639_2834311_-	DNA-binding response regulator HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AZQ80709.1|2834443_2834857_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AZQ80710.1|2834965_2835970_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AZQ80711.1|2835970_2836606_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AZQ80712.1|2836841_2837513_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AZQ80713.1|2837855_2838386_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
AZQ80714.1|2839288_2839615_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.9	4.7e-26
AZQ80715.1|2839617_2839857_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	1.2e-21
AZQ80716.1|2839955_2841176_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AZQ80717.1|2841755_2842637_+	hypothetical protein	NA	NA	NA	NA	NA
AZQ80718.1|2842648_2842966_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ82320.1|2843335_2843575_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ80719.1|2847000_2848329_+	hypothetical protein	NA	NA	NA	NA	NA
AZQ80720.1|2848927_2849605_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
AZQ80721.1|2849601_2850750_-|plate	baseplate J/gp47 family protein	plate	R9TN81	Rhizobium_phage	25.6	2.4e-16
AZQ80722.1|2850739_2851189_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	41.4	7.2e-17
AZQ80723.1|2851185_2851767_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
AZQ80724.1|2851763_2852849_-|tail	phage tail protein	tail	Q8SBG7	Shigella_phage	30.2	6.2e-38
>prophage 5
CP034589	Escherichia coli strain L37 chromosome, complete genome	4546245	2856287	2884729	4546245	integrase,tail,capsid,portal,holin,head,terminase	Salmonella_phage(25.93%)	40	2869081:2869095	2887579:2887593
AZQ80728.1|2856287_2856566_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZQ80729.1|2856567_2856939_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZQ80730.1|2856942_2858454_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.4	4.1e-104
AZQ80731.1|2858450_2858636_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AZQ80732.1|2858638_2859184_-	ATP-binding protein	NA	NA	NA	NA	NA
AZQ80733.1|2859180_2859540_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ80734.1|2859544_2859955_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ80735.1|2859926_2860976_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	7.3e-52
AZQ80736.1|2861074_2861482_-|head	head decoration protein	head	NA	NA	NA	NA
AZQ80737.1|2861481_2862072_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ80738.1|2862073_2862940_-	S49 family peptidase	NA	A0A0B4SK12	Proteus_phage	43.2	1.1e-48
AZQ80739.1|2862936_2864571_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	36.0	1.5e-91
AZQ80740.1|2864570_2864834_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AZQ80741.1|2864842_2866969_-|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.7	1.8e-97
AZQ80742.1|2866910_2867474_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ80743.1|2867713_2868352_-	hypothetical protein	NA	NA	NA	NA	NA
AZQ80744.1|2868468_2868975_-	hypothetical protein	NA	NA	NA	NA	NA
2869081:2869095	attL	ATGGTTTTCATGAAG	NA	NA	NA	NA
AZQ80745.1|2869477_2869666_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	100.0	1.5e-24
AZQ80746.1|2869616_2869892_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	47.2	1.5e-12
AZQ80747.1|2869888_2870236_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	79.1	2.3e-39
AZQ80748.1|2870232_2870772_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	97.8	1.3e-100
AZQ82321.1|2870768_2871068_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
AZQ80749.1|2872803_2873382_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.1	9.3e-49
AZQ80750.1|2873395_2874376_-	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	67.5	2.2e-135
AZQ80751.1|2874388_2874766_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	1.9e-47
AZQ80752.1|2874775_2875585_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.7	4.5e-110
AZQ80753.1|2875581_2876496_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	56.3	2.4e-30
AZQ80754.1|2876452_2876665_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
AZQ80755.1|2876902_2877364_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
AZQ80756.1|2877398_2877641_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
AZQ80757.1|2877738_2878434_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	3.5e-87
AZQ80758.1|2878734_2879094_+	hypothetical protein	NA	NA	NA	NA	NA
AZQ80759.1|2879302_2880220_+	hypothetical protein	NA	A0A1W6JP69	Morganella_phage	35.9	5.8e-45
AZQ80760.1|2880309_2880609_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	48.6	1.9e-13
AZQ80761.1|2880608_2881397_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	3.8e-61
AZQ80762.1|2881393_2882470_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	73.5	3.3e-148
AZQ80763.1|2882462_2883206_+	DUF550 domain-containing protein	NA	A0A193GZ33	Enterobacter_phage	61.8	2.2e-42
AZQ80764.1|2883202_2883481_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	46.1	2.3e-13
AZQ80765.1|2883513_2883741_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	3.8e-30
AZQ80766.1|2883742_2884729_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	85.3	6.6e-172
2887579:2887593	attR	ATGGTTTTCATGAAG	NA	NA	NA	NA
>prophage 6
CP034589	Escherichia coli strain L37 chromosome, complete genome	4546245	2968736	2975431	4546245		Enterobacteria_phage(42.86%)	7	NA	NA
AZQ80839.1|2968736_2969129_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	50.0	4.2e-29
AZQ80840.1|2969131_2969689_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.1	8.6e-52
AZQ80841.1|2969690_2970569_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.5e-106
AZQ80842.1|2970619_2971519_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.4	1.5e-29
AZQ80843.1|2971518_2972604_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	4.8e-99
AZQ80844.1|2972999_2973893_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.3	5.6e-45
AZQ80845.1|2974039_2975431_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	30.7	1.4e-18
>prophage 7
CP034589	Escherichia coli strain L37 chromosome, complete genome	4546245	3066089	3075530	4546245		Enterobacteria_phage(85.71%)	10	NA	NA
AZQ80911.1|3066089_3067226_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
AZQ80912.1|3067222_3069223_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
AZQ80913.1|3069347_3069809_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AZQ80914.1|3069848_3070319_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AZQ80915.1|3070365_3071085_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AZQ80916.1|3071081_3072767_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AZQ80917.1|3072988_3073720_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AZQ80918.1|3073779_3073887_+	protein YohO	NA	NA	NA	NA	NA
AZQ80919.1|3073867_3074599_-	ABC transporter permease	NA	NA	NA	NA	NA
AZQ80920.1|3074603_3075530_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
>prophage 8
CP034589	Escherichia coli strain L37 chromosome, complete genome	4546245	3677691	3690874	4546245		Escherichia_phage(50.0%)	12	NA	NA
AZQ81444.1|3677691_3680253_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
AZQ81445.1|3680358_3681015_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
AZQ81446.1|3681065_3681833_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AZQ81447.1|3682028_3682937_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AZQ81448.1|3682933_3684196_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
AZQ81449.1|3684192_3684831_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AZQ81450.1|3684835_3685612_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AZQ81451.1|3685700_3687065_+	permease	NA	NA	NA	NA	NA
AZQ81452.1|3687158_3688151_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AZQ81453.1|3688213_3689353_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AZQ81454.1|3689492_3690119_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AZQ81455.1|3690112_3690874_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 1
CP034590	Escherichia coli strain L37 plasmid pL37-2, complete sequence	145704	17278	92020	145704	integrase,transposase	Escherichia_phage(52.5%)	59	54876:54906	94541:94571
AZQ82371.1|17278_20317_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.5	1.7e-295
AZQ82372.1|21016_22150_-	permease	NA	NA	NA	NA	NA
AZQ82373.1|22255_22579_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZQ82374.1|25027_25270_-	mat domain protein	NA	Q71TG2	Escherichia_phage	98.6	1.2e-29
AZQ82375.1|25458_26019_-	recombinase	NA	Q71TG3	Escherichia_phage	97.8	1.7e-100
AZQ82376.1|26266_26578_-	lysogeny establishment protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	2.8e-44
AZQ82377.1|26628_27660_-	recombinase	NA	Q71TG5	Escherichia_phage	99.4	8.4e-194
AZQ82378.1|27667_27889_-	creatininase	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
AZQ82450.1|28300_28393_+	peptidase	NA	Q38401	Escherichia_phage	100.0	2.3e-07
AZQ82379.1|28525_29506_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.3e-183
AZQ82380.1|29963_30494_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SLP0	Escherichia_phage	100.0	8.6e-102
AZQ82381.1|30490_31087_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	99.5	6.5e-114
AZQ82382.1|31141_31918_-	dimethyl sulfoxide reductase	NA	A0A077SK59	Escherichia_phage	100.0	5.8e-131
AZQ82383.1|31910_32537_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	100.0	2.9e-128
AZQ82451.1|32550_34953_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	83.8	0.0e+00
AZQ82384.1|36082_36178_+	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AZQ82385.1|36143_36353_+	c1 repressor inactivator	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
AZQ82386.1|36463_37315_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
AZQ82387.1|38968_39148_-	PdcA protein	NA	Q71TH5	Escherichia_phage	98.3	6.0e-23
AZQ82388.1|39152_39533_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
AZQ82389.1|39532_39754_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AZQ82390.1|39936_41493_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.1e-104
AZQ82391.1|41489_42728_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	52.5	3.5e-37
AZQ82392.1|42849_45966_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.3	1.1e-26
AZQ82393.1|46232_46739_-	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	99.4	1.4e-93
AZQ82394.1|46811_48074_-	hypothetical protein	NA	Q71TI8	Escherichia_phage	99.8	7.0e-235
AZQ82395.1|48075_48294_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AZQ82396.1|48375_49077_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
AZQ82397.1|49073_49751_-	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
AZQ82398.1|49747_50374_-	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	99.5	1.0e-122
AZQ82399.1|52606_52936_+	hypothetical protein	NA	NA	NA	NA	NA
AZQ82400.1|53004_53145_+	transcriptional regulator	NA	NA	NA	NA	NA
54876:54906	attL	CCGCAGAATTCGGAAAAAATCGTACGCTAAG	NA	NA	NA	NA
AZQ82401.1|56657_57050_+	cysteine hydrolase	NA	NA	NA	NA	NA
AZQ82402.1|57187_58072_+	EamA family transporter	NA	NA	NA	NA	NA
AZQ82403.1|58103_59303_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AZQ82404.1|59381_60035_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZQ82452.1|60066_60324_-	relaxase	NA	NA	NA	NA	NA
AZQ82405.1|62755_63346_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AZQ82406.1|63482_64055_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
AZQ82453.1|64091_65483_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
AZQ82407.1|66262_66919_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
AZQ82408.1|68371_71371_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
AZQ82409.1|72657_73518_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AZQ82410.1|75044_75896_+	replication protein C	NA	NA	NA	NA	NA
AZQ82411.1|76430_77315_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AZQ82412.1|77531_78746_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AZQ82413.1|79129_79834_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZQ82414.1|79824_80004_+	replication initiator protein	NA	NA	NA	NA	NA
AZQ82415.1|80149_80707_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AZQ82416.1|80889_81750_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AZQ82417.1|81980_82817_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AZQ82418.1|82816_83620_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AZQ82419.1|83680_84496_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AZQ82420.1|84825_85002_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AZQ82421.1|85183_86188_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AZQ82422.1|86266_89233_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
AZQ82423.1|89603_90308_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZQ82424.1|90377_90851_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AZQ82425.1|91006_92020_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
94541:94571	attR	CTTAGCGTACGATTTTTTCCGAATTCTGCGG	NA	NA	NA	NA
>prophage 2
CP034590	Escherichia coli strain L37 plasmid pL37-2, complete sequence	145704	117679	130538	145704	plate	Escherichia_phage(58.33%)	12	NA	NA
AZQ82436.1|117679_117835_+	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
AZQ82437.1|119302_119812_-|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	99.4	6.6e-91
AZQ82438.1|119823_120405_-	hypothetical protein	NA	Q71TM4	Escherichia_phage	98.4	9.5e-102
AZQ82439.1|120440_121256_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.2	3.5e-110
AZQ82440.1|121265_122855_-	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	98.5	3.4e-303
AZQ82441.1|122914_124621_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
AZQ82442.1|124845_125847_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AZQ82443.1|125863_127060_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AZQ82444.1|127228_128038_-	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.8	7.1e-156
AZQ82455.1|128330_129215_-	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
AZQ82445.1|129550_129943_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
AZQ82446.1|130118_130538_-	ppfA	NA	A0A1B0VCB0	Salmonella_phage	83.6	2.7e-42
