The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	351	56023	2142780	integrase,protease,tRNA,transposase	Bacillus_phage(22.73%)	57	47956:48015	69133:69212
BBE39227.1|351_612_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	1.1e-09
BBE39228.1|623_1463_+|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	7.1e-50
BBE39229.1|1573_4540_+	fibronectin binding repeat protein	NA	NA	NA	NA	NA
BBE39230.1|4648_5260_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39231.1|5655_8211_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.5	7.8e-39
BBE39232.1|8197_8551_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39233.1|8547_8985_-	arginine repressor	NA	NA	NA	NA	NA
BBE39234.1|9272_10964_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.4	6.4e-74
BBE39235.1|11033_12431_-	ABC transporter ATP-binding protein uup	NA	A0A1B0RXA0	Streptococcus_phage	28.5	7.7e-49
BBE39236.1|12607_13522_-	hypothetical protein	NA	M1Q1P6	Streptococcus_phage	39.8	3.4e-53
BBE39237.1|13534_14452_-	hypothetical protein	NA	M1Q1P6	Streptococcus_phage	34.9	1.1e-46
BBE39238.1|14472_15414_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39239.1|15406_17155_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SJ84	Klosneuvirus	25.7	1.3e-13
BBE39240.1|17490_18780_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
BBE39241.1|19160_19343_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
BBE39242.1|19358_19508_+	50S ribosomal protein L33 1	NA	NA	NA	NA	NA
BBE39243.1|19660_20710_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39244.1|20742_21582_-|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	7.1e-50
BBE39245.1|21593_21854_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	1.1e-09
BBE39246.1|21980_22346_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39247.1|22514_22694_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39248.1|23144_23273_+|transposase	transposase	transposase	NA	NA	NA	NA
BBE39249.1|23340_23631_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	55.1	2.0e-20
BBE39250.1|23666_24446_+|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	49.0	5.4e-68
BBE39251.1|24638_25478_+|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	7.1e-50
BBE39252.1|25982_26825_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39253.1|26906_27227_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39254.1|27308_27812_-	putative Nudix hydrolase NudL	NA	NA	NA	NA	NA
BBE39255.1|27973_28264_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	55.1	2.0e-20
BBE39256.1|28299_29079_+|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	49.0	5.4e-68
BBE39257.1|29348_29675_+	lineage-specific thermal regulator protein	NA	NA	NA	NA	NA
BBE39258.1|29661_30249_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39259.1|30245_31319_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39260.1|31443_33717_-	chromosome partition protein Smc	NA	NA	NA	NA	NA
BBE39261.1|33851_34385_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
BBE39262.1|34381_35881_-|transposase	transposase DDE domain protein	transposase	A0A1X9I5T2	Streptococcus_phage	74.8	1.3e-203
BBE39263.1|36089_36701_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
BBE39264.1|36889_37162_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39265.1|37509_37782_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39266.1|37797_39159_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	63.0	1.1e-153
BBE39267.1|39194_39647_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
BBE39268.1|39643_41620_-	bifunctional oligoribonuclease and PAP phosphatase NrnA	NA	NA	NA	NA	NA
BBE39269.1|41710_43609_-|tRNA	tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG	tRNA	NA	NA	NA	NA
BBE39270.1|43659_44109_-	NUDIX domain protein	NA	NA	NA	NA	NA
BBE39271.1|44322_44931_-	inner membrane protein	NA	NA	NA	NA	NA
BBE39272.1|44962_46084_-|tRNA	tRNA-specific 2-thiouridylase MnmA	tRNA	NA	NA	NA	NA
BBE39273.1|46381_47053_+	L-serine dehydratase, beta chain	NA	NA	NA	NA	NA
BBE39274.1|47064_47937_+	L-serine dehydratase, alpha chain	NA	NA	NA	NA	NA
47956:48015	attL	CCCGCGTTGTAAAATGAAGTGCAACAAAAAAGACATGTTCGTCTGATATACTAGAATTCC	NA	NA	NA	NA
BBE39275.1|48036_49065_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	32.7	3.7e-40
BBE39276.1|49139_49787_+	5'-nucleotidase	NA	NA	NA	NA	NA
BBE39277.1|49849_50464_-	putative transglycosylase IsaA precursor	NA	Q4Z8Z7	Staphylococcus_phage	76.4	5.4e-23
BBE39278.1|50649_51450_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
BBE39279.1|51442_52285_-	energy-coupling factor transporter ATP-binding protein EcfA2	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	4.8e-14
BBE39280.1|52260_53100_-	energy-coupling factor transporter ATP-binding protein EcfA1	NA	G9BWD6	Planktothrix_phage	30.8	1.5e-20
BBE39281.1|53102_53645_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
BBE39282.1|53658_54690_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39283.1|54739_56023_-|protease	putative zinc protease AlbF	protease	A0A0G2Y5U8	Acanthamoeba_polyphaga_mimivirus	30.8	1.2e-16
69133:69212	attR	CCCGCGTTGTAAAATGAAGTGCAACAAAAAAGACATGTTCGTCTGATATACTAGAATTCCCCAATTCAGTATGGAAAGCA	NA	NA	NA	NA
>prophage 2
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	61930	144707	2142780	integrase,protease,tRNA	unidentified_phage(18.52%)	58	93697:93756	144708:144790
BBE39289.1|61930_62953_-|tRNA	tryptophan--tRNA ligase 2	tRNA	NA	NA	NA	NA
BBE39290.1|63377_64250_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39291.1|64328_65948_+	putative ABC transporter ATP-binding protein YheS	NA	A0A2K9L3Z8	Tupanvirus	25.5	5.4e-46
BBE39292.1|66032_68609_+	bacterial membrane protein YfhO	NA	NA	NA	NA	NA
BBE39293.1|69213_70242_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	32.7	3.7e-40
BBE39294.1|70577_71057_-	ribosomal RNA large subunit methyltransferase H	NA	NA	NA	NA	NA
BBE39295.1|71266_72487_+|protease	serine protease Do-like HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.9	2.9e-15
BBE39296.1|72602_73376_+	chromosome-partitioning protein Spo0J	NA	I3NLC2	Bifidobacterium_phage	35.0	4.6e-19
BBE39297.1|73609_74965_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
BBE39298.1|74866_75064_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39299.1|75118_76255_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	25.1	1.1e-24
BBE39300.1|76328_76526_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39301.1|76650_77025_+	hypothetical protein	NA	A0A0A7RUJ5	Clostridium_phage	43.1	9.0e-05
BBE39302.1|77148_78264_+	ribosome-binding ATPase YchF	NA	NA	NA	NA	NA
BBE39303.1|78334_78904_+|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
BBE39304.1|78906_82407_+	transcription-repair-coupling factor	NA	S5MMS1	Bacillus_phage	31.5	5.9e-05
BBE39305.1|82369_83875_+	putative cell division protein YtgP	NA	NA	NA	NA	NA
BBE39306.1|83909_84182_+	heat shock protein 15	NA	NA	NA	NA	NA
BBE39307.1|84168_84540_+	septum formation initiator	NA	NA	NA	NA	NA
BBE39308.1|84539_84662_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39309.1|84674_85961_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39310.1|85957_87244_+|tRNA	tRNA(Ile)-lysidine synthase	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	27.9	2.8e-13
BBE39311.1|87248_87791_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	26.4	5.1e-09
BBE39312.1|87812_89798_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	49.0	6.1e-108
BBE39313.1|89926_91342_+	putative amino acid permease YhdG	NA	NA	NA	NA	NA
BBE39314.1|91465_92491_-|integrase	integrase core domain protein	integrase	H7BVY4	unidentified_phage	32.2	7.2e-36
BBE39315.1|92667_93696_-|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
93697:93756	attL	CTGCTTTCCATACTGAATTGGGGAATTCTAGTATATCAGACGAACATGTCTTTTTTGTTG	NA	NA	NA	NA
BBE39316.1|107519_108734_+	peptidoglycan DL-endopeptidase CwlO precursor	NA	NA	NA	NA	NA
BBE39317.1|108884_109913_-|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE39318.1|110064_111027_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	35.5	1.1e-41
BBE39319.1|111165_112017_+	DNA repair protein RecO	NA	NA	NA	NA	NA
BBE39320.1|112123_113131_+	phosphate acyltransferase	NA	NA	NA	NA	NA
BBE39321.1|113123_113366_+	meromycolate extension acyl carrier protein	NA	NA	NA	NA	NA
BBE39322.1|113531_114242_+	phosphoribosylaminoimidazole-succinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	39.7	5.7e-40
BBE39323.1|114450_118176_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.0	2.6e-35
BBE39324.1|118294_119746_+	amidophosphoribosyltransferase precursor	NA	A0A0M3SGR2	Mollivirus	34.0	7.2e-58
BBE39325.1|119898_120927_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	43.0	2.1e-64
BBE39326.1|120919_121474_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.1	3.8e-23
BBE39327.1|121527_123072_+	bifunctional purine biosynthesis protein PurH	NA	Q58MG4	Prochlorococcus_phage	48.4	3.7e-76
BBE39328.1|123151_124279_-	N-acetylmuramoyl-L-alanine amidase domain-containing protein precursor	NA	F8HGP2	Streptococcus_phage	28.1	4.5e-07
BBE39329.1|124561_125824_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
BBE39330.1|126230_126719_+	N5-carboxyaminoimidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	39.2	1.6e-17
BBE39331.1|126705_127779_+	N5-carboxyaminoimidazole ribonucleotide synthase	NA	NA	NA	NA	NA
BBE39332.1|127789_128518_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39333.1|128555_128708_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39334.1|128778_130071_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.5	1.9e-17
BBE39335.1|130213_131125_+	anaerobic benzoate catabolism transcriptional regulator	NA	NA	NA	NA	NA
BBE39336.1|131211_131307_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39337.1|131359_132358_+	Holliday junction ATP-dependent DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	8.0e-08
BBE39338.1|132492_132927_+	low molecular weight protein-tyrosine-phosphatase YfkJ	NA	NA	NA	NA	NA
BBE39339.1|132952_133354_+	MORN repeat protein	NA	NA	NA	NA	NA
BBE39340.1|133350_135126_+	O-acetyltransferase OatA	NA	A0A1R3Y5Q6	Salmonella_virus	25.7	3.9e-21
BBE39341.1|135446_138089_+	aldehyde-alcohol dehydrogenase	NA	NA	NA	NA	NA
BBE39342.1|138346_139399_+	putative zinc-type alcohol dehydrogenase-like protein YjmD	NA	NA	NA	NA	NA
BBE39343.1|139589_140606_+	alcohol dehydrogenase 1	NA	A0A2K9L339	Tupanvirus	25.1	3.9e-26
BBE39344.1|140796_142281_+	threonine synthase	NA	NA	NA	NA	NA
BBE39345.1|142320_143610_+	multidrug resistance protein NorM	NA	NA	NA	NA	NA
BBE39346.1|143678_144707_-|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
144708:144790	attR	CTGCTTTCCATACTGAATTGGGGAATTCTAGTATATCAGACGAACATGTCTTTTTTGTTGCACTTCATTTTACAACGCGGGAA	NA	NA	NA	NA
>prophage 3
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	160166	210543	2142780	integrase,protease,tRNA,transposase	unidentified_phage(15.38%)	40	167603:167618	178143:178158
BBE39376.1|160166_161150_-|integrase	integrase core domain protein	integrase	H7BVY4	unidentified_phage	31.9	2.6e-35
167603:167618	attL	TAAACCTTGTCTTTTC	NA	NA	NA	NA
BBE39377.1|167737_168013_-	anaerobic benzoate catabolism transcriptional regulator	NA	NA	NA	NA	NA
BBE39378.1|167999_168368_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39379.1|168425_169004_-	tyrosine recombinase XerC	NA	A0A0S2MV79	Bacillus_phage	40.2	6.5e-26
BBE39380.1|169019_169562_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39381.1|169576_169759_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39382.1|170084_170375_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	56.2	2.6e-20
BBE39383.1|170410_171190_+|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	50.0	1.2e-67
BBE39384.1|171230_171974_-|transposase	transposase	transposase	Q9JMN8	Wolbachia_phage	32.0	1.2e-24
BBE39385.1|172508_174830_+	collagen adhesin precursor	NA	NA	NA	NA	NA
BBE39386.1|175008_176037_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE39387.1|176626_177793_+	fluoroquinolones export ATP-binding protein/MT2762	NA	A0A2H4PQG7	Staphylococcus_phage	39.3	5.7e-05
BBE39388.1|178379_178916_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
178143:178158	attR	GAAAAGACAAGGTTTA	NA	NA	NA	NA
BBE39389.1|179050_179950_+	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
BBE39390.1|179965_181174_+	NADH dehydrogenase-like protein	NA	NA	NA	NA	NA
BBE39391.1|181283_182711_+	cytochrome bd ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
BBE39392.1|182711_183731_+	cytochrome bd-I ubiquinol oxidase subunit 2	NA	NA	NA	NA	NA
BBE39393.1|183730_185446_+	ATP-binding/permease protein CydD	NA	W8CYL7	Bacillus_phage	23.2	1.2e-27
BBE39394.1|185445_187191_+	putative ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.9	8.5e-21
BBE39395.1|187255_188236_-	Heptaprenyl diphosphate synthase component 2	NA	NA	NA	NA	NA
BBE39396.1|188490_189342_+	4-diphosphocytidyl-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
BBE39397.1|189410_189854_+	transcriptional repressor AdcR	NA	NA	NA	NA	NA
BBE39398.1|189857_190577_+	high-affinity zinc uptake system ATP-binding protein ZnuC	NA	G9BWD6	Planktothrix_phage	30.3	3.0e-12
BBE39399.1|190569_191382_+	high-affinity zinc uptake system membrane protein ZnuB	NA	NA	NA	NA	NA
BBE39400.1|191430_192687_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	41.1	2.4e-73
BBE39401.1|192793_195094_+	penicillin-binding protein 1F	NA	NA	NA	NA	NA
BBE39402.1|195357_198924_+	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	25.7	1.8e-38
BBE39403.1|199019_202661_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	25.9	6.2e-66
BBE39404.1|202864_203230_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39405.1|203310_204252_+	putative type II secretion system protein E	NA	NA	NA	NA	NA
BBE39406.1|204232_205219_+	type II secretion system protein F	NA	NA	NA	NA	NA
BBE39407.1|205220_205547_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39408.1|205521_205950_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39409.1|205906_206203_+	type II secretory pathway pseudopilin	NA	NA	NA	NA	NA
BBE39410.1|206183_206624_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39411.1|206601_206976_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39412.1|207038_207992_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
BBE39413.1|208050_209247_+	acetate kinase	NA	NA	NA	NA	NA
BBE39414.1|209552_209723_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39415.1|209862_210543_+|protease	CAAX amino terminal protease self-immunity	protease	NA	NA	NA	NA
>prophage 4
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	214158	327965	2142780	integrase,protease,tRNA,transposase	Bacillus_phage(28.57%)	107	230116:230175	309338:309391
BBE39421.1|214158_214785_+|tRNA	phenylalanine--tRNA ligase beta subunit	tRNA	NA	NA	NA	NA
BBE39422.1|214926_215655_-	putative S-adenosyl-L-methionine-dependent methyltransferase	NA	NA	NA	NA	NA
BBE39423.1|215733_216129_+	single-stranded DNA-binding protein ssb	NA	A1EAD1	Streptococcus_phage	47.0	4.4e-26
BBE39424.1|216638_217601_+	ABC transporter substrate binding protein	NA	NA	NA	NA	NA
BBE39425.1|217630_218590_+	ABC transporter substrate binding protein	NA	NA	NA	NA	NA
BBE39426.1|218753_219782_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE39427.1|219793_220504_-|transposase	transposase	transposase	Q9JMN8	Wolbachia_phage	33.3	9.7e-24
BBE39428.1|220807_221611_+	ABC transporter ATP-binding protein YxdL	NA	A0A1V0SE00	Indivirus	25.2	6.2e-11
BBE39429.1|221746_222388_-	deoxyguanosine kinase	NA	C1KFI3	Lactobacillus_virus	49.1	9.0e-53
BBE39430.1|222407_223385_-|tRNA	tRNA-dihydrouridine synthase C	tRNA	NA	NA	NA	NA
BBE39431.1|223371_224244_-	33 kDa chaperonin	NA	NA	NA	NA	NA
BBE39432.1|224551_225781_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39433.1|225869_226865_+|integrase	integrase core domain protein	integrase	H7BVY4	unidentified_phage	31.9	2.6e-35
BBE39434.1|226900_227311_+	Cna protein B-type domain protein	NA	NA	NA	NA	NA
BBE39435.1|227399_228323_+	Cna protein B-type domain protein	NA	NA	NA	NA	NA
BBE39436.1|228324_229242_+	sortase family protein	NA	NA	NA	NA	NA
BBE39437.1|229198_230050_+	sortase family protein	NA	NA	NA	NA	NA
230116:230175	attL	TCACAAGTTGTCAAGTCAAGTGCAACCAGTTCATAGATAACTAGAGTTCCAGAGGTTAAG	NA	NA	NA	NA
BBE39438.1|230170_231199_-|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
230116:230175	attL	TCACAAGTTGTCAAGTCAAGTGCAACCAGTTCATAGATAACTAGAGTTCCAGAGGTTAAG	NA	NA	NA	NA
BBE39439.1|231297_232137_-|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	7.1e-50
BBE39440.1|232148_232409_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	1.1e-09
BBE39441.1|232535_233081_+	Cna protein B-type domain protein	NA	NA	NA	NA	NA
BBE39442.1|233091_233931_-|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	7.1e-50
BBE39443.1|233942_234203_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	8.4e-10
BBE39444.1|234275_235535_+	Cna protein B-type domain protein	NA	NA	NA	NA	NA
BBE39445.1|235726_236386_+	sortase family protein	NA	NA	NA	NA	NA
BBE39446.1|236369_237227_+	sortase family protein	NA	NA	NA	NA	NA
BBE39447.1|237287_242465_+	bone sialoprotein-binding protein precursor	NA	NA	NA	NA	NA
BBE39448.1|242869_244276_+	short-chain fatty acids transporter	NA	NA	NA	NA	NA
BBE39449.1|244356_245268_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
BBE39450.1|245383_246568_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
BBE39451.1|246579_247239_+	acetate CoA-transferase subunit alpha	NA	NA	NA	NA	NA
BBE39452.1|247241_247889_+	butyrate--acetoacetate CoA-transferase subunit B	NA	NA	NA	NA	NA
BBE39453.1|248083_248761_-	YheO-like PAS domain protein	NA	NA	NA	NA	NA
BBE39454.1|248938_249298_+	enamine/imine deaminase	NA	NA	NA	NA	NA
BBE39455.1|249335_249863_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39456.1|250161_251424_-	toxic anion resistance protein	NA	M1PLC8	Streptococcus_phage	68.1	3.2e-147
BBE39457.1|251436_252318_-	hypothetical protein	NA	M1PFV6	Streptococcus_phage	34.7	2.9e-25
BBE39458.1|252631_253660_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE39459.1|253925_255218_+	adenylosuccinate synthetase	NA	G5CQQ4	Megavirus	36.5	1.5e-70
BBE39460.1|255538_256582_+	membrane lipoprotein TmpC precursor	NA	NA	NA	NA	NA
BBE39461.1|256784_257558_-	4-hydroxyphenylacetate decarboxylase activating enzyme	NA	H6W830	Escherichia_phage	32.0	6.4e-05
BBE39462.1|257682_258429_+	glucitol operon repressor	NA	NA	NA	NA	NA
BBE39463.1|258485_259424_+	sorbitol operon regulator	NA	NA	NA	NA	NA
BBE39464.1|259703_260024_+	N,N'-diacetylchitobiose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
BBE39465.1|260051_260360_+	lichenan-specific phosphotransferase enzyme IIB component	NA	NA	NA	NA	NA
BBE39466.1|260369_261674_+	lichenan permease IIC component	NA	NA	NA	NA	NA
BBE39467.1|261949_264367_+	benzylsuccinate synthase alpha subunit	NA	Q66LZ4	Escherichia_phage	52.8	3.6e-09
BBE39468.1|264381_265050_+	fructose-6-phosphate aldolase 1	NA	E3SKN5	Synechococcus_phage	34.7	2.2e-25
BBE39469.1|265106_266195_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
BBE39470.1|266272_266659_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	58.0	3.5e-28
BBE39471.1|266678_266783_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39472.1|266854_267508_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39473.1|267614_268640_+	microcin C7 self-immunity protein MccF	NA	NA	NA	NA	NA
BBE39474.1|268779_270078_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39475.1|270273_270762_+|tRNA	prolyl-tRNA editing protein ProX	tRNA	NA	NA	NA	NA
BBE39476.1|270901_271153_-	helix-turn-helix protein	NA	NA	NA	NA	NA
BBE39477.1|271130_271649_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39478.1|271809_272556_-|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	37.3	7.8e-32
BBE39479.1|272660_273500_-|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	7.1e-50
BBE39480.1|273511_273772_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	1.1e-09
BBE39481.1|273792_274065_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39482.1|274269_275040_+	M protein, serotype 5 precursor	NA	NA	NA	NA	NA
BBE39483.1|275269_275461_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39484.1|275530_276559_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE39485.1|276881_279143_+	chromosome partition protein Smc	NA	NA	NA	NA	NA
276555:277723	attR	CTTAACCTCTGGAACTCTAGTTATCTATGAACTGGTTGCACTTGACTTGACAACTTGTGATTTGTTAGAAATAAAGGAGACTTAGATAGTTTAAAAGATTTTATTAACTTATATGAGACAGATTTGTTAAGTTTTTATAAACATGGTCATAATTATGACTTTGGCTGTTTTATTTATGGTATAGGAAATGACGGAAAAGATAAGTTCCGTGATAGATGGTTTAAAGAAGGAGTCATTTTCTATTGAAATTTAAAAAAGATGAACCAAATTTACATTAAAGTATTATAATAATTTCAATAAAGGAAGTTACAGAAAGGGGAACTACTTATGAAACAAGCAAAAGTATTAACAGGAATTGCAGTCGCAGCTTTATCTACAGGCACAGGTCTTGTGCAGGCAGATGATTTATCAAACACACGACCAGCTAAAGCAGCTGAAGTTGTGACACATACTGAAGTGACAGAAAATCAAGTAGCTGACGCTAAAGCAAAAGCTGATGAGGCAACGAAAGCCGTTAAGGATCAGGAAGCTACGGTTAAGGCTATTGAGGCAGAAAAATCTCAAGCACAACAATCTTTAGTTAATGCGACAACAGCAGTTAATGATACCGAAAAGTTAGCCAGTGAAGCAACGCCAGAAGGTCTAACAAAAGCCCAAGAAGAGGCTGAGGCTAGTCAAAGCGCTGTTACTGATGCACAAGCACAACTTGAAGCAGCTCAAGATGCTGAATCAAAAGCCCAAACAGCAGTTGATCATCAAAAAGAAACAGTCGCCAAAGCGTCTCAAGCAGTTGTTGAGAAAGAAGCTACAGTGACAAGTGCTACTCAAGCTGTTAATCAAGCCAAAGCAGCTCTCACGACAAGTAATCAAGTAGTTGACGTTAGTGCAGCGGAAGAAAAAGTGTTAGAGGCTCAAGAAGCGGTTACGAAAGCAGAAACACAAGTTTCTCAGGCTCAGGAAGCAGATGCAAAACATGAGTCTGATGTAAGCCATGCTAAAGAAGAGCTTGACCTTAAGTCTCAAAAATTAACAGAAAAACAAACAACTCTAGAACAAGTCATGGCTGCGATTGAAGCAGAGCGTCTTACTAAGTCGGTTGAAAATGGCACTTACTTTAACCAAAGAGATAACGAGTGGCAAAAAGCTTATGGTAATCAAACCTTTGCGGC	NA	NA	NA	NA
BBE39486.1|279312_282108_+	agglutinin receptor precursor	NA	NA	NA	NA	NA
276555:277723	attR	CTTAACCTCTGGAACTCTAGTTATCTATGAACTGGTTGCACTTGACTTGACAACTTGTGATTTGTTAGAAATAAAGGAGACTTAGATAGTTTAAAAGATTTTATTAACTTATATGAGACAGATTTGTTAAGTTTTTATAAACATGGTCATAATTATGACTTTGGCTGTTTTATTTATGGTATAGGAAATGACGGAAAAGATAAGTTCCGTGATAGATGGTTTAAAGAAGGAGTCATTTTCTATTGAAATTTAAAAAAGATGAACCAAATTTACATTAAAGTATTATAATAATTTCAATAAAGGAAGTTACAGAAAGGGGAACTACTTATGAAACAAGCAAAAGTATTAACAGGAATTGCAGTCGCAGCTTTATCTACAGGCACAGGTCTTGTGCAGGCAGATGATTTATCAAACACACGACCAGCTAAAGCAGCTGAAGTTGTGACACATACTGAAGTGACAGAAAATCAAGTAGCTGACGCTAAAGCAAAAGCTGATGAGGCAACGAAAGCCGTTAAGGATCAGGAAGCTACGGTTAAGGCTATTGAGGCAGAAAAATCTCAAGCACAACAATCTTTAGTTAATGCGACAACAGCAGTTAATGATACCGAAAAGTTAGCCAGTGAAGCAACGCCAGAAGGTCTAACAAAAGCCCAAGAAGAGGCTGAGGCTAGTCAAAGCGCTGTTACTGATGCACAAGCACAACTTGAAGCAGCTCAAGATGCTGAATCAAAAGCCCAAACAGCAGTTGATCATCAAAAAGAAACAGTCGCCAAAGCGTCTCAAGCAGTTGTTGAGAAAGAAGCTACAGTGACAAGTGCTACTCAAGCTGTTAATCAAGCCAAAGCAGCTCTCACGACAAGTAATCAAGTAGTTGACGTTAGTGCAGCGGAAGAAAAAGTGTTAGAGGCTCAAGAAGCGGTTACGAAAGCAGAAACACAAGTTTCTCAGGCTCAGGAAGCAGATGCAAAACATGAGTCTGATGTAAGCCATGCTAAAGAAGAGCTTGACCTTAAGTCTCAAAAATTAACAGAAAAACAAACAACTCTAGAACAAGTCATGGCTGCGATTGAAGCAGAGCGTCTTACTAAGTCGGTTGAAAATGGCACTTACTTTAACCAAAGAGATAACGAGTGGCAAAAAGCTTATGGTAATCAAACCTTTGCGGC	NA	NA	NA	NA
BBE39487.1|282338_283253_+	CHAP domain protein	NA	NA	NA	NA	NA
BBE39488.1|283249_283807_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39489.1|283831_284569_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39490.1|285589_286879_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	46.2	1.8e-97
BBE39491.1|286911_287478_-	aminodeoxychorismate/anthranilate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	42.4	1.0e-31
BBE39492.1|287510_289268_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	28.8	3.3e-33
BBE39493.1|289452_291426_-	6-aminohexanoate-cyclic-dimer hydrolase	NA	NA	NA	NA	NA
BBE39494.1|291598_292069_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39495.1|292070_292415_+	ASCH domain protein	NA	NA	NA	NA	NA
BBE39496.1|292426_292867_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
BBE39497.1|292961_293903_+	ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
BBE39498.1|293913_294672_+	ribosomal RNA small subunit methyltransferase E	NA	NA	NA	NA	NA
BBE39499.1|294838_295846_+	HTH-type transcriptional regulator MalR	NA	NA	NA	NA	NA
BBE39500.1|296115_298302_+	PTS system glucose-specific EIICBA component	NA	NA	NA	NA	NA
BBE39501.1|298380_299202_+	maltose 6'-phosphate phosphatase	NA	NA	NA	NA	NA
BBE39502.1|299308_300346_-	glutamyl aminopeptidase	NA	NA	NA	NA	NA
BBE39503.1|300416_300971_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39504.1|300974_301742_-	pyrimidine-specific ribonucleoside hydrolase RihB	NA	NA	NA	NA	NA
BBE39505.1|302174_302636_-	putative NrdI-like protein	NA	NA	NA	NA	NA
BBE39506.1|303045_303741_+	capsule synthesis positive regulator AcpB	NA	NA	NA	NA	NA
BBE39507.1|303792_304632_-|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	7.1e-50
BBE39508.1|304643_304904_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	1.1e-09
BBE39509.1|304924_305197_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39510.1|305401_306901_+	immunoglobulin G-binding protein H precursor	NA	NA	NA	NA	NA
BBE39511.1|307176_307956_-|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	50.4	2.4e-68
BBE39512.1|307991_308291_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	53.3	2.2e-14
BBE39513.1|308308_309337_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE39514.1|309356_310115_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase precursor	NA	NA	NA	NA	NA
BBE39515.1|310369_312589_+	bifunctional (p)ppGpp synthase/hydrolase RelA	NA	U5J9N6	Bacillus_phage	39.1	3.7e-13
BBE39516.1|312602_313046_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
BBE39517.1|313273_314122_+	leucine-rich protein	NA	NA	NA	NA	NA
BBE39518.1|314715_315849_+	trehalose import ATP-binding protein SugC	NA	G9BWD6	Planktothrix_phage	31.8	2.1e-20
BBE39519.1|315930_317550_+	glucan 1,6-alpha-glucosidase	NA	NA	NA	NA	NA
BBE39520.1|317737_321361_+	pullulanase precursor	NA	NA	NA	NA	NA
BBE39521.1|321513_321804_-	hypothetical protein	NA	Q938I9	Temperate_phage	48.6	5.9e-12
BBE39522.1|321959_322223_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39523.1|322416_322776_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
BBE39524.1|323004_323754_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.2	1.5e-22
BBE39525.1|323766_324561_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
BBE39526.1|324658_325918_+|protease	regulator of sigma-W protease RasP	protease	NA	NA	NA	NA
BBE39527.1|326108_327965_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 5
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	346762	402614	2142780	integrase,holin,protease,tRNA	unidentified_phage(16.67%)	51	365331:365347	403738:403754
BBE39544.1|346762_348106_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	33.1	8.5e-53
BBE39545.1|348098_348500_+	mini-ribonuclease 3	NA	NA	NA	NA	NA
BBE39546.1|348616_349636_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39547.1|350058_350844_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39548.1|350891_351638_+|tRNA	putative TrmH family tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
BBE39549.1|351818_352160_+	YacP-like NYN domain protein	NA	NA	NA	NA	NA
BBE39550.1|352258_353119_+	fatty acid-binding protein	NA	A0A0N9SI50	Staphylococcus_phage	32.8	2.2e-09
BBE39551.1|353253_353952_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39552.1|353948_354155_+	hypothetical protein	NA	A0A1V0E021	Clostridioides_phage	56.1	3.0e-10
BBE39553.1|354258_355287_-|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE39554.1|355549_355996_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
BBE39555.1|356016_356409_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
BBE39556.1|356870_358820_+	putative licABCH operon regulator	NA	NA	NA	NA	NA
BBE39557.1|358821_359280_+	heat-responsive suppressor HrsA	NA	NA	NA	NA	NA
BBE39558.1|359289_360630_+	galactitol permease IIC component	NA	NA	NA	NA	NA
BBE39559.1|360626_360980_+	galactitol-specific phosphotransferase enzyme IIB component	NA	NA	NA	NA	NA
BBE39560.1|360966_361743_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
BBE39561.1|361742_362420_+	triosephosphate isomerase	NA	NA	NA	NA	NA
BBE39562.1|362431_362953_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39563.1|363198_364014_+	putative phosphatase YwpJ	NA	NA	NA	NA	NA
365331:365347	attL	AGATAGGCTTTCCCTTC	NA	NA	NA	NA
BBE39564.1|369581_370064_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39565.1|370296_371646_-	aspartokinase 3	NA	NA	NA	NA	NA
BBE39566.1|371791_372541_+|tRNA	tRNA pseudouridine synthase A	tRNA	NA	NA	NA	NA
BBE39567.1|372530_373298_+	pyridoxine kinase	NA	NA	NA	NA	NA
BBE39568.1|373284_373758_+	thiamine precursor transporter HmpT	NA	NA	NA	NA	NA
BBE39569.1|373768_374332_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39570.1|374394_375240_-	putative MscS family protein YkuT	NA	NA	NA	NA	NA
BBE39571.1|375626_377030_+	alpha-amylase precursor	NA	NA	NA	NA	NA
BBE39572.1|377285_378659_+	alpha-amylase precursor	NA	NA	NA	NA	NA
BBE39573.1|378866_380150_+	trigger factor	NA	NA	NA	NA	NA
BBE39574.1|380363_380942_+	putative DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
BBE39575.1|381224_382829_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.4	2.1e-138
BBE39576.1|382907_384665_+	sensor histidine kinase YehU	NA	Q9EYF3	Enterobacteria_phage	31.4	4.3e-65
BBE39577.1|384661_385390_+	sensory transduction protein LytR	NA	NA	NA	NA	NA
BBE39578.1|385521_385971_+|holin	antiholin-like protein LrgA	holin	NA	NA	NA	NA
BBE39579.1|385988_386696_+|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
BBE39580.1|386855_387782_+	esterase	NA	NA	NA	NA	NA
BBE39581.1|389681_390563_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
BBE39582.1|390620_391229_-|integrase	integrase core domain protein	integrase	A0A1B1P773	Bacillus_phage	52.5	6.7e-50
BBE39583.1|391438_392002_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39584.1|392541_393570_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE39585.1|393747_393936_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
BBE39586.1|394089_394455_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39587.1|394454_396119_+	DAK2 domain protein	NA	NA	NA	NA	NA
BBE39588.1|396354_397245_+|protease	FtsH protease regulator HflK	protease	A0A1V0SL90	Klosneuvirus	35.6	2.3e-38
BBE39589.1|397381_397498_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39590.1|397662_398271_-|integrase	integrase core domain protein	integrase	A0A1B1P773	Bacillus_phage	52.5	6.7e-50
BBE39591.1|398480_399044_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39592.1|399107_399848_-	octopine permease ATP-binding protein P	NA	G9BWD6	Planktothrix_phage	39.3	8.3e-26
BBE39593.1|399840_401409_-	glutamine transport system permease protein GlnP	NA	NA	NA	NA	NA
BBE39594.1|401618_402614_+|integrase	integrase core domain protein	integrase	A0A2K9V2S9	Faecalibacterium_phage	32.2	9.1e-36
403738:403754	attR	GAAGGGAAAGCCTATCT	NA	NA	NA	NA
>prophage 6
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	478873	489812	2142780	integrase,tRNA	uncultured_Mediterranean_phage(28.57%)	14	471463:471477	497696:497710
471463:471477	attL	CAATCAGATGATCAG	NA	NA	NA	NA
BBE39661.1|478873_479860_+	dITP/XTP pyrophosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	31.6	8.5e-10
BBE39662.1|479838_480360_+	phosphodiesterase	NA	NA	NA	NA	NA
BBE39663.1|480356_480818_+	CBS domain-containing protein YkuL	NA	NA	NA	NA	NA
BBE39664.1|480824_481571_+	tyrosine recombinase XerD-like protein	NA	NA	NA	NA	NA
BBE39665.1|481570_482278_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	21.9	5.3e-06
BBE39666.1|482274_482838_+	segregation and condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.3	3.2e-14
BBE39667.1|482950_483673_+	ribosomal large subunit pseudouridine synthase B	NA	NA	NA	NA	NA
BBE39668.1|483669_483921_+	putative membrane protein insertion efficiency factor	NA	A0A2H4PQM5	Staphylococcus_phage	52.5	9.9e-16
BBE39669.1|483982_485011_-|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE39670.1|485194_486211_+|integrase	integrase core domain protein	integrase	H7BVY4	unidentified_phage	32.2	7.1e-36
BBE39671.1|486374_486920_+|tRNA	putative tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
BBE39672.1|487475_488039_+	riboflavin transporter RibU	NA	NA	NA	NA	NA
BBE39673.1|488043_488694_+	putative undecaprenyl-diphosphatase YbjG	NA	NA	NA	NA	NA
BBE39674.1|488828_489812_+|tRNA	(dimethylallyl)adenosine tRNA methylthiotransferase MiaB	tRNA	A0A2H4PQV5	Staphylococcus_phage	49.6	9.0e-36
497696:497710	attR	CAATCAGATGATCAG	NA	NA	NA	NA
>prophage 7
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	509508	520931	2142780		Streptococcus_phage(84.62%)	18	NA	NA
BBE39695.1|509508_510273_+	lipopolysaccharide export system ATP-binding protein LptB	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	9.5e-17
BBE39696.1|510272_510983_+	high-affinity branched-chain amino acid transport ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	28.4	3.0e-17
BBE39697.1|511027_511690_+	inosine 5'-monophosphate dehydrogenase	NA	M1NSC5	Streptococcus_phage	57.4	7.1e-61
BBE39698.1|511776_512412_+	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	66.3	1.8e-69
BBE39699.1|512427_513300_+	DNA polymerase III subunit tau	NA	M1NSC1	Streptococcus_phage	42.1	4.1e-56
BBE39700.1|513296_514097_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39701.1|514089_514413_+	initiation-control protein YabA	NA	M1PFV3	Streptococcus_phage	64.2	7.0e-30
BBE39702.1|514417_515281_+	ribosomal RNA small subunit methyltransferase I	NA	M1PLC5	Streptococcus_phage	76.4	2.4e-117
BBE39703.1|515307_515700_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39704.1|515746_516376_-	CutC-like protein	NA	NA	NA	NA	NA
BBE39705.1|516492_516819_+	phosphoserine aminotransferase	NA	M1Q1P2	Streptococcus_phage	66.0	8.9e-33
BBE39706.1|516806_517583_+	phosphoserine aminotransferase	NA	M1Q1P2	Streptococcus_phage	62.3	6.1e-88
BBE39707.1|517608_518160_+	acetyltransferase (GNAT) family protein	NA	M1PSC3	Streptococcus_phage	54.1	2.7e-50
BBE39708.1|518228_518726_+	methylated-DNA--protein-cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	52.9	3.0e-40
BBE39709.1|518722_519079_+	regulatory protein MgsR	NA	M1PLC0	Streptococcus_phage	63.2	1.6e-38
BBE39710.1|519129_519552_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39711.1|519553_519943_-	glyoxalase-like domain protein	NA	NA	NA	NA	NA
BBE39712.1|520103_520931_-	exodeoxyribonuclease	NA	M1PSC0	Streptococcus_phage	79.1	6.4e-128
>prophage 8
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	591717	799699	2142780	portal,terminase,capsid,transposase,integrase,tail,protease,head,holin,tRNA	Streptococcus_phage(29.03%)	195	629220:629235	804622:805786
BBE39779.1|591717_594519_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.7	1.1e-89
BBE39780.1|594932_595235_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39781.1|595288_595741_-	CTP pyrophosphohydrolase	NA	NA	NA	NA	NA
BBE39782.1|595858_598150_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpE	protease	A0A223W0B1	Agrobacterium_phage	39.3	2.2e-125
BBE39783.1|598448_598679_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39784.1|598806_599493_+	arginine transport system permease protein ArtQ	NA	NA	NA	NA	NA
BBE39785.1|599492_600227_+	glutamine transport ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.1	7.4e-35
BBE39786.1|600427_600904_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
BBE39787.1|600900_603060_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
BBE39788.1|603059_603209_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39789.1|603295_604324_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE39790.1|604578_606003_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SCV6	Indivirus	30.8	1.5e-60
BBE39791.1|606156_607851_+	phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	42.9	7.0e-129
BBE39792.1|608067_608922_+	bifunctional protein FolD protein	NA	A0A249XZQ2	Enterococcus_phage	39.0	5.8e-39
BBE39793.1|608918_609767_+	ADP-dependent (S)-NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
BBE39794.1|609917_611258_+	exodeoxyribonuclease 7 large subunit	NA	L7RDW5	Acanthamoeba_polyphaga_moumouvirus	32.6	6.5e-37
BBE39795.1|611235_611451_+	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
BBE39796.1|611450_612323_+	farnesyl diphosphate synthase	NA	NA	NA	NA	NA
BBE39797.1|612315_613143_+	hemolysin A	NA	NA	NA	NA	NA
BBE39798.1|613129_613600_+	arginine repressor	NA	NA	NA	NA	NA
BBE39799.1|613618_615280_+	DNA repair protein RecN	NA	NA	NA	NA	NA
BBE39800.1|615486_616404_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39801.1|616622_617462_+	DegV domain-containing protein/M5005_Spy1226	NA	A0A0N9SI50	Staphylococcus_phage	36.9	2.6e-12
BBE39802.1|617520_618297_+	spore germination lipase LipC	NA	NA	NA	NA	NA
BBE39803.1|618274_618862_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39804.1|618960_619236_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.0	2.0e-25
BBE39805.1|619432_620623_-	enterobactin exporter EntS	NA	NA	NA	NA	NA
BBE39806.1|620692_621565_-	helix-turn-helix domain protein	NA	NA	NA	NA	NA
BBE39807.1|621781_623644_+	zinc-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	33.7	6.6e-88
BBE39808.1|623945_624881_-	putative dihydroorotate dehydrogenase A	NA	A0A1V0SH91	Hokovirus	44.5	3.3e-64
BBE39809.1|625048_626077_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE39810.1|626297_626993_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
BBE39811.1|627102_627624_+	transcription repressor NadR	NA	NA	NA	NA	NA
BBE39812.1|627725_628268_+	niacin transporter NiaX	NA	NA	NA	NA	NA
BBE39813.1|628394_629165_+	putative formate transporter 1	NA	NA	NA	NA	NA
629220:629235	attL	ATTTGTGATAAAATAA	NA	NA	NA	NA
BBE39814.1|629271_631326_+	penicillin-binding protein 2B	NA	NA	NA	NA	NA
629220:629235	attL	ATTTGTGATAAAATAA	NA	NA	NA	NA
BBE39815.1|631337_631934_+	recombination protein RecR	NA	NA	NA	NA	NA
BBE39816.1|632097_633144_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
BBE39817.1|633349_634717_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
BBE39818.1|635134_635512_+	integral membrane protein	NA	NA	NA	NA	NA
BBE39819.1|635759_637304_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	29.1	9.8e-37
BBE39820.1|637431_637815_+	hypothetical protein	NA	A6N235	Microbacterium_phage	42.1	7.3e-10
BBE39821.1|638023_638758_+	methionine import ATP-binding protein MetN	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	4.8e-18
BBE39822.1|638750_639413_+	D-methionine transport system permease protein MetI	NA	NA	NA	NA	NA
BBE39823.1|639436_640267_+	methionine-binding lipoprotein MetQ precursor	NA	NA	NA	NA	NA
BBE39824.1|640495_642115_+	DEAD-box ATP-dependent RNA helicase CshA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.5	1.9e-59
BBE39825.1|642241_644242_+	low affinity potassium transport system protein kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.2	7.1e-64
BBE39826.1|644265_644544_-	GIY-YIG nuclease superfamily protein	NA	NA	NA	NA	NA
BBE39827.1|644533_645388_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
BBE39828.1|645427_646168_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
BBE39829.1|646493_647156_+	ComE operon protein 1	NA	NA	NA	NA	NA
BBE39830.1|647136_648822_+	Competence protein	NA	NA	NA	NA	NA
BBE39831.1|648946_649582_+	hypothetical protein	NA	Q6DMY1	Streptococcus_phage	95.3	1.5e-113
BBE39832.1|649663_649816_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39833.1|649890_650730_-|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	7.1e-50
BBE39834.1|650837_651128_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	56.2	2.6e-20
BBE39835.1|651163_651943_+|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	50.0	1.2e-67
BBE39836.1|652136_652394_+	hypothetical protein	NA	D0R0D7	Streptococcus_phage	96.5	2.5e-38
BBE39837.1|652393_652732_+|head,tail	phage head-tail joining protein	head,tail	A0A1X9I694	Streptococcus_phage	98.2	2.4e-57
BBE39838.1|652724_653093_+	hypothetical protein	NA	A0A1X9I688	Streptococcus_phage	91.0	2.2e-48
BBE39839.1|653099_653426_+	hypothetical protein	NA	E4ZFM8	Streptococcus_phage	99.1	3.4e-56
BBE39840.1|653427_653997_+	hypothetical protein	NA	E4ZFM9	Streptococcus_phage	98.9	2.2e-103
BBE39841.1|654008_654428_+	hypothetical protein	NA	D0R0E2	Streptococcus_phage	100.0	2.1e-71
BBE39842.1|654610_657469_+	chromosome partition protein Smc	NA	A0A1B0RXL6	Streptococcus_phage	94.3	2.8e-215
BBE39843.1|657465_658191_+	hypothetical protein	NA	M1Q107	Streptococcus_phage	59.8	4.7e-82
BBE39844.1|658190_661106_+	hypothetical protein	NA	Q6DMT0	Streptococcus_phage	64.2	0.0e+00
BBE39845.1|661118_662975_+	hypothetical protein	NA	Q6DMS9	Streptococcus_phage	73.4	1.1e-257
BBE39846.1|662992_663397_+|holin	holin family protein	holin	D0R0E9	Streptococcus_phage	75.6	3.9e-46
BBE39847.1|663398_664868_+	membrane-bound lytic murein transglycosylase D	NA	A0A1B0RXL4	Streptococcus_phage	90.6	5.5e-255
BBE39848.1|664974_665136_+	hypothetical protein	NA	M1PSL4	Streptococcus_phage	88.7	3.0e-18
BBE39849.1|665193_666429_+	transposon gamma-delta resolvase	NA	M1NSJ1	Streptococcus_phage	96.1	1.8e-230
BBE39850.1|666428_667991_+	transposon Tn3 resolvase	NA	Q6DMS5	Streptococcus_phage	72.1	2.6e-215
BBE39851.1|668064_668679_+	cadmium resistance transporter	NA	NA	NA	NA	NA
BBE39852.1|668969_669809_-|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	7.1e-50
BBE39853.1|669820_670081_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	1.1e-09
BBE39854.1|670556_671138_+	ComEC family competence protein	NA	M1PSD2	Streptococcus_phage	59.2	2.7e-56
BBE39855.1|671218_672265_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
BBE39856.1|672354_672960_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	54.2	9.3e-60
BBE39857.1|673117_674179_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
BBE39858.1|674298_675519_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39859.1|675523_676552_-|tRNA	S-adenosylmethionine:tRNA ribosyltransferase-isomerase	tRNA	NA	NA	NA	NA
BBE39860.1|676750_677464_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
BBE39861.1|677567_678284_+	ribosomal small subunit pseudouridine synthase A	NA	NA	NA	NA	NA
BBE39862.1|678375_679536_+	putative cyanate transporter	NA	NA	NA	NA	NA
BBE39863.1|679650_680610_+	competence protein CoiA-like family protein	NA	NA	NA	NA	NA
BBE39864.1|680620_682423_+	oligoendopeptidase F, plasmid	NA	NA	NA	NA	NA
BBE39865.1|682609_683164_+	NADPH azoreductase	NA	NA	NA	NA	NA
BBE39866.1|683286_683829_+	acetyltransferase (GNAT) family protein	NA	NA	NA	NA	NA
BBE39867.1|683828_684452_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
BBE39868.1|684786_685998_+	putative MFS-type transporter YhjX	NA	NA	NA	NA	NA
BBE39869.1|686085_686757_+	putative O-methyltransferase/MSMEI_4947	NA	NA	NA	NA	NA
BBE39870.1|686819_687887_+	foldase protein PrsA precursor	NA	NA	NA	NA	NA
BBE39871.1|688271_690890_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.2	1.3e-62
BBE39872.1|691049_691604_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39873.1|691603_691819_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39874.1|691815_692577_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39875.1|692595_693291_+|protease	CAAX amino terminal protease self-immunity	protease	NA	NA	NA	NA
BBE39876.1|693325_694723_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
BBE39877.1|694661_695621_-	ribonucleoside-diphosphate reductase subunit beta nrdF1	NA	A0A096XT60	Enterococcus_phage	70.5	2.6e-128
BBE39878.1|695779_697939_-	ribonucleoside-diphosphate reductase subunit alpha 2	NA	A8E2R1	Enterococcus_phage	62.6	9.2e-259
BBE39879.1|697958_698177_-	glutaredoxin-like protein NrdH	NA	A0A249XUR7	Enterococcus_phage	50.7	6.2e-14
BBE39880.1|698560_698824_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
BBE39881.1|698828_700562_+	phosphoenolpyruvate-protein phosphotransferase	NA	NA	NA	NA	NA
BBE39882.1|700728_702156_+	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
BBE39883.1|702241_703528_+	peptidoglycan-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
BBE39884.1|703805_704891_-	putative DEAD-box ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.6	4.9e-35
BBE39885.1|704988_705615_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.7	1.3e-35
BBE39886.1|705675_705948_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39887.1|705992_706808_-	hypothetical protein	NA	NA	NA	NA	NA
BBE39888.1|706938_707445_+	free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
BBE39889.1|707444_709124_+	DNA polymerase III subunit tau	NA	A0A1U9WR94	Streptococcus_virus	41.2	4.6e-48
BBE39890.1|709518_710460_-	bifunctional ligase/repressor BirA	NA	NA	NA	NA	NA
BBE39891.1|710593_711622_-|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE39892.1|711813_714180_+	internalin-A precursor	NA	NA	NA	NA	NA
BBE39893.1|714673_715870_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	66.9	9.6e-141
BBE39894.1|715907_716930_-|integrase	integrase core domain protein	integrase	H7BVY4	unidentified_phage	32.2	7.1e-36
BBE39895.1|717143_718403_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase 2	NA	NA	NA	NA	NA
717092:717107	attR	ATTTGTGATAAAATAA	NA	NA	NA	NA
BBE39896.1|718409_719864_-|transposase	transposase DDE domain protein	transposase	A0A1X9I5T2	Streptococcus_phage	74.8	1.3e-203
717092:717107	attR	ATTTGTGATAAAATAA	NA	NA	NA	NA
BBE39897.1|720304_721849_+	putative symporter YjmB	NA	NA	NA	NA	NA
BBE39898.1|722001_723030_+	2-dehydro-3-deoxygluconokinase	NA	NA	NA	NA	NA
BBE39899.1|723052_724843_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	44.8	1.3e-136
BBE39900.1|724884_725556_+	putative L-lactate dehydrogenase operon regulatory protein	NA	NA	NA	NA	NA
BBE39901.1|725684_726302_+	KHG/KDPG aldolase	NA	NA	NA	NA	NA
BBE39902.1|726331_727729_+	uronate isomerase	NA	NA	NA	NA	NA
BBE39903.1|727823_728918_+	mannonate dehydratase	NA	NA	NA	NA	NA
BBE39904.1|728932_729772_+	putative oxidoreductase	NA	NA	NA	NA	NA
BBE39905.1|730040_730844_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
BBE39906.1|730900_731929_-|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE39907.1|732137_733928_+	beta-N-acetylglucosaminidase/beta-glucosidase	NA	NA	NA	NA	NA
BBE39908.1|734223_734340_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39909.1|734894_736016_+	immunoglobulin G-binding protein G precursor	NA	NA	NA	NA	NA
BBE39910.1|736263_736818_+	ribosomal-protein-L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
BBE39911.1|736810_738094_+	cobalt-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
BBE39912.1|738110_738971_+	methionine aminopeptidase 1	NA	NA	NA	NA	NA
BBE39913.1|738972_739929_+	ribonuclease BN-like family protein	NA	NA	NA	NA	NA
BBE39914.1|740027_741320_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
BBE39915.1|741312_741804_+	shikimate kinase	NA	NA	NA	NA	NA
BBE39916.1|742034_743519_+	regulatory protein MsrR	NA	NA	NA	NA	NA
BBE39917.1|743605_744964_+	putative RNA methyltransferase	NA	D0R096	Streptococcus_phage	89.8	3.5e-232
BBE39918.1|745653_747456_+	type I restriction enzyme EcoKI M protein	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	24.6	8.8e-05
BBE39919.1|747477_748989_+	type I restriction enzyme EcoKI M protein	NA	A0A220A2U4	Liberibacter_phage	30.5	4.7e-52
BBE39920.1|748933_749524_+	EcoKI restriction-modification system protein HsdS	NA	NA	NA	NA	NA
BBE39921.1|749520_749919_-	type I restriction modification DNA specificity domain protein	NA	NA	NA	NA	NA
BBE39922.1|750156_751149_+	tyrosine recombinase XerD	NA	A0A2H4JAA2	uncultured_Caudovirales_phage	29.2	2.9e-34
BBE39923.1|751160_752342_+	putative type-1 restriction enzyme specificity protein MG438	NA	NA	NA	NA	NA
BBE39924.1|752391_753225_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39925.1|753226_753727_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39926.1|753755_756773_+	type-1 restriction enzyme R protein	NA	A0A220A398	Liberibacter_phage	25.0	3.7e-64
BBE39927.1|756832_758668_+	hypothetical protein	NA	A0A1X9I6C7	Streptococcus_phage	31.4	2.1e-78
BBE39928.1|759071_759677_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
BBE39929.1|759772_759982_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39930.1|759974_760289_+	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	47.1	2.5e-16
BBE39931.1|760288_761440_+	PD-(D/E)XK nuclease superfamily protein	NA	M1Q218	Streptococcus_phage	62.9	7.1e-133
BBE39932.1|761429_761972_+	hypothetical protein	NA	A0A2K5B2A9	Erysipelothrix_phage	81.7	2.3e-81
BBE39933.1|762030_763971_+	DNA polymerase I, thermostable	NA	A0A2K5B2B0	Erysipelothrix_phage	67.8	1.0e-264
BBE39934.1|764113_764896_+	hypothetical protein	NA	A0A1Q1PVU2	Staphylococcus_phage	54.7	8.6e-74
BBE39935.1|764888_765233_+	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	51.4	8.2e-29
BBE39936.1|765225_767469_+	hypothetical protein	NA	A0A1B0RXC5	Streptococcus_phage	48.6	6.1e-205
BBE39937.1|767605_767815_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39938.1|767811_768099_+	VRR-NUC domain protein	NA	A0A1B0RXC4	Streptococcus_phage	64.4	9.3e-26
BBE39939.1|768095_769448_+	RNA polymerase-associated protein RapA	NA	A0A2K5B273	Erysipelothrix_phage	71.1	2.2e-162
BBE39940.1|769447_769861_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39941.1|770014_770380_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	56.0	3.8e-32
BBE39942.1|770426_771089_+|terminase	phage terminase, small subunit	terminase	A0A2K5B277	Erysipelothrix_phage	52.3	5.4e-53
BBE39943.1|771093_771876_+	S-adenosylmethionine synthase	NA	NA	NA	NA	NA
BBE39944.1|771875_772478_+	hypothetical protein	NA	A0A0B5HE03	Vibrio_phage	37.6	8.5e-13
BBE39945.1|772467_773706_+	DNA adenine methyltransferase YhdJ	NA	A0A2I4R670	Erysipelothrix_phage	60.8	4.0e-142
BBE39946.1|773698_775285_+	putative BsuMI modification methylase subunit YdiP	NA	A0A2K9V3X0	Faecalibacterium_phage	63.5	4.8e-31
BBE39947.1|775373_775757_+	hypothetical protein	NA	A0A2K5B281	Erysipelothrix_phage	55.1	3.1e-16
BBE39948.1|775936_776113_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39949.1|776173_777772_+	phage Terminase	NA	A0A2K5B285	Erysipelothrix_phage	84.6	6.5e-270
BBE39950.1|777848_778412_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39951.1|778470_779832_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	74.5	3.1e-180
BBE39952.1|779884_780481_+|protease	ATP-dependent Clp protease proteolytic subunit 1	protease	A0A1X9I749	Streptococcus_phage	55.3	4.6e-51
BBE39953.1|780484_781702_+|capsid	phage capsid family protein	capsid	A0A2I4R671	Erysipelothrix_phage	48.3	2.8e-103
BBE39954.1|781712_782024_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	74.0	4.8e-36
BBE39955.1|782020_782359_+|head,tail	phage head-tail joining protein	head,tail	NA	NA	NA	NA
BBE39956.1|782351_782783_+	hypothetical protein	NA	A0A2K5B292	Erysipelothrix_phage	58.0	3.8e-39
BBE39957.1|782779_783118_+	hypothetical protein	NA	A0A2K5B293	Erysipelothrix_phage	51.4	6.9e-28
BBE39958.1|783119_783710_+	hypothetical protein	NA	A0A2K5B294	Erysipelothrix_phage	71.6	2.4e-76
BBE39959.1|783719_784103_+	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	65.0	1.4e-37
BBE39960.1|784308_785886_+	hypothetical protein	NA	A0A1B1IM39	Lactococcus_phage	62.4	7.3e-64
BBE39961.1|786019_787693_+	hypothetical protein	NA	A0A1P8BMU5	Lactococcus_phage	74.6	2.6e-19
BBE39962.1|787766_788288_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39963.1|788356_789049_+|tail	phage tail protein	tail	A0A1L2BYA2	Clostridium_phage	26.3	3.3e-16
BBE39964.1|789045_793098_+	hypothetical protein	NA	A0A1B1P770	Bacillus_phage	39.1	1.2e-86
BBE39965.1|793110_793272_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39966.1|793258_793678_+	hypothetical protein	NA	A0A1S5RCP5	Lactobacillus_phage	29.8	7.8e-05
BBE39967.1|793723_794140_+|holin	holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	57.0	2.0e-37
BBE39968.1|794129_795050_+	N-acetyl-anhydromuranmyl-L-alanine amidase	NA	A0A1D8ETE4	Propionibacterium_phage	41.1	3.8e-28
BBE39969.1|795326_795515_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39970.1|795574_796747_+	hypothetical protein	NA	A0A2K5B2B2	Erysipelothrix_phage	50.8	2.2e-105
BBE39971.1|796794_797322_+	hypothetical protein	NA	NA	NA	NA	NA
BBE39972.1|797918_798758_+	methionine-binding lipoprotein MetQ precursor	NA	NA	NA	NA	NA
BBE39973.1|798904_799699_+	purine nucleoside phosphorylase DeoD-type	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	84.1	2.6e-78
804622:805786	attR	TCACAAGTTGTCAAGTCAAGTGCAACCAGTTCATAGATAACTAGAGTTCCAGAGGTTAAGCTGTTCGGGCTAGCTCAAACAGGAATGTTGAGGATTGATATTGAAGAAGTCGTCTTGGGCGCTCATTGATGGCAGTAATATAATTGTCAAGTTCTTCAGAGGTTAGTGAATTAAGTGAGACTCCTTTAGGGACATATTCTCTGAGGAGGCCATTGAAGTTCTCGTTTGTTCCTCTCTCATGTGAAGAATAGGGATGTGCAAAGTAAACGTCAACAGCTTCTAGGTTTGAGAGCAAACTAAACTCAGAACCATTATCCGCTGTGATGGATGCAATAGGATACTGACTGATGAGATGCGTGACAGCACGGTTAATGGTTTGGGACTGCTTGTCTTCTAGCTTAACTCCTAGTGCATAGCGTGTCTGGCGCTCTACCAAAGTCAACATAACAGCTTCACCTTTGGTTTTCTTGCCGAGAACCAAATCAATCTCCCAATGCCCAAATTCAGAACGATCATTAATATATTCTGGACGTTCTTCGATAGATTTACCTAAAGTCTTCTTATTCGTTTTCATGACTTTCTTAGAACGTTTTCTGATACTAACCATCTTAGGCAAATCGATTGGTTTAATAGCTAACAACCCCTCTTTGATATAACGATAAATCGTTTTGGTAGAGGGGACGACTTCTTCAGGATGGTTTACTTTGTAAGTCTGAACAAAACTATCCACACTATGGAGACGAATGTTGGCCGTCAAGGCAGATTCTAATTGTGCAATGAACCTAGCGGAGCAGCCATTCAATTTGAGGTAAGAACTCTTTTGACGATTGGTTTCATAGACACGTTGTCCACTATCAGCGAAATAGGTGTTGAAGAAGGTTTGTTTTCCATTCTTATCCTTTACCTGATCTACTGAACCACGTTTTATTTCTCGGCAGATTGTAGAACGGTGACGCCCTAGAAGTCGAGCAATCTCAACGGGTTTCTTTCCCATTTTAAGATAAGCAGCAATTTCACCCCGTTCTGTGGCTGAAAGATGAGAATAGGATGATTTTCTGGTAGAATTAATATTAGACATGTTCATCTGCTTTCCATACTGAATTGGGGAATTCTAGTATATCAGACGAACATGTCTTTTTTGTTGCACTTCATTTTACAACGCGGG	NA	NA	NA	NA
>prophage 9
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	823950	873503	2142780	integrase,protease,tRNA,transposase	Bacillus_phage(18.75%)	56	869685:869698	873666:873679
BBE39997.1|823950_824979_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE39998.1|825067_826327_+	maltose/maltodextrin-binding protein precursor	NA	NA	NA	NA	NA
BBE39999.1|826491_828195_+	cyclomaltodextrinase	NA	NA	NA	NA	NA
BBE40000.1|828317_829622_+	maltose transport system permease protein MalF	NA	NA	NA	NA	NA
BBE40001.1|829621_830044_+	maltose transporter permease	NA	NA	NA	NA	NA
BBE40002.1|829988_830483_+	maltose transport system permease protein MalG	NA	NA	NA	NA	NA
BBE40003.1|830564_831332_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40004.1|831406_832204_-	putative HTH-type transcriptional repressor ExuR	NA	NA	NA	NA	NA
BBE40005.1|832376_833213_-	inner membrane ABC transporter permease protein YcjP	NA	NA	NA	NA	NA
BBE40006.1|833212_834574_-	maltose transport system permease protein MalF	NA	NA	NA	NA	NA
BBE40007.1|834854_836108_-	maltose/maltodextrin-binding protein precursor	NA	NA	NA	NA	NA
BBE40008.1|836352_837372_+	HTH-type transcriptional regulator MalR	NA	NA	NA	NA	NA
BBE40009.1|837490_838987_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
BBE40010.1|839017_841282_+	glycogen phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
BBE40011.1|841522_842077_+	NADPH azoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.0	6.4e-15
BBE40012.1|842141_842444_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40013.1|842638_843625_+	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
BBE40014.1|843940_844549_+	glutathione S-transferase GST-4.5	NA	NA	NA	NA	NA
BBE40015.1|844731_845649_+	C4-dicarboxylate transporter/malic acid transport protein	NA	NA	NA	NA	NA
BBE40016.1|845754_845931_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40017.1|846063_846948_+|tRNA	tRNA dimethylallyltransferase	tRNA	NA	NA	NA	NA
BBE40018.1|847035_848205_+	GTPase HflX	NA	NA	NA	NA	NA
BBE40019.1|848270_848906_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40020.1|848920_849850_+	ribonuclease Z	NA	NA	NA	NA	NA
BBE40021.1|849849_850614_+	putative oxidoreductase	NA	NA	NA	NA	NA
BBE40022.1|850610_852818_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.5	1.6e-72
BBE40023.1|852951_853470_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.7	7.8e-31
BBE40024.1|853687_854371_+	DNA replication protein DnaD	NA	Q938N2	Temperate_phage	35.6	6.5e-09
BBE40025.1|854367_855024_+	ultraviolet N-glycosylase/AP lyase	NA	NA	NA	NA	NA
BBE40026.1|855095_855782_+|tRNA	tRNA (adenine(22)-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
BBE40027.1|855771_856560_+	putative GTP cyclohydrolase 1 type 2	NA	NA	NA	NA	NA
BBE40028.1|856577_857399_+	zinc transporter ZupT	NA	NA	NA	NA	NA
BBE40029.1|857408_858515_+	glycine oxidase	NA	NA	NA	NA	NA
BBE40030.1|858573_859443_+	glucose-1-phosphate thymidylyltransferase 1	NA	K7QKA7	Escherichia_phage	64.2	9.2e-101
BBE40031.1|859442_860036_+	putative dTDP-4-dehydrorhamnose 3,5-epimerase	NA	NA	NA	NA	NA
BBE40032.1|860279_861323_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.6	1.9e-68
BBE40033.1|861511_862237_+|protease	CAAX amino terminal protease self-immunity	protease	NA	NA	NA	NA
BBE40034.1|862327_862519_-	hypothetical protein	NA	W6LMT3	Streptococcus_phage	60.7	3.7e-15
BBE40035.1|862714_863194_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
BBE40036.1|863243_864425_+	pheromone autoinducer 2 transporter	NA	NA	NA	NA	NA
BBE40037.1|864414_865662_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
BBE40038.1|865724_867377_-	hypothetical protein	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	39.0	2.3e-07
BBE40039.1|867554_867926_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40040.1|867938_868130_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40041.1|868087_868843_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40042.1|869124_869304_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40043.1|869300_869564_+	hypothetical protein	NA	A0A0A8WI22	Clostridium_phage	45.8	3.4e-14
BBE40044.1|869541_869709_+	hypothetical protein	NA	NA	NA	NA	NA
869685:869698	attL	AAATTATTTTGAGT	NA	NA	NA	NA
BBE40045.1|869718_870000_+	antitoxin PezA	NA	A0A1P8VVN6	Streptococcus_phage	55.9	2.9e-08
BBE40046.1|870020_870281_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	1.1e-09
BBE40047.1|870292_871132_+|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	7.1e-50
BBE40048.1|871203_871506_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40049.1|871545_872082_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40050.1|872106_872334_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40051.1|872397_872688_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	55.1	2.0e-20
BBE40052.1|872723_873503_+|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	49.0	5.4e-68
873666:873679	attR	AAATTATTTTGAGT	NA	NA	NA	NA
>prophage 10
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	1044208	1088602	2142780	integrase,tRNA,transposase	Streptococcus_phage(67.86%)	47	1063032:1063047	1096029:1096044
BBE40215.1|1044208_1045474_-	HTH-type transcriptional regulator NorG	NA	A0A1X9I5H2	Streptococcus_phage	48.3	4.0e-105
BBE40216.1|1045563_1046412_+	pyridoxamine kinase	NA	NA	NA	NA	NA
BBE40217.1|1046408_1046969_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40218.1|1047170_1048388_-|transposase	transposase from transposon Tn916	transposase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
BBE40219.1|1048469_1048673_-	excisionase from transposon Tn916	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
BBE40220.1|1049133_1049364_-	helix-turn-helix domain protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
BBE40221.1|1049360_1049783_-	RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
BBE40222.1|1050287_1050641_+	anaerobic benzoate catabolism transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
BBE40223.1|1050986_1052027_-	tetracycline resistance protein TetM from transposon TnFO1	NA	A0A1S5SF82	Streptococcus_phage	100.0	9.4e-201
BBE40224.1|1052038_1052905_-	tetracycline resistance protein TetM	NA	A0A1S5SF82	Streptococcus_phage	100.0	2.7e-145
BBE40225.1|1053281_1054196_-	conjugative transposon protein TcpC	NA	A0A1S5SF22	Streptococcus_phage	100.0	1.1e-168
BBE40226.1|1054210_1055212_-	putative endopeptidase p60 precursor	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
BBE40227.1|1055208_1057320_-	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	99.9	0.0e+00
BBE40228.1|1057388_1059836_-	AAA-like domain protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
BBE40229.1|1059819_1060326_-	TcpE family protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
BBE40230.1|1060300_1060798_-	antirestriction protein	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
BBE40231.1|1060914_1061136_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
BBE40232.1|1061178_1062384_-	replication initiation factor	NA	A0A1S5SEX3	Streptococcus_phage	98.3	4.7e-228
BBE40233.1|1062560_1062998_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40234.1|1063003_1064389_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	94.2	4.0e-247
1063032:1063047	attL	GATGGCTTTTTTGTGT	NA	NA	NA	NA
BBE40235.1|1064417_1064801_-	hypothetical protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	2.3e-64
BBE40236.1|1064819_1065134_-	hypothetical protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
BBE40237.1|1065656_1066658_+	streptokinase C precursor	NA	NA	NA	NA	NA
BBE40238.1|1066713_1066974_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	1.1e-09
BBE40239.1|1066985_1067825_+|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	7.1e-50
BBE40240.1|1068230_1069775_+	putative ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.6	7.0e-51
BBE40241.1|1070103_1070310_+	CsbD-like protein	NA	NA	NA	NA	NA
BBE40242.1|1070318_1070438_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40243.1|1070446_1070896_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40244.1|1070975_1071887_-	diacylglycerol kinase	NA	NA	NA	NA	NA
BBE40245.1|1072004_1072655_-	hemolysin-III related	NA	NA	NA	NA	NA
BBE40246.1|1072651_1073092_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40247.1|1073278_1073668_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40248.1|1073823_1074084_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	1.1e-09
BBE40249.1|1074095_1074935_+|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	5.5e-50
BBE40250.1|1075623_1076472_+	ribosome biogenesis GTPase A	NA	NA	NA	NA	NA
BBE40251.1|1076461_1077232_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	8.6e-26
BBE40252.1|1077338_1078181_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40253.1|1078281_1080414_+	DNA topoisomerase 1	NA	A0A1V0SCS0	Indivirus	35.5	3.6e-98
BBE40254.1|1080493_1081378_-	HTH-type transcriptional regulator CynR	NA	NA	NA	NA	NA
BBE40255.1|1081569_1082628_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40256.1|1082642_1083635_+	D-lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	34.1	8.5e-42
BBE40257.1|1083739_1084405_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40258.1|1084397_1085114_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40259.1|1085264_1086611_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil-5-)- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
BBE40260.1|1086788_1088171_+	methylmalonyl-CoA carboxyltransferase 5S subunit	NA	NA	NA	NA	NA
BBE40261.1|1088239_1088602_-|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	52.7	3.3e-28
1096029:1096044	attR	ACACAAAAAAGCCATC	NA	NA	NA	NA
>prophage 11
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	1209046	1257286	2142780	integrase,protease,tRNA	Bacillus_phage(35.29%)	43	1233859:1233874	1262973:1262988
BBE40382.1|1209046_1210075_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE40383.1|1210484_1212584_+|protease	putative ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.2	1.8e-118
BBE40384.1|1212640_1212856_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40385.1|1212897_1213383_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40386.1|1213550_1214579_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	9.7e-41
BBE40387.1|1214690_1215290_-	putative GTP-binding protein EngB	NA	NA	NA	NA	NA
BBE40388.1|1215299_1216529_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.5	4.6e-138
BBE40389.1|1216644_1216815_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40390.1|1216834_1217332_-	dihydrofolate reductase	NA	A0A0A8JB64	Ralstonia_phage	27.6	3.2e-13
BBE40391.1|1217412_1218252_-	thymidylate synthase	NA	U5J9N5	Bacillus_phage	53.2	4.1e-82
BBE40392.1|1218469_1219651_+	polyketide biosynthesis 3-hydroxy-3-methylglutaryl-ACP synthase PksG	NA	NA	NA	NA	NA
BBE40393.1|1219640_1220909_+	3-hydroxy-3-methylglutaryl-coenzyme A reductase	NA	NA	NA	NA	NA
BBE40394.1|1221097_1222627_+	M protein trans-acting positive regulator (MGA) PRD domain protein	NA	NA	NA	NA	NA
BBE40395.1|1222773_1223766_-	isopentenyl-diphosphate delta-isomerase	NA	NA	NA	NA	NA
BBE40396.1|1223752_1224766_-	mevalonate kinase	NA	NA	NA	NA	NA
BBE40397.1|1224758_1225703_-	homoserine kinase	NA	NA	NA	NA	NA
BBE40398.1|1225684_1226563_-	galactokinase	NA	NA	NA	NA	NA
BBE40399.1|1226767_1228069_-	putative multidrug resistance ABC transporter ATP-binding/permease protein YheH	NA	W8CYL7	Bacillus_phage	28.8	1.9e-33
BBE40400.1|1228019_1228433_-	lipid transporter ATP-binding/permease protein	NA	NA	NA	NA	NA
BBE40401.1|1228434_1230156_-	putative multidrug resistance ABC transporter ATP-binding/permease protein YheI	NA	W8CYL7	Bacillus_phage	26.4	1.9e-36
BBE40402.1|1230617_1232642_+	endonuclease YhcR precursor	NA	NA	NA	NA	NA
BBE40403.1|1232829_1233240_-	peptide deformylase 2	NA	NA	NA	NA	NA
BBE40404.1|1233364_1234714_-	NAD(P)-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
1233859:1233874	attL	CTTCTTTGATTTGCTT	NA	NA	NA	NA
BBE40405.1|1234904_1236677_-	putative ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.9	1.2e-49
BBE40406.1|1236676_1238422_-	putative ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	4.1e-39
BBE40407.1|1238529_1240407_-	putative ABC transporter ATP-binding protein YjjK	NA	A0A2K9L3Z8	Tupanvirus	31.8	6.7e-64
BBE40408.1|1240403_1241612_-	CCA-adding enzyme	NA	H7BUW3	unidentified_phage	45.0	9.0e-38
BBE40409.1|1241731_1242580_-	DegV domain-containing protein	NA	NA	NA	NA	NA
BBE40410.1|1242579_1242960_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40411.1|1243030_1243552_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40412.1|1243602_1244310_-	muramidase-2 precursor	NA	S5M633	Brevibacillus_phage	41.1	2.5e-11
BBE40413.1|1244469_1245069_-	N-acetylmuramoyl-L-alanine amidase domain-containing protein precursor	NA	Q332B8	Clostridium_botulinum_C_phage	31.8	2.0e-09
BBE40414.1|1245163_1247110_-	PTS system fructose-specific EIIABC component	NA	NA	NA	NA	NA
BBE40415.1|1247106_1248018_-	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
BBE40416.1|1248014_1248728_-	lactose phosphotransferase system repressor	NA	NA	NA	NA	NA
BBE40417.1|1248962_1249886_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
BBE40418.1|1249898_1250957_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40419.1|1251145_1252138_-	ferredoxin--NADP reductase 2	NA	Q9JRK7	Streptococcus_phage	54.9	3.7e-29
BBE40420.1|1252137_1252869_-|tRNA	tRNA (guanine-N(1)-)-methyltransferase	tRNA	NA	NA	NA	NA
BBE40421.1|1252858_1253377_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
BBE40422.1|1253738_1255196_-	Cna protein B-type domain protein	NA	NA	NA	NA	NA
BBE40423.1|1255319_1256348_-|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE40424.1|1256446_1257286_-|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	7.1e-50
1262973:1262988	attR	CTTCTTTGATTTGCTT	NA	NA	NA	NA
>prophage 12
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	1316875	1537060	2142780	portal,terminase,capsid,tail,integrase,transposase,protease,head,tRNA	Streptococcus_phage(37.14%)	231	1319834:1319893	1544502:1545665
BBE40482.1|1316875_1317292_-|integrase	integrase core domain protein	integrase	A0A1B1P773	Bacillus_phage	52.0	3.1e-30
BBE40483.1|1317519_1317681_+|transposase	transposase	transposase	NA	NA	NA	NA
BBE40484.1|1317852_1318614_+|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	49.6	1.9e-62
BBE40485.1|1318906_1319470_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40486.1|1319547_1319724_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
1319834:1319893	attL	TTCCCGCGTTGTAAAATGAAGTGCAACAAAAAAGACATGTTCGTCTGATATACTAGAATT	NA	NA	NA	NA
BBE40487.1|1319916_1320945_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	2.8e-40
1319834:1319893	attL	TTCCCGCGTTGTAAAATGAAGTGCAACAAAAAAGACATGTTCGTCTGATATACTAGAATT	NA	NA	NA	NA
BBE40488.1|1320960_1321803_-	arginine-binding extracellular protein ArtP precursor	NA	NA	NA	NA	NA
BBE40489.1|1321871_1322987_-	capreomycidine synthase	NA	NA	NA	NA	NA
BBE40490.1|1323147_1326780_-	ATP-dependent helicase/nuclease subunit A	NA	G3MA40	Bacillus_virus	26.1	3.8e-23
BBE40491.1|1326776_1330001_-	ATP-dependent helicase/deoxyribonuclease subunit B	NA	NA	NA	NA	NA
BBE40492.1|1330175_1331102_+	putative neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	37.0	1.0e-33
BBE40493.1|1331197_1331866_-	putative ABC transporter ATP-binding protein/MT1014	NA	G9BWD6	Planktothrix_phage	36.7	1.3e-30
BBE40494.1|1331875_1332952_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
BBE40495.1|1333024_1333411_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40496.1|1333403_1333781_-	OsmC-like protein	NA	NA	NA	NA	NA
BBE40497.1|1333893_1336299_-|tRNA	phenylalanine--tRNA ligase beta subunit	tRNA	NA	NA	NA	NA
BBE40498.1|1336508_1337552_-|tRNA	phenylalanine--tRNA ligase alpha subunit	tRNA	A0A2K9L3A8	Tupanvirus	33.9	1.0e-29
BBE40499.1|1337834_1338701_-	DNA-entry nuclease	NA	NA	NA	NA	NA
BBE40500.1|1338736_1338925_-	DNA-directed RNA polymerase subunit beta	NA	NA	NA	NA	NA
BBE40501.1|1338928_1340200_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase 1	NA	NA	NA	NA	NA
BBE40502.1|1340264_1340489_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40503.1|1340829_1341246_-	ATP synthase epsilon chain	NA	NA	NA	NA	NA
BBE40504.1|1341258_1342665_-	ATP synthase subunit beta	NA	NA	NA	NA	NA
BBE40505.1|1342827_1343703_-	ATP synthase gamma chain	NA	NA	NA	NA	NA
BBE40506.1|1343721_1345227_-	ATP synthase subunit alpha	NA	NA	NA	NA	NA
BBE40507.1|1345242_1345779_-	ATP synthase subunit delta	NA	NA	NA	NA	NA
BBE40508.1|1345778_1346273_-	ATP synthase subunit b	NA	NA	NA	NA	NA
BBE40509.1|1346290_1347007_-	ATP synthase subunit a	NA	NA	NA	NA	NA
BBE40510.1|1347041_1347239_-	ATP synthase subunit c	NA	NA	NA	NA	NA
BBE40511.1|1347503_1348943_-	glycogen synthase	NA	NA	NA	NA	NA
BBE40512.1|1348939_1350073_-	glycogen biosynthesis protein GlgD	NA	NA	NA	NA	NA
BBE40513.1|1350062_1351202_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
BBE40514.1|1351328_1353209_-	1,4-alpha-glucan branching enzyme GlgB	NA	NA	NA	NA	NA
BBE40515.1|1353315_1355619_-	pullulanase	NA	NA	NA	NA	NA
BBE40516.1|1355624_1356647_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	2.7e-19
BBE40517.1|1356659_1358618_-	DNA ligase	NA	A0A0A8J9A9	Ralstonia_phage	33.1	1.3e-94
BBE40518.1|1358763_1359267_-	queuosine precursor transporter QueT	NA	E7DN70	Pneumococcus_phage	36.1	6.5e-06
BBE40519.1|1359597_1360755_-	endonuclease/Exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
BBE40520.1|1360739_1362422_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40521.1|1362777_1363896_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
BBE40522.1|1363892_1365020_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
BBE40523.1|1365028_1365952_-	daunorubicin/doxorubicin resistance ATP-binding protein DrrA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	36.6	1.0e-33
BBE40524.1|1365972_1366659_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40525.1|1366655_1367330_-|protease	CAAX amino terminal protease self-immunity	protease	NA	NA	NA	NA
BBE40526.1|1367304_1368663_-	YcaO-like family protein	NA	NA	NA	NA	NA
BBE40527.1|1368675_1369740_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40528.1|1369736_1370687_-	nitroreductase family protein	NA	NA	NA	NA	NA
BBE40529.1|1371131_1371392_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	1.1e-09
BBE40530.1|1371403_1372243_+|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	7.1e-50
BBE40531.1|1372341_1373370_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE40532.1|1373568_1374195_-	hypothetical protein	NA	A0A1P8VVL4	Streptococcus_phage	57.9	2.5e-31
BBE40533.1|1374515_1374989_-|transposase	transposase IS200 like protein	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	34.2	2.2e-11
BBE40534.1|1375178_1375469_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	56.2	2.6e-20
BBE40535.1|1375504_1375954_+	hypothetical protein	NA	A0A0C5AEB1	Paenibacillus_phage	47.9	5.2e-31
BBE40536.1|1375922_1376285_+|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	52.7	3.3e-28
BBE40537.1|1376403_1377858_+|transposase	transposase DDE domain protein	transposase	A0A1X9I5T2	Streptococcus_phage	74.8	1.3e-203
BBE40538.1|1377985_1379293_-	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	96.3	6.4e-239
BBE40539.1|1379517_1379973_+	hypothetical protein	NA	W6LLD2	Streptococcus_phage	39.3	3.9e-18
BBE40540.1|1380052_1380667_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
BBE40541.1|1380798_1382523_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
BBE40542.1|1382871_1384824_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	45.9	2.6e-143
BBE40543.1|1384824_1385394_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
BBE40544.1|1385486_1386698_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
BBE40545.1|1387252_1387453_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40546.1|1387454_1388060_+	AP2 domain protein	NA	K9L513	Pectobacterium_phage	26.4	6.1e-11
BBE40547.1|1388061_1388277_+	hypothetical protein	NA	B3GW25	Streptococcus_phage	54.4	3.7e-11
BBE40548.1|1388345_1388585_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40549.1|1388975_1389935_-	Abi-like protein	NA	A0A059NT88	Lactococcus_phage	38.8	2.8e-58
BBE40550.1|1390365_1390464_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40551.1|1390750_1391947_-	exo-glucosaminidase LytG precursor	NA	A7J2B5	Streptococcus_phage	83.0	2.2e-198
BBE40552.1|1391943_1392057_-	hypothetical protein	NA	A7J2B4	Streptococcus_phage	77.1	7.1e-06
BBE40553.1|1392069_1392444_-	Holin family protein	NA	A0A097QQ04	Enterococcus_phage	53.8	5.3e-29
BBE40554.1|1392452_1392611_-	hypothetical protein	NA	A0A1X9I5T1	Streptococcus_phage	52.3	1.2e-06
BBE40555.1|1392673_1393078_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40556.1|1393175_1393610_-	hypothetical protein	NA	Q938J8	Temperate_phage	82.9	1.2e-56
BBE40557.1|1393618_1395295_-	gp58-like protein	NA	Q938J9	Temperate_phage	68.6	6.1e-125
BBE40558.1|1395306_1395681_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40559.1|1395685_1397296_-	hypothetical protein	NA	A3F657	Streptococcus_phage	82.3	1.5e-32
BBE40560.1|1397292_1399440_-	hypothetical protein	NA	Q938K1	Temperate_phage	90.7	0.0e+00
BBE40561.1|1399436_1400144_-|tail	phage tail protein	tail	Q938K2	Temperate_phage	71.9	4.7e-95
BBE40562.1|1400143_1404067_-|tail	phage-related minor tail protein	tail	J7KDT4	Streptococcus_phage	53.1	2.0e-248
BBE40563.1|1404079_1404247_-	hypothetical protein	NA	J7KBS0	Streptococcus_phage	89.1	2.2e-19
BBE40564.1|1404276_1404603_-	hypothetical protein	NA	J7KK85	Streptococcus_phage	79.6	3.1e-41
BBE40565.1|1404710_1405256_-	hypothetical protein	NA	J7KKC8	Streptococcus_phage	78.7	2.6e-77
BBE40566.1|1405274_1405700_-	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	85.1	5.0e-68
BBE40567.1|1405696_1406074_-	hypothetical protein	NA	J7KDM3	Streptococcus_phage	75.2	1.9e-47
BBE40568.1|1406070_1406403_-|head,tail	phage head-tail joining protein	head,tail	J7KJ42	Streptococcus_phage	86.4	4.8e-50
BBE40569.1|1406414_1406717_-|head,tail	phage gp6-like head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	87.8	4.0e-43
BBE40570.1|1406861_1408049_-|capsid	phage capsid family protein	capsid	J7KJ82	Streptococcus_phage	75.2	2.7e-159
BBE40571.1|1408073_1408739_-|protease	ATP-dependent Clp protease proteolytic subunit 1	protease	M1Q115	Streptococcus_phage	77.7	2.1e-92
BBE40572.1|1408716_1409937_-|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.7	2.0e-186
BBE40573.1|1409970_1410237_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	79.5	2.9e-29
BBE40574.1|1410229_1410400_-	hypothetical protein	NA	J7KK43	Streptococcus_phage	56.2	3.3e-07
BBE40575.1|1410396_1412151_-	phage Terminase	NA	J7KKD1	Streptococcus_phage	98.6	0.0e+00
BBE40576.1|1412165_1412633_-|terminase	phage terminase, small subunit	terminase	J7KC46	Streptococcus_phage	97.4	2.5e-81
BBE40577.1|1412803_1413142_-	HNH endonuclease	NA	J7KH36	Streptococcus_phage	94.4	1.2e-56
BBE40578.1|1413242_1413428_+	YcfA-like protein	NA	F0PIL1	Enterococcus_phage	58.1	8.7e-09
BBE40579.1|1413479_1413857_+	hypothetical protein	NA	I3NLB2	Bifidobacterium_phage	41.3	3.0e-16
BBE40580.1|1413921_1414794_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40581.1|1415348_1415786_-	hypothetical protein	NA	A0A097PBF1	Streptococcus_pyogenes_phage	99.3	1.4e-76
BBE40582.1|1416289_1416385_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40583.1|1416381_1416624_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40584.1|1416646_1416856_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40585.1|1416892_1417279_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40586.1|1417434_1417647_-	hypothetical protein	NA	A0A140HLV8	Bacillus_phage	73.3	2.4e-10
BBE40587.1|1417643_1417892_-	hypothetical protein	NA	Q938M4	Temperate_phage	91.4	2.5e-35
BBE40588.1|1417888_1418245_-	hypothetical protein	NA	A0A1P8VVP9	Streptococcus_phage	87.3	8.5e-53
BBE40589.1|1418241_1418682_-	endodeoxyribonuclease RUS	NA	A0A097PAS0	Streptococcus_pyogenes_phage	95.9	3.6e-77
BBE40590.1|1418694_1418925_-	hypothetical protein	NA	Q938M6	Temperate_phage	83.0	5.9e-15
BBE40591.1|1418921_1419458_-	NUMOD4 motif protein	NA	A0A1W6JNF8	Staphylococcus_phage	62.3	1.8e-51
BBE40592.1|1419467_1419887_-	single-stranded DNA-binding protein ssb	NA	Q938M7	Temperate_phage	92.1	2.7e-66
BBE40593.1|1419879_1420554_-	ERF superfamily protein	NA	Q938M8	Temperate_phage	83.5	8.2e-97
BBE40594.1|1420554_1421037_-	siphovirus Gp157	NA	Q938M9	Temperate_phage	94.4	2.7e-46
BBE40595.1|1421057_1421312_-	hypothetical protein	NA	Q938N0	Temperate_phage	91.7	2.0e-40
BBE40596.1|1421298_1421661_-	hypothetical protein	NA	A0A097PAU3	Streptococcus_pyogenes_phage	62.8	3.9e-21
BBE40597.1|1421630_1421768_-	hypothetical protein	NA	J7KBQ4	Streptococcus_phage	78.4	2.1e-07
BBE40598.1|1421758_1422541_-	DNA replication protein DnaC	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	96.9	5.1e-143
BBE40599.1|1422527_1423289_-	hypothetical protein	NA	A0A097PBE7	Streptococcus_pyogenes_phage	87.4	3.3e-110
BBE40600.1|1423288_1423399_-	hypothetical protein	NA	A0A097PAT6	Streptococcus_pyogenes_phage	88.9	1.3e-09
BBE40601.1|1423382_1423523_-	hypothetical protein	NA	A0A097PAR2	Streptococcus_pyogenes_phage	93.2	2.1e-15
BBE40602.1|1423506_1423737_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40603.1|1423839_1423998_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40604.1|1424027_1424213_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40605.1|1424268_1424772_+	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	35.5	3.9e-11
BBE40606.1|1424881_1425016_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40607.1|1425027_1425783_-	hypothetical protein	NA	M1PKL6	Streptococcus_phage	76.1	1.3e-98
BBE40608.1|1425803_1426022_-	helix-turn-helix protein	NA	J7KK54	Streptococcus_phage	65.2	6.6e-16
BBE40609.1|1426188_1426545_+	helix-turn-helix protein	NA	J7KJ52	Streptococcus_phage	68.7	8.6e-21
BBE40610.1|1426555_1426909_+	hypothetical protein	NA	M1HNY1	Streptococcus_phage	42.3	2.0e-22
BBE40611.1|1426911_1427598_+	hypothetical protein	NA	A0A1P8VVT3	Streptococcus_phage	94.3	1.0e-115
BBE40612.1|1427715_1428795_+|transposase	transposase from transposon Tn916	transposase	X2KSV6	Streptococcus_phage	41.0	6.8e-69
BBE40613.1|1429238_1429586_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
BBE40614.1|1429700_1430963_-	H(+)/Cl(-) exchange transporter ClcA	NA	A0A1X9I5Z9	Streptococcus_phage	51.0	1.3e-95
BBE40615.1|1430955_1431240_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40616.1|1431415_1431865_-	flavodoxin	NA	NA	NA	NA	NA
BBE40617.1|1431932_1432952_-	aminodeoxyfutalosine deaminase	NA	NA	NA	NA	NA
BBE40618.1|1433203_1433983_+	disulfide-bond oxidoreductase YghU	NA	NA	NA	NA	NA
BBE40619.1|1434067_1434499_+	putative acyltransferase	NA	NA	NA	NA	NA
BBE40620.1|1434504_1435446_+	putative bifunctional oligoribonuclease and PAP phosphatase NrnA	NA	NA	NA	NA	NA
BBE40621.1|1435533_1436562_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE40622.1|1436735_1436996_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
BBE40623.1|1437207_1437612_-	PTS system mannose-specific EIIAB component	NA	NA	NA	NA	NA
BBE40624.1|1437611_1438427_-	mannose permease IID component	NA	NA	NA	NA	NA
BBE40625.1|1438413_1439316_-	N-acetylgalactosamine permease IIC component 1	NA	NA	NA	NA	NA
BBE40626.1|1439358_1439844_-	fructose-specific phosphotransferase enzyme IIB component	NA	NA	NA	NA	NA
BBE40627.1|1439840_1441625_-	beta-galactosidase precursor	NA	NA	NA	NA	NA
BBE40628.1|1441745_1442459_+	HTH-type transcriptional regulator FrlR	NA	NA	NA	NA	NA
BBE40629.1|1442521_1443517_-	tagatose 1,6-diphosphate aldolase 1	NA	NA	NA	NA	NA
BBE40630.1|1443526_1444705_-	putative tagatose-6-phosphate ketose/aldose isomerase	NA	NA	NA	NA	NA
BBE40631.1|1444724_1445447_-	HTH-type transcriptional repressor YvoA	NA	NA	NA	NA	NA
BBE40632.1|1445625_1446654_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE40633.1|1446868_1448188_+|transposase	transposase DDE domain protein	transposase	A0A1X9I5T2	Streptococcus_phage	74.9	4.4e-203
BBE40634.1|1448347_1448632_-	metal-binding protein ZinT precursor	NA	NA	NA	NA	NA
BBE40635.1|1448683_1449712_-|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE40636.1|1449776_1451090_-	high-affinity zinc uptake system binding-protein ZnuA precursor	NA	NA	NA	NA	NA
1449736:1449818	attR	AATTCTAGTATATCAGACGAACATGTCTTTTTTGTTGCACTTCATTTTACAACGCGGGAAGTAAAAGTTTTCTTTTCACCATT	NA	NA	NA	NA
BBE40637.1|1451240_1452638_-	dipeptidase	NA	NA	NA	NA	NA
1449736:1449818	attR	AATTCTAGTATATCAGACGAACATGTCTTTTTTGTTGCACTTCATTTTACAACGCGGGAAGTAAAAGTTTTCTTTTCACCATT	NA	NA	NA	NA
BBE40638.1|1452770_1453682_-	putative sporulation transcription regulator WhiA	NA	Q7AWZ3	Streptococcus_phage	64.0	7.6e-106
BBE40639.1|1453678_1454656_-	putative gluconeogenesis factor	NA	A1IMD5	Streptococcus_phage	75.7	1.0e-140
BBE40640.1|1454652_1455543_-	glmZ(sRNA)-inactivating NTPase	NA	A0A0R8VB27	Thermobifida_phage	30.6	1.1e-05
BBE40641.1|1455675_1456419_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40642.1|1456709_1458056_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.1	5.9e-54
BBE40643.1|1458093_1459290_-	aspartate aminotransferase	NA	NA	NA	NA	NA
BBE40644.1|1459571_1462034_-	hypothetical protein	NA	A0A1X9I5C8	Streptococcus_phage	49.3	7.6e-209
BBE40645.1|1462267_1462915_+	putative metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	62.1	4.2e-74
BBE40646.1|1463039_1463969_-	cell division protein FtsX	NA	NA	NA	NA	NA
BBE40647.1|1463961_1464654_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.8	1.6e-31
BBE40648.1|1464697_1465681_-	peptide chain release factor 2	NA	NA	NA	NA	NA
BBE40649.1|1465899_1467072_-	epoxyqueuosine reductase	NA	NA	NA	NA	NA
BBE40650.1|1467282_1469196_-	fructose-1,6-bisphosphatase class 3	NA	NA	NA	NA	NA
BBE40651.1|1469426_1470071_-	phosphorylated carbohydrates phosphatase	NA	NA	NA	NA	NA
BBE40652.1|1470245_1470536_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	55.1	2.0e-20
BBE40653.1|1470571_1471351_+|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	49.0	5.4e-68
BBE40654.1|1471436_1473839_-	pullulanase	NA	NA	NA	NA	NA
BBE40655.1|1473959_1475240_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40656.1|1475478_1476339_+	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
BBE40657.1|1476343_1476709_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40658.1|1476742_1479946_-	hyaluronate lyase precursor	NA	NA	NA	NA	NA
BBE40659.1|1479970_1480609_-	KHG/KDPG aldolase	NA	NA	NA	NA	NA
BBE40660.1|1480613_1481615_-	2-dehydro-3-deoxygluconokinase	NA	NA	NA	NA	NA
BBE40661.1|1481643_1482285_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40662.1|1482309_1483104_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
BBE40663.1|1483268_1484297_-|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE40664.1|1484615_1485053_+	PTS system mannose-specific EIIAB component	NA	NA	NA	NA	NA
BBE40665.1|1485052_1486252_+	uUnsaturated chondroitin disaccharide hydrolase	NA	NA	NA	NA	NA
BBE40666.1|1486287_1486776_+	fructose-specific phosphotransferase enzyme IIB component	NA	NA	NA	NA	NA
BBE40667.1|1486794_1487577_+	N-acetylgalactosamine permease IIC component 1	NA	NA	NA	NA	NA
BBE40668.1|1487563_1488385_+	mannose permease IID component	NA	NA	NA	NA	NA
BBE40669.1|1488471_1490379_+	heparin-sulfate lyase precursor	NA	NA	NA	NA	NA
BBE40670.1|1490442_1491438_+	HTH-type transcriptional regulator KdgR	NA	NA	NA	NA	NA
BBE40671.1|1491579_1492002_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40672.1|1492044_1494726_-	calcium-transporting ATPase 1	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.7	9.9e-69
BBE40673.1|1495053_1495461_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40674.1|1495542_1496844_+	HD domain protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.5	8.8e-23
BBE40675.1|1497324_1498134_+	putative phosphatase	NA	NA	NA	NA	NA
BBE40676.1|1498133_1499351_+	lipid II:glycine glycyltransferase	NA	NA	NA	NA	NA
BBE40677.1|1499350_1500586_+	aminoacyltransferase FemB	NA	NA	NA	NA	NA
BBE40678.1|1500724_1501861_+	lactate 2-monooxygenase	NA	NA	NA	NA	NA
BBE40679.1|1501946_1502705_-	triosephosphate isomerase	NA	NA	NA	NA	NA
BBE40680.1|1502870_1504283_-	poly-beta-1,6-N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
BBE40681.1|1504304_1504445_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40682.1|1504449_1506591_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40683.1|1506854_1507634_-|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	50.0	1.2e-67
BBE40684.1|1507669_1507960_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	56.2	2.6e-20
BBE40685.1|1508007_1509303_-	CotH protein	NA	NA	NA	NA	NA
BBE40686.1|1509256_1509934_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40687.1|1509985_1510681_-	VTC domain protein	NA	NA	NA	NA	NA
BBE40688.1|1511124_1512321_-	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	28.6	3.3e-32
BBE40689.1|1512446_1513526_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40690.1|1513509_1514019_-	RNA polymerase sigma factor YlaC	NA	NA	NA	NA	NA
BBE40691.1|1514089_1515364_-	lipid II flippase FtsW	NA	NA	NA	NA	NA
BBE40692.1|1515579_1518345_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
BBE40693.1|1518541_1520341_+	oligoendopeptidase F, plasmid	NA	A0A1X9I5X5	Streptococcus_phage	37.2	2.2e-109
BBE40694.1|1520333_1520813_+	hydroperoxy fatty acid reductase gpx1	NA	NA	NA	NA	NA
BBE40695.1|1520858_1521242_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40696.1|1521225_1521729_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40697.1|1522052_1522895_+	glycosyl hydrolases family 25	NA	A0A160LKP9	Bacillus_phage	30.4	3.6e-17
BBE40698.1|1523177_1523741_+	thiamine transporter ThiT	NA	NA	NA	NA	NA
BBE40699.1|1523832_1524312_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
BBE40700.1|1524308_1524674_+	inner membrane protein YccF	NA	NA	NA	NA	NA
BBE40701.1|1524755_1525535_-|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	49.0	5.4e-68
BBE40702.1|1525570_1525861_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	55.1	2.0e-20
BBE40703.1|1525950_1526529_+	putative phosphoserine phosphatase 2	NA	NA	NA	NA	NA
BBE40704.1|1526709_1527612_-	putative HAD-hydrolase YfnB	NA	NA	NA	NA	NA
BBE40705.1|1527785_1529279_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.9	1.5e-90
BBE40706.1|1529355_1530393_-	ammonia channel precursor	NA	NA	NA	NA	NA
BBE40707.1|1530496_1531624_+	putative oxidoreductase CzcO	NA	NA	NA	NA	NA
BBE40708.1|1531918_1532131_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40709.1|1532335_1533613_-|protease	putative protease YhbU precursor	protease	Q6DW11	Phage_TP	31.9	2.4e-41
BBE40710.1|1533727_1534654_-|protease	putative protease YhbU precursor	protease	NA	NA	NA	NA
BBE40711.1|1534806_1535835_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE40712.1|1536013_1537060_+|integrase	integrase core domain protein	integrase	A0A2K9V2S9	Faecalibacterium_phage	32.2	9.5e-36
1544502:1545665	attR	GCTTAACCTCTGGAACTCTAGTTATCTATGAACTGGTTGCACTTGACTTGACAACTTGTGATCAAATAAAAAAAGAGAATTTTTAAAAAAATTCACTTTTAACACAGTTAATCGTCTAATTTAGCTAGTGTGTCATATTCCCCTAACAATAATTTCACTTCTTCAAGTGAACGTGCTCCTTTAATTAAATCAATAAAATGCTGCCCTTCTTCCGGAGTTGTTGCCGAGTAAGTATAAAGGATATGTTTAATTGCAGCTTCCTTTTTTTCTGCTAACAATTTTAATTCTTCTTTTCTCTTTTTAAAGTTATTTCGTCTGTAATTTTCTGTAGAAGTTGTATTCCAAGTATTATGGTAATGTGTACCACTAGTATAATAAGAAGATGCTCTACACTTGCTGTCCCTACTGCCACTGTTGCAAATGCAAGTGCTGCGGCACCTGCTAACATAACTTTTTTCATGTTAATATCTCCTCCACTTTTTCATTTTATTAAAAGTTACTAAACCAGTGTACCTATAAACTCATAAAAAAGCAATTAAGATATTATTTTTTATATTTAATTTTAATTTATATATTAGTTATAATTCCTTAAGCAATTAAAAACAAGCACTTGTAGGTGCTCGTTTTTAGGATGAGAATAAGTTGCTCTATGACCTCAAACCTAATTCAAGTCAATTAATTCTCCTGTTTCCAAATAGACCACACGCTCGCAGATATTAGCAATATAATCCGCAAAGCGTTCCAAATGCCCTATAATATAGAGATACTGAGTACCATTTGGAATGGAGGTTTCTTGGTCTTTCATAAGGCTTATAATATCTTTTGATAAGGCATAATAGTGCTGATCAATCTGTTCATCTGTTTGTGCAATAGAAATTGCTTTTGAAGCCTGGTGCAAAGGAAAAGTTTCTAATAAATCAGCTAACATGCGAAGTGCTGATTGCCCCATCAGATGTAATTGGTCTTCGATGGGGGCTAGTTGGTCTTCTTTTAATTGTAAAATAGCCTTAGCGATACCTGTCATATGGTCCCCCATTCGTTCAAGGTCCGAACAAGAAGACATAATGCTAATCACGAAGCGAAGGTCAGATACTTGGGGTTGCTGTAGAGCCAACATCCTGGCACATGCCAATTCGATGGCACTTTGCCTTTGGTTAATCTTCT	NA	NA	NA	NA
>prophage 13
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	1543478	1593523	2142780	integrase,tRNA,transposase	Bacillus_phage(38.1%)	52	1543389:1543448	1572884:1572973
1543389:1543448	attL	AATAAAAAACCCGCGTTGTAAAATGAAGTGCAACAAAAAAGACATGTTCGTCTGATATAC	NA	NA	NA	NA
BBE40720.1|1543478_1544507_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE40721.1|1544608_1544779_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40722.1|1544781_1544961_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40723.1|1545162_1545813_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40724.1|1545830_1546583_-	phosphate import ATP-binding protein PstB 3	NA	G9BWD6	Planktothrix_phage	33.3	1.2e-16
BBE40725.1|1546584_1547400_-	phosphate transport system permease protein PstA	NA	NA	NA	NA	NA
BBE40726.1|1547392_1548256_-	phosphate transport system permease protein PstC	NA	NA	NA	NA	NA
BBE40727.1|1548372_1549248_-	phosphate-binding protein PstS 2 precursor	NA	NA	NA	NA	NA
BBE40728.1|1549414_1550743_-	alkaline phosphatase synthesis sensor protein PhoR	NA	A0A1V0SGX0	Hokovirus	34.2	2.6e-22
BBE40729.1|1550743_1551451_-	alkaline phosphatase synthesis transcriptional regulatory protein PhoP	NA	W8CYM9	Bacillus_phage	40.0	6.9e-38
BBE40730.1|1551537_1552017_-	hypothetical protein	NA	A0A291ATU0	Pandoravirus	34.6	2.3e-16
BBE40731.1|1552194_1552344_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40732.1|1552496_1553399_+	putative permease	NA	NA	NA	NA	NA
BBE40733.1|1553398_1554214_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40734.1|1554339_1555890_-	signal recognition particle receptor FtsY	NA	NA	NA	NA	NA
BBE40735.1|1555889_1556714_-	sugar phosphatase YidA	NA	NA	NA	NA	NA
BBE40736.1|1556717_1557515_-	flavin mononucleotide phosphatase YbjI	NA	NA	NA	NA	NA
BBE40737.1|1557755_1561682_-	C5a peptidase precursor	NA	A0A1B0T6A2	Bacillus_phage	29.5	6.6e-05
BBE40738.1|1561711_1562425_-	C5a peptidase precursor	NA	NA	NA	NA	NA
BBE40739.1|1562763_1566309_-	chromosome partition protein Smc	NA	NA	NA	NA	NA
BBE40740.1|1566309_1567002_-	ribonuclease 3	NA	A0A167RGU4	Powai_lake_megavirus	31.6	2.5e-24
BBE40741.1|1567501_1567762_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	1.1e-09
BBE40742.1|1567773_1568517_+|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	39.6	4.5e-40
BBE40743.1|1568527_1569367_-|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	7.1e-50
BBE40744.1|1569378_1569639_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	1.1e-09
BBE40745.1|1569850_1570126_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40746.1|1570205_1570985_-|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	49.0	5.4e-68
BBE40747.1|1571020_1571311_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	55.1	2.0e-20
BBE40748.1|1571824_1572853_-|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE40749.1|1573058_1573934_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
1572884:1572973	attR	GTATATCAGACGAACATGTCTTTTTTGTTGCACTTCATTTTACAACGCGGGTTTTTTATTATCTTTATTATGATATGACTTTTTAGATGT	NA	NA	NA	NA
BBE40750.1|1574015_1574825_-	putative metallo-hydrolase YycJ	NA	A0A0C5AJ83	Bacteriophage	37.5	1.1e-36
BBE40751.1|1574828_1576181_-	sensor histidine kinase YycG	NA	W8CYF6	Bacillus_phage	35.0	2.1e-35
BBE40752.1|1576173_1576884_-	transcriptional regulatory protein YycF	NA	W8CYM9	Bacillus_phage	39.4	5.7e-40
BBE40753.1|1577142_1577937_+	glutamine transport ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	40.4	7.2e-36
BBE40754.1|1577936_1578737_+	major cell-binding factor precursor	NA	NA	NA	NA	NA
BBE40755.1|1578750_1579452_+	putative glutamine ABC transporter permease protein GlnM	NA	NA	NA	NA	NA
BBE40756.1|1579466_1580114_+	putative glutamine ABC transporter permease protein GlnPprotein	NA	NA	NA	NA	NA
BBE40757.1|1580209_1581205_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40758.1|1581298_1582543_-	putative acyl--CoA ligase YhfT	NA	NA	NA	NA	NA
BBE40759.1|1582532_1583648_-	putative acetyl-CoA acyltransferase	NA	NA	NA	NA	NA
BBE40760.1|1583616_1584186_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40761.1|1584319_1585030_-	glycerol uptake facilitator protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	33.7	8.8e-33
BBE40762.1|1585047_1585422_-	PTS-dependent dihydroxyacetone kinase, phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
BBE40763.1|1585421_1585997_-	PTS-dependent dihydroxyacetone kinase, ADP-binding subunit DhaL	NA	NA	NA	NA	NA
BBE40764.1|1586007_1586997_-	PTS-dependent dihydroxyacetone kinase, dihydroxyacetone-binding subunit DhaK	NA	NA	NA	NA	NA
BBE40765.1|1587148_1587685_+	HTH-type dhaKLM operon transcriptional activator DhaS	NA	NA	NA	NA	NA
BBE40766.1|1587699_1588689_+	DhaKLM operon coactivator DhaQ	NA	NA	NA	NA	NA
BBE40767.1|1588793_1589231_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40768.1|1589282_1589579_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40769.1|1589580_1590399_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40770.1|1590400_1591393_-	methionine import ATP-binding protein MetN 2	NA	A0A2H4PQG7	Staphylococcus_phage	29.9	6.7e-15
BBE40771.1|1591579_1593523_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	39.1	5.6e-122
>prophage 14
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	1601678	1632203	2142780	integrase,transposase	Paenibacillus_phage(44.44%)	36	1605248:1605307	1632247:1632383
BBE40779.1|1601678_1602863_+	DNA/RNA non-specific endonuclease	NA	A7J2B8	Streptococcus_phage	51.0	2.5e-72
BBE40780.1|1602999_1603926_+	putative glycosyltransferase CsbB	NA	V5USA4	Oenococcus_phage	47.9	2.1e-79
BBE40781.1|1603982_1604780_-|integrase	integrase core domain protein	integrase	A0A1B1P773	Bacillus_phage	49.6	6.1e-59
BBE40782.1|1604815_1605331_-|transposase	transposase	transposase	NA	NA	NA	NA
1605248:1605307	attL	AAATGTTTGACTGATTTTAGGCCATGTCCAACCAGATTGTCGTAAGCGATAGATTTCAAT	NA	NA	NA	NA
BBE40783.1|1605468_1606248_-|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	49.0	7.0e-68
BBE40784.1|1606283_1606574_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	55.1	2.0e-20
BBE40785.1|1606649_1607006_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40786.1|1607178_1607646_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	57.3	2.6e-41
BBE40787.1|1607648_1609979_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.8	8.8e-90
BBE40788.1|1610075_1610312_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
BBE40789.1|1610500_1611112_-	bicyclomycin resistance protein	NA	NA	NA	NA	NA
BBE40790.1|1611087_1611669_-	tetracycline resistance protein, class B	NA	NA	NA	NA	NA
BBE40791.1|1611880_1613383_-	AAA-like domain protein	NA	A0A248XCZ8	Klebsiella_phage	43.7	5.0e-78
BBE40792.1|1613493_1614177_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40793.1|1614169_1614949_-|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	49.0	5.4e-68
BBE40794.1|1614984_1615275_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	55.1	2.0e-20
BBE40795.1|1615584_1615770_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40796.1|1616570_1617320_+	accessory gene regulator protein A	NA	NA	NA	NA	NA
BBE40797.1|1618031_1618436_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40798.1|1618348_1618666_-	plasmid stabilization system protein	NA	NA	NA	NA	NA
BBE40799.1|1618665_1618914_-	Phd_YefM	NA	NA	NA	NA	NA
BBE40800.1|1619536_1619824_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40801.1|1619933_1620194_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	1.1e-09
BBE40802.1|1620205_1621045_+|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	7.1e-50
BBE40803.1|1621377_1621668_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	55.1	2.0e-20
BBE40804.1|1621703_1622483_+|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	49.0	5.4e-68
BBE40805.1|1623334_1624204_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40806.1|1624278_1624557_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40807.1|1624594_1626196_-	transglutaminase-like superfamily protein	NA	NA	NA	NA	NA
BBE40808.1|1626292_1627276_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
BBE40809.1|1627457_1628285_+	formamidopyrimidine-DNA glycosylase	NA	G3MA33	Bacillus_virus	32.7	1.9e-26
BBE40810.1|1628254_1628875_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
BBE40811.1|1629327_1630029_+	putative ABC transporter ATP-binding protein YxlF	NA	A0A2H4PQG7	Staphylococcus_phage	33.6	2.5e-24
BBE40812.1|1630018_1631044_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40813.1|1631097_1631388_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	55.1	2.0e-20
BBE40814.1|1631423_1632203_+|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	49.0	5.4e-68
1632247:1632383	attR	AAATGTTTGACTGATTTTAGGCCATGTCCAACCAGATTGTCGTAAGCGATAGATTTCAATTTTATCTTCATAACTTAATTTCATAGAAAAACACCCCAAAAGTTAGATTTGTTGTCTAACTTTTGGGGTGCAGTTCA	NA	NA	NA	NA
>prophage 15
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	1647458	1702662	2142780	integrase,tRNA,transposase	unidentified_phage(20.0%)	48	1648488:1648547	1702663:1702743
BBE40833.1|1647458_1648487_-|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	32.7	4.8e-40
1648488:1648547	attL	CTGCTTTCCATACTGAATTGGGGAATTCTAGTATATCAGACGAACATGTCTTTTTTGTTG	NA	NA	NA	NA
BBE40834.1|1648771_1649722_-	carbamate kinase 1	NA	NA	NA	NA	NA
BBE40835.1|1650025_1651255_+|transposase	transposase IS116/IS110/IS902 family protein	transposase	Q9JMN8	Wolbachia_phage	28.3	1.1e-33
BBE40836.1|1651359_1652691_-	putative dipeptidase	NA	NA	NA	NA	NA
BBE40837.1|1652707_1654201_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40838.1|1654371_1655385_-	ornithine carbamoyltransferase, catabolic	NA	NA	NA	NA	NA
BBE40839.1|1655508_1655943_-	putative N-acetyltransferase YjcF	NA	NA	NA	NA	NA
BBE40840.1|1655949_1657185_-	arginine deiminase	NA	NA	NA	NA	NA
BBE40841.1|1657460_1658141_-	global nitrogen regulator	NA	NA	NA	NA	NA
BBE40842.1|1658282_1658756_+	arginine regulator	NA	NA	NA	NA	NA
BBE40843.1|1658921_1659638_-	B3/4 domain protein	NA	NA	NA	NA	NA
BBE40844.1|1659660_1660740_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40845.1|1660812_1662546_-	sensor histidine kinase YehU	NA	Q9EYF3	Enterobacteria_phage	32.7	5.1e-26
BBE40846.1|1662542_1663283_-	putative response regulatory protein	NA	Q6XM27	Feldmannia_irregularis_virus	32.4	8.0e-05
BBE40847.1|1663370_1664477_-	peptide methionine sulfoxide reductase MsrA/MsrB	NA	NA	NA	NA	NA
BBE40848.1|1664516_1665140_-	peptide methionine sulfoxide reductase MsrA/MsrB	NA	NA	NA	NA	NA
BBE40849.1|1665152_1665863_-	thiol:disulfide interchange protein DsbD precursor	NA	NA	NA	NA	NA
BBE40850.1|1666083_1667016_-	CorA-like Mg2+ transporter protein	NA	NA	NA	NA	NA
BBE40851.1|1667107_1668067_-	1,5-anhydro-D-fructose reductase	NA	NA	NA	NA	NA
BBE40852.1|1668332_1670981_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.2	8.6e-150
BBE40853.1|1670982_1671546_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40854.1|1671542_1672133_-	putative ribosomal N-acetyltransferase YdaF	NA	NA	NA	NA	NA
BBE40855.1|1672146_1672530_-	hypothetical protein	NA	V5UQY3	Oenococcus_phage	50.0	2.0e-31
BBE40856.1|1672884_1673280_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40857.1|1673300_1673555_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40858.1|1673781_1674216_+	multiple antibiotic resistance protein MarR	NA	NA	NA	NA	NA
BBE40859.1|1674229_1675597_+	multidrug export protein MepA	NA	NA	NA	NA	NA
BBE40860.1|1676347_1677577_+|transposase	transposase IS116/IS110/IS902 family protein	transposase	Q9JMN8	Wolbachia_phage	28.3	1.1e-33
BBE40861.1|1678335_1679115_-|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	50.0	1.2e-67
BBE40862.1|1679150_1679441_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	56.2	2.6e-20
BBE40863.1|1679582_1680335_+	phospho-2-dehydro-3-deoxyheptonate aldolase	NA	NA	NA	NA	NA
BBE40864.1|1680384_1681464_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
BBE40865.1|1681513_1681849_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40866.1|1681879_1683838_-	chromosome partition protein Smc	NA	NA	NA	NA	NA
BBE40867.1|1683983_1684157_+	hypothetical protein	NA	NA	NA	NA	NA
BBE40868.1|1684203_1685112_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40869.1|1685253_1686150_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
BBE40870.1|1686272_1689683_-	beta-galactosidase	NA	NA	NA	NA	NA
BBE40871.1|1689702_1691187_-	putative response regulatory protein	NA	NA	NA	NA	NA
BBE40872.1|1691186_1692911_-	sensor histidine kinase YpdA	NA	NA	NA	NA	NA
BBE40873.1|1692900_1693506_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40874.1|1693823_1695269_-	bacterial extracellular solute-binding protein	NA	NA	NA	NA	NA
BBE40875.1|1695347_1696274_-	L-arabinose transport system permease protein AraQ	NA	NA	NA	NA	NA
BBE40876.1|1696283_1697234_-	putative multiple-sugar transport system permease YteP	NA	NA	NA	NA	NA
BBE40877.1|1697450_1698329_+	beta-glucoside kinase	NA	NA	NA	NA	NA
BBE40878.1|1698332_1700507_+	glycosyl hydrolase family 92	NA	NA	NA	NA	NA
BBE40879.1|1700677_1701361_-	hypothetical protein	NA	NA	NA	NA	NA
BBE40880.1|1701633_1702662_-|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
1702663:1702743	attR	CTGCTTTCCATACTGAATTGGGGAATTCTAGTATATCAGACGAACATGTCTTTTTTGTTGCACTTCATTTTACAACGCGGG	NA	NA	NA	NA
>prophage 16
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	1730087	1737447	2142780	integrase	Streptococcus_phage(66.67%)	9	1722048:1722062	1731672:1731686
1722048:1722062	attL	ACTAAAATCGAAAAG	NA	NA	NA	NA
BBE40897.1|1730087_1731116_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE40898.1|1731212_1731761_-	ribosome-associated factor Y	NA	NA	NA	NA	NA
1731672:1731686	attR	CTTTTCGATTTTAGT	NA	NA	NA	NA
BBE40899.1|1731840_1732506_-	DNA utilization protein GntX	NA	NA	NA	NA	NA
BBE40900.1|1732477_1732867_-	ATP-dependent DNA helicase RecG	NA	A0A1X9I5S6	Streptococcus_phage	55.7	1.0e-27
BBE40901.1|1732887_1733802_-	primosome assembly protein PriA	NA	A0A1X9I5S6	Streptococcus_phage	53.3	1.8e-75
BBE40902.1|1733857_1734499_+	IMPACT family member YigZ	NA	A0A1X9I5T8	Streptococcus_phage	56.0	1.5e-63
BBE40903.1|1734599_1735535_+	cysteine synthase	NA	A0A1X9I5F1	Streptococcus_phage	78.9	1.3e-132
BBE40904.1|1735687_1736047_-	general stress protein 13	NA	NA	NA	NA	NA
BBE40905.1|1736046_1737447_-	putative bifunctional phosphatase/peptidyl-prolyl cis-trans isomerase	NA	A0A1V0S9I2	Catovirus	42.3	3.5e-25
>prophage 17
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	2009352	2064161	2142780	integrase,protease,tRNA,transposase	unidentified_phage(23.08%)	50	2055358:2055372	2064330:2064344
BBE41163.1|2009352_2010381_-|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE41164.1|2010473_2011457_-|integrase	integrase core domain protein	integrase	H7BVY4	unidentified_phage	32.2	6.9e-36
BBE41165.1|2011734_2012649_-	R3H domain protein	NA	NA	NA	NA	NA
BBE41166.1|2012660_2013476_-	membrane protein insertase MisCA precursor	NA	NA	NA	NA	NA
BBE41167.1|2013453_2013813_-	ribonuclease P protein component	NA	NA	NA	NA	NA
BBE41168.1|2014356_2015094_-	accessory gene regulator protein A	NA	NA	NA	NA	NA
BBE41169.1|2015100_2016384_-	hypothetical protein	NA	NA	NA	NA	NA
BBE41170.1|2016384_2017728_-	sensory histidine kinase DcuS	NA	NA	NA	NA	NA
BBE41171.1|2017874_2018903_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE41172.1|2019111_2019321_+	cold shock-like protein CspLA	NA	Q9AZD3	Lactococcus_phage	81.5	1.3e-24
BBE41173.1|2019514_2019976_+	transcriptional regulator CtsR	NA	NA	NA	NA	NA
BBE41174.1|2019975_2022420_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A223W0B1	Agrobacterium_phage	39.0	6.5e-128
BBE41175.1|2022597_2022888_+	10 kDa chaperonin	NA	NA	NA	NA	NA
BBE41176.1|2022923_2024549_+	60 kDa chaperonin	NA	A0A219YK78	uncultured_virus	55.8	3.9e-153
BBE41177.1|2024763_2025231_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
BBE41178.1|2025563_2027060_-	dipeptidase A	NA	NA	NA	NA	NA
BBE41179.1|2027341_2028982_+	hypothetical protein	NA	NA	NA	NA	NA
BBE41180.1|2029083_2029995_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
BBE41181.1|2029978_2030170_-	hypothetical protein	NA	NA	NA	NA	NA
BBE41182.1|2030513_2030894_+	hypothetical protein	NA	NA	NA	NA	NA
BBE41183.1|2030932_2033281_+	penicillin-binding protein 1F	NA	NA	NA	NA	NA
BBE41184.1|2033494_2033671_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
BBE41185.1|2033874_2034429_+	hypothetical protein	NA	NA	NA	NA	NA
BBE41186.1|2034703_2036164_+	immunoglobulin G-binding protein G precursor	NA	NA	NA	NA	NA
BBE41187.1|2036422_2038924_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.5	0.0e+00
BBE41188.1|2039227_2040661_+	ascorbate-specific permease IIC component UlaA	NA	NA	NA	NA	NA
BBE41189.1|2040731_2041010_+	ascorbate-specific phosphotransferase enzyme IIB component	NA	NA	NA	NA	NA
BBE41190.1|2041136_2041622_+	ascorbate-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
BBE41191.1|2041730_2042393_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
BBE41192.1|2042396_2043260_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
BBE41193.1|2043261_2043978_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
BBE41194.1|2044260_2045907_+	putative licABCH operon regulator	NA	NA	NA	NA	NA
BBE41195.1|2046203_2047295_+	putative L-ascorbate-6-phosphate lactonase UlaG	NA	NA	NA	NA	NA
BBE41196.1|2047550_2048462_+	putative lipid kinase	NA	A0A1V0SBJ0	Catovirus	25.3	2.4e-14
BBE41197.1|2048896_2050093_+	glycine betaine transport ATP-binding protein OpuAA	NA	G3M9Y6	Bacillus_virus	38.7	1.5e-29
BBE41198.1|2050110_2051838_+	glycine betaine/carnitine transport permease protein GbuB	NA	NA	NA	NA	NA
BBE41199.1|2051982_2054625_+	DNA polymerase I	NA	S5M8J1	Bacillus_phage	34.7	3.5e-50
BBE41200.1|2054699_2054813_+	hypothetical protein	NA	NA	NA	NA	NA
BBE41201.1|2054831_2055272_+	hypothetical protein	NA	NA	NA	NA	NA
BBE41202.1|2055338_2055806_+	peroxide-responsive repressor PerR	NA	NA	NA	NA	NA
2055358:2055372	attL	AGCAAGCCCTAGATG	NA	NA	NA	NA
BBE41203.1|2055926_2056793_-	hypothetical protein	NA	NA	NA	NA	NA
BBE41204.1|2057012_2058155_+|tRNA	queuine tRNA-ribosyltransferase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.6	3.8e-86
BBE41205.1|2058359_2058671_+	CHY zinc finger	NA	NA	NA	NA	NA
BBE41206.1|2058674_2059214_+	biotin transporter BioY	NA	NA	NA	NA	NA
BBE41207.1|2059352_2060132_+	ribonuclease BN	NA	NA	NA	NA	NA
BBE41208.1|2060131_2060659_+|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
BBE41209.1|2060760_2061993_-	hypothetical protein	NA	NA	NA	NA	NA
BBE41210.1|2062391_2063039_+	exotoxin type C precursor	NA	NA	NA	NA	NA
BBE41211.1|2063049_2063889_-|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	7.1e-50
BBE41212.1|2063900_2064161_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.6	1.1e-09
2064330:2064344	attR	CATCTAGGGCTTGCT	NA	NA	NA	NA
>prophage 18
AP018726	Streptococcus dysgalactiae Kdys0611 DNA, complete genome	2142780	2068797	2126792	2142780	integrase,protease,tRNA,transposase	Paenibacillus_phage(23.53%)	50	2093218:2093271	2126793:2126846
BBE41218.1|2068797_2069088_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	56.2	2.6e-20
BBE41219.1|2069123_2069903_+|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	50.0	1.2e-67
BBE41220.1|2070066_2070453_+	hypothetical protein	NA	NA	NA	NA	NA
BBE41221.1|2070566_2072072_-	M protein trans-acting positive regulator (MGA) PRD domain protein	NA	NA	NA	NA	NA
BBE41222.1|2072506_2074168_+	fibronectin binding repeat protein	NA	NA	NA	NA	NA
BBE41223.1|2074652_2075237_+	putative 5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
BBE41224.1|2075233_2075908_+|protease	rhomboid protease GluP	protease	NA	NA	NA	NA
BBE41225.1|2076084_2076312_-	hypothetical protein	NA	NA	NA	NA	NA
BBE41226.1|2076389_2076680_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	55.1	2.0e-20
BBE41227.1|2076715_2077495_+|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	49.0	5.4e-68
BBE41228.1|2077483_2077933_-	hypothetical protein	NA	NA	NA	NA	NA
BBE41229.1|2078113_2079016_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	51.5	6.2e-76
BBE41230.1|2079047_2080064_-	glycerol-3-phosphate dehydrogenase [NAD(P)+]	NA	NA	NA	NA	NA
BBE41231.1|2080264_2080714_+	MarR family protein	NA	NA	NA	NA	NA
BBE41232.1|2080706_2082416_+	putative multidrug export ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	28.3	3.1e-36
BBE41233.1|2082415_2084200_+	putative ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	1.1e-44
BBE41234.1|2084318_2085086_+	hypothetical protein	NA	NA	NA	NA	NA
BBE41235.1|2085193_2085640_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A5GYP0	Lactococcus_phage	52.1	4.5e-35
BBE41236.1|2085821_2087084_+	hypothetical protein	NA	NA	NA	NA	NA
BBE41237.1|2087273_2087768_+	beta-carbonic anhydrase 1	NA	NA	NA	NA	NA
BBE41238.1|2087903_2088620_+	hypothetical protein	NA	NA	NA	NA	NA
BBE41239.1|2088848_2089295_+	putative HTH-type transcriptional regulator	NA	NA	NA	NA	NA
BBE41240.1|2089298_2090000_+	hypothetical protein	NA	NA	NA	NA	NA
BBE41241.1|2090094_2091363_+	major Facilitator Superfamily protein	NA	NA	NA	NA	NA
BBE41242.1|2091495_2092944_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
2093218:2093271	attL	CACAAGTTGTCAAGTCAAGTGCAACCAGTTCATAGATAACTAGAGTTCCAGAGG	NA	NA	NA	NA
BBE41243.1|2093271_2094300_-|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
BBE41244.1|2094317_2094962_+	hypothetical protein	NA	NA	NA	NA	NA
BBE41245.1|2094993_2095152_-	hypothetical protein	NA	J7KH24	Streptococcus_phage	92.3	7.6e-22
BBE41246.1|2095512_2096262_+	LexA repressor	NA	J7KJ52	Streptococcus_phage	59.1	7.0e-73
BBE41247.1|2096476_2097421_+	Abi-like protein	NA	M1PS09	Streptococcus_phage	61.1	1.9e-104
BBE41248.1|2097542_2098616_+|transposase	transposase from transposon Tn916	transposase	A0A1P8VVR7	Streptococcus_phage	62.6	1.5e-121
BBE41249.1|2099193_2099754_+	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
BBE41250.1|2099774_2101307_+	NADH dehydrogenase	NA	V9VEY6	Lactococcus_phage	29.4	1.5e-21
BBE41251.1|2101364_2102630_-	imidazolonepropionase	NA	NA	NA	NA	NA
BBE41252.1|2103008_2105039_+	urocanate hydratase	NA	NA	NA	NA	NA
BBE41253.1|2105126_2106026_+	hypothetical protein	NA	NA	NA	NA	NA
BBE41254.1|2106036_2106663_+	methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
BBE41255.1|2106680_2108354_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
BBE41256.1|2108375_2108972_+	HutD	NA	NA	NA	NA	NA
BBE41257.1|2109198_2110542_+	serine/threonine exchanger SteT	NA	NA	NA	NA	NA
BBE41258.1|2110553_2112095_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	43.6	2.4e-99
BBE41259.1|2112281_2113268_+	formimidoylglutamase	NA	NA	NA	NA	NA
BBE41260.1|2113298_2116373_-	bacterial transcriptional activator domain protein	NA	NA	NA	NA	NA
BBE41261.1|2116632_2117400_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
BBE41262.1|2117533_2118574_+	elongation factor Ts	NA	NA	NA	NA	NA
BBE41263.1|2118747_2120643_-	neutral endopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.8	1.4e-69
BBE41264.1|2120851_2122480_-	trehalose-6-phosphate hydrolase	NA	NA	NA	NA	NA
BBE41265.1|2122546_2124559_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
BBE41266.1|2124768_2125482_+	trehalose operon transcriptional repressor	NA	NA	NA	NA	NA
BBE41267.1|2125763_2126792_+|integrase	integrase core domain protein	integrase	H7BUM7	unidentified_phage	33.0	1.7e-40
2126793:2126846	attR	CCTCTGGAACTCTAGTTATCTATGAACTGGTTGCACTTGACTTGACAACTTGTG	NA	NA	NA	NA
>prophage 1
AP018727	Streptococcus dysgalactiae Kdys0611 plasmid pFGCSD1 DNA, complete genome	28095	9444	23082	28095	transposase,tRNA,integrase	Streptococcus_phage(46.67%)	22	12910:12965	20042:20097
BBE41297.1|9444_10347_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	51.5	6.2e-76
BBE41298.1|10527_10977_+	hypothetical protein	NA	NA	NA	NA	NA
BBE41299.1|10965_11745_-|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	49.0	5.4e-68
BBE41300.1|11780_12071_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	55.1	2.0e-20
BBE41301.1|12318_12909_+|integrase	integrase core domain protein	integrase	Q6J1X2	Lactobacillus_phage	42.6	7.0e-36
12910:12965	attL	AATAAATAGATTAAAATTCTACGTTTGTTACTCTAAAAACTTGACTTAACCTCACC	NA	NA	NA	NA
BBE41302.1|12941_13385_-	hypothetical protein	NA	NA	NA	NA	NA
BBE41303.1|13449_13713_-|tRNA	prolyl-tRNA editing protein ProX	tRNA	NA	NA	NA	NA
BBE41304.1|13720_15214_+	poxvirus D5 protein-like protein	NA	A0A1X9I717	Streptococcus_phage	83.2	8.3e-243
BBE41305.1|15502_15676_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	61.4	3.5e-12
BBE41306.1|15681_15855_+	hypothetical protein	NA	NA	NA	NA	NA
BBE41307.1|15856_16414_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	56.6	1.9e-30
BBE41308.1|16487_16976_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	58.0	3.5e-49
BBE41309.1|17304_17688_-	hypothetical protein	NA	NA	NA	NA	NA
BBE41310.1|17900_18263_+	hypothetical protein	NA	A0A2H4JFS1	uncultured_Caudovirales_phage	29.1	6.7e-05
BBE41311.1|18237_18615_+	hypothetical protein	NA	J7KDQ1	Streptococcus_phage	40.9	1.8e-13
BBE41312.1|18929_19190_+|transposase	transposase	transposase	NA	NA	NA	NA
BBE41313.1|19201_20041_+|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	7.1e-50
BBE41314.1|20051_20276_-	hypothetical protein	NA	NA	NA	NA	NA
20042:20097	attR	AATAAATAGATTAAAATTCTACGTTTGTTACTCTAAAAACTTGACTTAACCTCACC	NA	NA	NA	NA
BBE41315.1|20832_21687_+	DNA-damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	52.0	4.0e-56
BBE41316.1|21932_22481_+	hypothetical protein	NA	A0A1X9I5Y5	Streptococcus_phage	43.9	1.9e-35
BBE41317.1|22477_22708_+	tyrosine recombinase XerC	NA	Q9AZI0	Lactococcus_phage	40.3	3.8e-06
BBE41318.1|22752_23082_+|transposase	transposase from transposon Tn916	transposase	A0A1X9I5Y5	Streptococcus_phage	55.7	3.2e-22
>prophage 1
AP018728	Streptococcus dysgalactiae Kdys0611 plasmid pFGCSD2 DNA, complete genome	16656	1309	13336	16656	tRNA,integrase,transposase	Streptococcus_phage(52.94%)	25	11136:11149	12782:12795
BBE41329.1|1309_1540_+|integrase	integrase core domain protein	integrase	Q6J1X2	Lactobacillus_phage	35.0	2.9e-06
BBE41330.1|1536_1644_+	hypothetical protein	NA	NA	NA	NA	NA
BBE41331.1|1655_1898_+|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	49.3	4.6e-10
BBE41332.1|2272_2371_-	hypothetical protein	NA	NA	NA	NA	NA
BBE41333.1|2434_2644_-|tRNA	prolyl-tRNA editing protein ProX	tRNA	NA	NA	NA	NA
BBE41334.1|2703_2937_+	hypothetical protein	NA	A0A1X9I717	Streptococcus_phage	71.4	1.4e-19
BBE41335.1|3190_3382_+	hypothetical protein	NA	A0A1X9I717	Streptococcus_phage	94.9	6.8e-25
BBE41336.1|3526_3676_+	hypothetical protein	NA	A0A1X9I717	Streptococcus_phage	100.0	2.2e-18
BBE41337.1|3617_3923_+	poxvirus D5 protein-like protein	NA	A0A1X9I717	Streptococcus_phage	78.2	3.1e-35
BBE41338.1|3907_4192_+	hypothetical protein	NA	A0A1X9I717	Streptococcus_phage	74.7	5.9e-33
BBE41339.1|4658_4832_+	hypothetical protein	NA	NA	NA	NA	NA
BBE41340.1|4833_5391_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	56.6	1.9e-30
BBE41341.1|5464_5794_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	61.1	4.3e-27
BBE41342.1|6282_6396_-	hypothetical protein	NA	NA	NA	NA	NA
BBE41343.1|6542_6668_-	hypothetical protein	NA	NA	NA	NA	NA
BBE41344.1|6880_7243_+	hypothetical protein	NA	A0A2H4JFS1	uncultured_Caudovirales_phage	29.1	6.7e-05
BBE41345.1|7217_7595_+	hypothetical protein	NA	J7KDQ1	Streptococcus_phage	40.9	1.8e-13
BBE41346.1|7880_8168_+|transposase	transposase	transposase	NA	NA	NA	NA
BBE41347.1|8179_8977_+|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	40.9	1.8e-39
BBE41348.1|9808_10087_+	DNA-damage-inducible protein D	NA	NA	NA	NA	NA
BBE41349.1|10096_10663_+	DNA-damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	48.9	5.2e-36
BBE41350.1|10987_11455_+	hypothetical protein	NA	A0A1X9I5Y5	Streptococcus_phage	38.9	3.2e-23
11136:11149	attL	ATTTATGGCTTGAA	NA	NA	NA	NA
BBE41351.1|11546_11912_+|integrase	phage integrase family protein	integrase	Q9AZI0	Lactococcus_phage	38.0	2.2e-08
BBE41352.1|12110_12794_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	47.9	1.9e-37
BBE41353.1|12808_13336_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	26.2	3.6e-07
12782:12795	attR	ATTTATGGCTTGAA	NA	NA	NA	NA
>prophage 1
AP018730	Streptococcus dysgalactiae Kdys0611 plasmid pFGCSD4 DNA, complete genome	15413	5	12605	15413	tRNA,integrase,transposase	Streptococcus_phage(54.55%)	17	354:409	7486:7541
BBE41388.1|5_353_+|integrase	integrase core domain protein	integrase	Q6J1X2	Lactobacillus_phage	47.3	2.1e-19
354:409	attL	AATAAATAGATTAAAATTCTACGTTTGTTACTCTAAAAACTTGACTTAACCTCACC	NA	NA	NA	NA
BBE41389.1|385_829_-	hypothetical protein	NA	NA	NA	NA	NA
BBE41390.1|893_1157_-|tRNA	prolyl-tRNA editing protein ProX	tRNA	NA	NA	NA	NA
BBE41391.1|1164_2658_+	poxvirus D5 protein-like protein	NA	A0A1X9I717	Streptococcus_phage	83.2	8.3e-243
BBE41392.1|2946_3120_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	61.4	3.5e-12
BBE41393.1|3125_3299_+	hypothetical protein	NA	NA	NA	NA	NA
BBE41394.1|3300_3858_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	56.6	1.9e-30
BBE41395.1|3931_4420_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	58.0	3.5e-49
BBE41396.1|4748_5132_-	hypothetical protein	NA	NA	NA	NA	NA
BBE41397.1|5344_5707_+	hypothetical protein	NA	A0A2H4JFS1	uncultured_Caudovirales_phage	29.1	6.7e-05
BBE41398.1|5681_6059_+	hypothetical protein	NA	J7KDQ1	Streptococcus_phage	40.9	1.8e-13
BBE41399.1|6373_6634_+|transposase	transposase	transposase	NA	NA	NA	NA
BBE41400.1|6630_7485_+|integrase	integrase core domain protein	integrase	A0A1P8CWQ3	Bacillus_phage	41.4	9.5e-50
BBE41401.1|7495_7720_-	hypothetical protein	NA	NA	NA	NA	NA
7486:7541	attR	AATAAATAGATTAAAATTCTACGTTTGTTACTCTAAAAACTTGACTTAACCTCACC	NA	NA	NA	NA
BBE41402.1|8276_9131_+	DNA-damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	52.0	4.0e-56
BBE41403.1|9364_10528_+|transposase	transposase from transposon Tn916	transposase	A0A1X9I5Y5	Streptococcus_phage	45.9	2.9e-86
BBE41404.1|10622_12605_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.3	6.6e-62
>prophage 1
AP018731	Streptococcus dysgalactiae Kdys0611 plasmid pFGCSD5 DNA, complete genome	6198	107	3907	6198	transposase	Wolbachia_phage(50.0%)	6	NA	NA
BBE41409.1|107_380_+	DNA-damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	57.1	7.2e-20
BBE41410.1|680_1241_+	hypothetical protein	NA	A0A1X9I5Y5	Streptococcus_phage	44.6	5.5e-38
BBE41411.1|1321_1750_+|transposase	transposase from transposon Tn916	transposase	A0A1X9I5Y5	Streptococcus_phage	47.9	5.8e-24
BBE41412.1|1888_2362_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	52.0	1.7e-24
BBE41413.1|2405_2867_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	27.9	6.3e-08
BBE41414.1|2866_3907_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	23.6	6.0e-06
