The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
AP019009	Serratia marcescens AS-1 DNA, complete genome	5071908	3427241	3447878	5071908	tail	Klebsiella_phage(23.53%)	22	NA	NA
BBG70341.1|3427241_3429263_-	hypothetical protein	NA	A0A1I9SF20	Klebsiella_phage	46.7	2.0e-29
BBG70342.1|3429259_3430417_-	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	57.8	3.3e-45
BBG70343.1|3430466_3433955_-	host specificity protein	NA	F1C571	Cronobacter_phage	66.2	0.0e+00
BBG70344.1|3434107_3434362_-	hypothetical protein	NA	F1C572	Cronobacter_phage	74.4	1.5e-27
BBG70345.1|3434776_3434878_-	hypothetical protein	NA	NA	NA	NA	NA
BBG70346.1|3435152_3435857_-	peptidase P60	NA	K7PGR2	Enterobacteria_phage	76.2	4.8e-108
BBG70347.1|3435866_3436616_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	64.1	2.2e-95
BBG70348.1|3436628_3436967_-	hypothetical protein	NA	Q6UAW6	Klebsiella_phage	60.0	1.1e-33
BBG70349.1|3436966_3439393_-	hypothetical protein	NA	Q6UAW7	Klebsiella_phage	43.1	2.3e-16
BBG70350.1|3439531_3439897_-	hypothetical protein	NA	Q7Y401	Yersinia_phage	44.2	1.9e-23
BBG70351.1|3440013_3440469_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	74.8	1.2e-56
BBG70352.1|3440510_3440903_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	46.8	9.4e-21
BBG70353.1|3440899_3441289_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	42.1	4.8e-25
BBG70354.1|3441345_3441786_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	63.4	2.0e-43
BBG70355.1|3441782_3442088_-	hypothetical protein	NA	F1C5D1	Cronobacter_phage	81.6	2.4e-40
BBG70356.1|3442891_3443254_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	64.6	2.7e-38
BBG70357.1|3443496_3444174_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	44.6	6.0e-07
BBG70358.1|3444576_3444906_-	transcriptional regulator	NA	NA	NA	NA	NA
BBG70359.1|3445033_3445501_-	hypothetical protein	NA	NA	NA	NA	NA
BBG70360.1|3445607_3446186_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
BBG70361.1|3446179_3446596_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
BBG70362.1|3446747_3447878_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	53.9	1.4e-104
>prophage 2
AP019009	Serratia marcescens AS-1 DNA, complete genome	5071908	4376564	4417369	5071908	tRNA,tail,plate,integrase,head,portal,terminase,capsid	Erwinia_phage(50.0%)	50	4383195:4383243	4417462:4417510
BBG71208.1|4376564_4377578_-|tRNA	tRNA N6-adenosine threonylcarbamoyltransferase	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.2e-109
BBG71209.1|4377903_4378119_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
BBG71210.1|4378255_4380004_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.6	2.5e-73
BBG71211.1|4380161_4382003_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
BBG71212.1|4382058_4382511_-	polyketide cyclase	NA	NA	NA	NA	NA
BBG71213.1|4382528_4383017_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4383195:4383243	attL	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATT	NA	NA	NA	NA
BBG71214.1|4383439_4383670_-	prophage late control protein OgrK	NA	Q37973	Salmonella_virus	64.5	9.4e-21
BBG71215.1|4383753_4384914_-	late control protein D	NA	A0A218M4J7	Erwinia_phage	62.6	7.1e-125
BBG71216.1|4384910_4385393_-|tail	tail assembly protein	tail	A0A0F7LDE8	Escherichia_phage	62.8	7.5e-52
BBG71217.1|4385398_4388245_-	hypothetical protein	NA	A0A0M3UL85	Salmonella_phage	50.7	2.0e-107
BBG71218.1|4388392_4388674_-	hypothetical protein	NA	A0A0F7LDQ8	Escherichia_phage	70.1	1.4e-26
BBG71219.1|4388728_4389238_-|tail	major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.2	1.7e-70
BBG71220.1|4389253_4390423_-|tail	tail sheath protein	tail	F1BUU3	Erwinia_phage	81.7	1.8e-184
BBG71221.1|4391152_4391371_+	hypothetical protein	NA	NA	NA	NA	NA
BBG71222.1|4391387_4391486_+	hypothetical protein	NA	NA	NA	NA	NA
BBG71223.1|4391538_4392084_-	hypothetical protein	NA	A0A222YWC2	Escherichia_phage	44.1	6.5e-36
BBG71224.1|4392085_4394704_-	hypothetical protein	NA	Q858V4	Yersinia_virus	54.4	1.4e-59
BBG71225.1|4394713_4395247_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.0	4.8e-76
BBG71226.1|4395239_4396148_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	68.5	5.6e-109
BBG71227.1|4396152_4396503_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	67.2	3.8e-37
BBG71228.1|4396499_4396640_-	hypothetical protein	NA	NA	NA	NA	NA
BBG71229.1|4396650_4397280_-|plate	baseplate assembly protein	plate	A0A0M4S6F6	Salmonella_phage	71.5	1.6e-75
BBG71230.1|4397352_4397799_-	virion morphogenesis protein	NA	O80313	Escherichia_phage	57.7	7.9e-40
BBG71231.1|4397785_4398262_-|tail	tail fiber protein	tail	F1BUP9	Erwinia_phage	64.1	3.4e-49
BBG71232.1|4398357_4398786_-	lysozyme	NA	F1BUQ1	Erwinia_phage	36.6	7.1e-14
BBG71233.1|4398782_4399295_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	66.9	1.5e-58
BBG71234.1|4399278_4399488_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.5	2.6e-09
BBG71235.1|4399492_4399696_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	68.7	2.4e-20
BBG71236.1|4399695_4400184_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	54.3	1.1e-39
BBG71237.1|4400277_4400937_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.4	5.2e-80
BBG71238.1|4400939_4402118_-|capsid	phage capsid protein	capsid	F1BUQ8	Erwinia_phage	78.9	1.7e-158
BBG71239.1|4402160_4402976_-|capsid	phage capsid protein	capsid	S4TP53	Salmonella_phage	53.8	1.9e-71
BBG71240.1|4403082_4404891_+	oxidoreductase	NA	F1BUR2	Erwinia_phage	81.5	1.9e-289
BBG71241.1|4404890_4405925_+|portal	phage portal vertex protein	portal	F1BUR7	Erwinia_phage	79.8	5.0e-162
BBG71242.1|4405969_4406314_-	hypothetical protein	NA	NA	NA	NA	NA
BBG71243.1|4407022_4408024_+	hypothetical protein	NA	NA	NA	NA	NA
BBG71244.1|4408023_4409103_+	hypothetical protein	NA	NA	NA	NA	NA
BBG71245.1|4409113_4409257_-	hypothetical protein	NA	NA	NA	NA	NA
BBG71246.1|4410066_4410303_-	hypothetical protein	NA	NA	NA	NA	NA
BBG71247.1|4410341_4412558_-	phage replication protein	NA	A0A0F7LBQ2	Escherichia_phage	58.5	2.0e-240
BBG71248.1|4412554_4412881_-	hypothetical protein	NA	NA	NA	NA	NA
BBG71249.1|4412877_4413195_-	hypothetical protein	NA	NA	NA	NA	NA
BBG71250.1|4413184_4413466_-	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
BBG71251.1|4413641_4413755_-	hypothetical protein	NA	NA	NA	NA	NA
BBG71252.1|4413754_4414066_-	hypothetical protein	NA	NA	NA	NA	NA
BBG71253.1|4414065_4414308_-	hypothetical protein	NA	A0A218M4I9	Erwinia_phage	49.2	2.8e-07
BBG71254.1|4414875_4415385_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	53.6	7.1e-45
BBG71255.1|4415415_4415637_-	hypothetical protein	NA	NA	NA	NA	NA
BBG71256.1|4415746_4416331_+	repressor	NA	F1BUS8	Erwinia_phage	40.2	1.1e-28
BBG71257.1|4416334_4417369_+|integrase	integrase	integrase	F1BUS9	Erwinia_phage	62.9	5.0e-122
4417462:4417510	attR	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATT	NA	NA	NA	NA
>prophage 3
AP019009	Serratia marcescens AS-1 DNA, complete genome	5071908	4698021	4706948	5071908		environmental_Halophage(16.67%)	7	NA	NA
BBG71531.1|4698021_4700100_+	membrane protein	NA	H9YQA8	environmental_Halophage	71.9	1.3e-52
BBG71532.1|4700140_4701358_-	acetylornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	26.1	3.6e-26
BBG71533.1|4701489_4702065_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	62.3	4.0e-68
BBG71534.1|4702137_4703661_-	hypothetical protein	NA	A0A248XCZ8	Klebsiella_phage	42.6	2.5e-77
BBG71535.1|4703812_4704538_-	DNA-binding response regulator	NA	NA	NA	NA	NA
BBG71536.1|4704537_4706223_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	72.7	9.8e-224
BBG71537.1|4706378_4706948_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0S9I2	Catovirus	31.7	1.3e-07
