The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
AP017626	Pleomorphomonas sp. SM30 DNA, complete genome	4841392	660831	672453	4841392	tRNA	uncultured_Mediterranean_phage(80.0%)	12	NA	NA
BBE71045.1|660831_661851_+	beta-hexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	44.2	4.5e-22
BBE71046.1|661904_662774_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	36.3	1.1e-34
BBE71047.1|662770_663481_+	hypothetical protein	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	50.0	5.1e-41
BBE71048.1|663631_664738_+	spermidine/putrescine import ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	35.4	2.0e-31
BBE71049.1|664966_665191_+	Sec-independent protein translocase protein TatA	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	60.7	1.6e-09
BBE71050.1|665269_665821_+	Sec-independent protein translocase protein TatB	NA	NA	NA	NA	NA
BBE71051.1|665817_666630_+	Sec-independent protein translocase protein TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	45.1	1.5e-49
BBE71052.1|666920_667817_+	hypothetical protein	NA	NA	NA	NA	NA
BBE71053.1|667940_669233_+|tRNA	serine-tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.5	1.0e-95
BBE71054.1|669290_670046_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	39.8	3.8e-42
BBE71055.1|670160_670811_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	39.4	1.3e-22
BBE71056.1|670992_672453_+	murein hydrolase activator NlpD precursor	NA	Q8SBN9	Clostridium_phage	37.6	2.8e-17
>prophage 2
AP017626	Pleomorphomonas sp. SM30 DNA, complete genome	4841392	1228303	1239336	4841392		Orpheovirus(14.29%)	11	NA	NA
BBE71557.1|1228303_1228900_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	34.9	5.5e-20
BBE71558.1|1228899_1230099_-	riboflavin biosynthesis protein RibD	NA	A0A1V0SE20	Indivirus	30.3	4.8e-23
BBE71559.1|1230198_1231002_-	hypothetical protein	NA	NA	NA	NA	NA
BBE71560.1|1231237_1231702_+	endoribonuclease L-PSP	NA	M1IDR7	Acanthocystis_turfacea_Chlorella_virus	38.0	5.9e-22
BBE71561.1|1231701_1232457_+	glycerophosphoryl diester phosphodiesterase	NA	A7IVV0	Paramecium_bursaria_Chlorella_virus	32.0	3.7e-05
BBE71562.1|1232541_1232970_-	HIT-like protein	NA	NA	NA	NA	NA
BBE71563.1|1233012_1234161_-	peptidase M15	NA	A0A223VZI6	Agrobacterium_phage	34.7	1.0e-06
BBE71564.1|1234394_1234835_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
BBE71565.1|1235078_1235654_+	cold shock-like protein CspE	NA	A0A1W6JNX5	Morganella_phage	35.8	2.3e-07
BBE71566.1|1235805_1236306_+	hypothetical protein	NA	NA	NA	NA	NA
BBE71567.1|1236339_1239336_-	N-6 DNA Methylase	NA	Q8V6N5	Halorubrum_phage	29.4	8.9e-10
>prophage 3
AP017626	Pleomorphomonas sp. SM30 DNA, complete genome	4841392	1722977	1782024	4841392	protease,tRNA,tail,capsid,portal,terminase,head	Rhodobacter_phage(26.67%)	54	NA	NA
BBE72008.1|1722977_1723439_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
BBE72009.1|1723431_1723680_-	Phd_YefM protein	NA	NA	NA	NA	NA
BBE72010.1|1723746_1724046_-	cupin domain protein	NA	NA	NA	NA	NA
BBE72011.1|1724128_1725622_-	methylmalonate-semialdehyde dehydrogenase [acylating]	NA	NA	NA	NA	NA
BBE72012.1|1725878_1727210_-	omega-amino acid-pyruvate aminotransferase	NA	NA	NA	NA	NA
BBE72013.1|1727387_1727936_+	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
BBE72014.1|1728034_1728934_+	Mrr restriction system protein	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	36.2	3.1e-11
BBE72015.1|1729010_1729670_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
BBE72016.1|1729675_1730626_-	inner membrane protein YtfF	NA	NA	NA	NA	NA
BBE72017.1|1730919_1732056_+	endoglucanase 3 precursor	NA	NA	NA	NA	NA
BBE72018.1|1732208_1733516_-	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
BBE72019.1|1733695_1735072_-	MauM, putative ferredoxin-type protein essential for electron transfer	NA	NA	NA	NA	NA
BBE72020.1|1735447_1737376_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72021.1|1737481_1739707_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
BBE72022.1|1740118_1740475_+	hypothetical protein	NA	NA	NA	NA	NA
BBE72023.1|1740582_1743225_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	23.6	1.9e-19
BBE72024.1|1743487_1745929_+	non-motile and phage-resistance protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	36.4	1.5e-23
BBE72025.1|1746079_1746514_+	hypothetical protein	NA	NA	NA	NA	NA
BBE72026.1|1746510_1746939_+	hypothetical protein	NA	NA	NA	NA	NA
BBE72027.1|1746954_1749921_-	glutamate-ammonia-ligase adenylyltransferase	NA	NA	NA	NA	NA
BBE72028.1|1749901_1751386_-	sensor kinase CusS	NA	NA	NA	NA	NA
BBE72029.1|1751372_1752065_-	transcriptional regulatory protein CusR	NA	NA	NA	NA	NA
BBE72030.1|1752277_1753816_-|protease	putative periplasmic serine endoprotease DegP-like precursor	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.9	3.4e-21
BBE72031.1|1753962_1754457_-	cytochrome c-type biogenesis protein CcmH precursor	NA	NA	NA	NA	NA
BBE72032.1|1754462_1756445_-	cytochrome c-type biogenesis protein CcmF	NA	NA	NA	NA	NA
BBE72033.1|1756470_1756974_-	cytochrome c-type biogenesis protein CcmE	NA	NA	NA	NA	NA
BBE72034.1|1757005_1758172_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
BBE72035.1|1758320_1759820_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72036.1|1759997_1760465_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72037.1|1760613_1762020_-	sensor protein PhoQ	NA	NA	NA	NA	NA
BBE72038.1|1762021_1762690_-	transcriptional regulatory protein QseB	NA	NA	NA	NA	NA
BBE72039.1|1762712_1763012_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72040.1|1763089_1763275_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72041.1|1763277_1765512_-	hypothetical protein	NA	A0A0K1LM04	Rhodobacter_phage	38.2	4.7e-08
BBE72042.1|1765495_1767604_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72043.1|1767892_1769383_-	hypothetical protein	NA	A0A0K1LLC1	Rhodobacter_phage	46.4	5.6e-106
BBE72044.1|1769540_1769969_-	gamma-DL-glutamyl hydrolase precursor	NA	F4YXU4	Roseobacter_phage	47.5	2.6e-32
BBE72045.1|1769965_1770847_-	hypothetical protein	NA	A0A1V0DY93	Dinoroseobacter_phage	38.0	3.8e-46
BBE72046.1|1770843_1771485_-	hypothetical protein	NA	A0A0K1Y6G4	Rhodobacter_phage	56.0	1.6e-54
BBE72047.1|1771620_1771881_+	hypothetical protein	NA	NA	NA	NA	NA
BBE72048.1|1771905_1772424_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72049.1|1772449_1772590_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72050.1|1772553_1772997_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72051.1|1773011_1773425_-|tail	phage major tail protein 2	tail	NA	NA	NA	NA
BBE72052.1|1773558_1773972_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72053.1|1773968_1774535_-|head,tail	phage gp6-like head-tail connector protein	head,tail	I3UM02	Rhodobacter_phage	33.3	5.2e-12
BBE72054.1|1774645_1775896_-|capsid	phage capsid family protein	capsid	Q3HQT0	Burkholderia_phage	44.0	2.9e-79
BBE72055.1|1775939_1776560_-|head,protease	caudovirus prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	48.0	2.6e-25
BBE72056.1|1776556_1776742_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72057.1|1776843_1777062_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72058.1|1777052_1778249_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	41.9	7.0e-75
BBE72059.1|1778739_1779495_+	bifunctional ligase/repressor BirA	NA	A0A1B0RXM1	Streptococcus_phage	31.9	3.0e-15
BBE72060.1|1780078_1780471_+	glyoxalase-like domain protein	NA	NA	NA	NA	NA
BBE72061.1|1780650_1782024_-|terminase	terminase-like family protein	terminase	A0A0K1LMR9	Caulobacter_phage	43.2	1.3e-77
>prophage 4
AP017626	Pleomorphomonas sp. SM30 DNA, complete genome	4841392	2798697	2862073	4841392	protease,tRNA,integrase,transposase	Pseudomonas_phage(22.22%)	45	2791395:2791448	2849907:2849960
2791395:2791448	attL	AGCACCAGACTACGAATCTGGGGGTCAGGAGTTCGAATCTCTTCGGGCGCGCCA	NA	NA	NA	NA
BBE72963.1|2798697_2803440_+|tRNA	tRNA(Glu)-specific nuclease WapA precursor	tRNA	NA	NA	NA	NA
BBE72964.1|2803867_2804845_-	tyrosine recombinase XerC	NA	NA	NA	NA	NA
BBE72965.1|2804841_2805471_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72966.1|2805824_2806100_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72967.1|2807905_2811931_-	putative deoxyribonuclease RhsA	NA	NA	NA	NA	NA
BBE72968.1|2812702_2813272_-	DNA-invertase hin	NA	A0A219YB42	Aeromonas_phage	42.9	4.9e-26
BBE72969.1|2815072_2815462_+	IS2 repressor TnpA	NA	A0A1B0YZU7	Pseudomonas_phage	44.1	4.2e-21
BBE72970.1|2815458_2816301_+|transposase	IS2 transposase TnpB	transposase	A0A1B0Z042	Pseudomonas_phage	50.0	1.2e-65
BBE72971.1|2816692_2817496_+	hypothetical protein	NA	NA	NA	NA	NA
BBE72972.1|2817608_2819894_-	hypothetical protein	NA	A0A1L2BY82	Clostridium_phage	26.1	6.0e-51
BBE72973.1|2820141_2821290_-	hypothetical protein	NA	A0A2H4J138	uncultured_Caudovirales_phage	52.8	9.6e-106
BBE72974.1|2822984_2823836_+	hypothetical protein	NA	NA	NA	NA	NA
BBE72975.1|2823680_2823992_-	excalibur calcium-binding domain protein	NA	NA	NA	NA	NA
BBE72976.1|2823997_2824618_-	succinoglycan biosynthesis protein ExoI	NA	NA	NA	NA	NA
BBE72977.1|2824659_2827245_-|protease	putative serine protease HtrA	protease	A0A1B1IRH0	uncultured_Mediterranean_phage	33.3	2.8e-12
BBE72978.1|2827241_2827820_-	putative peptidoglycan binding domain protein	NA	NA	NA	NA	NA
BBE72979.1|2827816_2828899_-	radical SAM superfamily protein	NA	NA	NA	NA	NA
BBE72980.1|2828895_2830302_-	molybdenum cofactor biosynthesis protein A	NA	NA	NA	NA	NA
BBE72981.1|2830298_2830550_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72982.1|2830725_2831430_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72983.1|2831591_2833439_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72984.1|2833510_2834284_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72985.1|2834283_2834961_-	von Willebrand factor type A domain protein	NA	NA	NA	NA	NA
BBE72986.1|2835610_2836861_+	hypothetical protein	NA	NA	NA	NA	NA
BBE72987.1|2836906_2837683_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72988.1|2837731_2839471_-|transposase	transposase	transposase	NA	NA	NA	NA
BBE72989.1|2840488_2840800_+	hypothetical protein	NA	NA	NA	NA	NA
BBE72990.1|2840948_2841710_-|integrase	integrase core domain protein	integrase	S5WIU1	Leptospira_phage	37.5	2.6e-22
BBE72991.1|2842350_2843982_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72992.1|2844471_2845188_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72993.1|2845384_2846305_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72994.1|2846441_2847137_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72995.1|2847179_2847917_-	hypothetical protein	NA	NA	NA	NA	NA
BBE72996.1|2848543_2849776_-	tyrosine recombinase XerD	NA	A0A221SAN4	Ralstonia_phage	30.4	1.1e-38
BBE72997.1|2850056_2850878_+	hypothetical protein	NA	NA	NA	NA	NA
2849907:2849960	attR	AGCACCAGACTACGAATCTGGGGGTCAGGAGTTCGAATCTCTTCGGGCGCGCCA	NA	NA	NA	NA
BBE72998.1|2850913_2851999_-|protease	putative zinc metalloprotease Rip3	protease	NA	NA	NA	NA
BBE72999.1|2852152_2853730_-	alkaline phosphatase D precursor	NA	NA	NA	NA	NA
BBE73000.1|2853950_2855144_+	hypothetical protein	NA	NA	NA	NA	NA
BBE73001.1|2855208_2856432_-	argininosuccinate synthase	NA	NA	NA	NA	NA
BBE73002.1|2856507_2857332_-	PAP2 superfamily protein	NA	NA	NA	NA	NA
BBE73003.1|2857469_2857850_+	hypothetical protein	NA	A0A2I7S9Z5	Vibrio_phage	38.6	2.6e-07
BBE73004.1|2857982_2858957_-	phthiocerol synthesis polyketide synthase type IPpsC	NA	NA	NA	NA	NA
BBE73005.1|2859060_2859627_-	ECF RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
BBE73006.1|2860009_2860525_+	hypothetical protein	NA	NA	NA	NA	NA
BBE73007.1|2860651_2862073_+|protease	intracellular serine protease	protease	NA	NA	NA	NA
>prophage 5
AP017626	Pleomorphomonas sp. SM30 DNA, complete genome	4841392	4351570	4359104	4841392	portal,terminase	Wolbachia_phage(33.33%)	7	NA	NA
BBE74351.1|4351570_4352134_+	hypothetical protein	NA	A0A068C985	Rhizobium_phage	30.4	7.0e-09
BBE74352.1|4352130_4354104_+|terminase	phage terminase large subunit GpA	terminase	A0A0A8ILA6	Aurantimonas_phage	49.1	2.4e-165
BBE74353.1|4354111_4354357_+	hypothetical protein	NA	NA	NA	NA	NA
BBE74354.1|4354353_4356015_+|portal	phage portal protein, lambda family	portal	A0A291AUL8	Sinorhizobium_phage	35.7	4.8e-74
BBE74355.1|4356039_4357563_+	putative signal peptide peptidase SppA	NA	K4HZZ6	Acidithiobacillus_phage	41.9	4.1e-27
BBE74356.1|4357599_4357980_+	hypothetical protein	NA	A0A1B2LRT0	Wolbachia_phage	38.9	3.3e-10
BBE74357.1|4358051_4359104_+	hypothetical protein	NA	Q9JMM2	Wolbachia_phage	45.7	5.8e-73
