The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
AP018824	Acinetobacter ursingii M3 DNA, chromosome 1, complete geonome	3429552	147	27507	3429552	integrase,plate,terminase,tail,portal	Pseudomonas_phage(19.23%)	39	NA	NA
BBF76057.1|147_792_-|plate	phage baseplate assembly protein	plate	V5YUM9	Pseudomonas_phage	41.5	3.6e-25
BBF76058.1|788_1349_-	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	41.1	1.7e-31
BBF76059.1|1324_1852_-	phage protein	NA	A0A088FVG9	Escherichia_phage	38.3	4.5e-18
BBF76060.1|1838_2174_-	hypothetical protein	NA	A0A193GYM3	Enterobacter_phage	50.0	2.7e-24
BBF76061.1|2173_2470_-	hypothetical protein	NA	A0A193GYL0	Enterobacter_phage	47.9	1.6e-12
BBF76062.1|2510_4532_-	phage protein	NA	D5LH01	Escherichia_phage	51.6	4.2e-181
BBF76063.1|4521_4854_-	hypothetical protein	NA	NA	NA	NA	NA
BBF76064.1|4853_6428_-|portal	phage-related portal protein	portal	A0A088FVG5	Escherichia_phage	60.7	5.6e-173
BBF76065.1|6433_6730_-	hypothetical protein	NA	A0A088FQK4	Escherichia_phage	56.8	5.4e-21
BBF76066.1|7093_8896_-	hypothetical protein	NA	NA	NA	NA	NA
BBF76067.1|8914_10888_-|terminase	phage terminase, large subunit	terminase	V5YTA4	Pseudomonas_phage	68.5	5.6e-255
BBF76068.1|10880_11384_-	phage-related protein	NA	V5YUM0	Pseudomonas_phage	50.9	2.5e-34
BBF76069.1|11547_11994_-|plate,tail	T4-like phage baseplate hub + tail lysozyme	plate,tail	A0A1I9L2K1	Xanthomonas_phage	57.2	7.4e-38
BBF76070.1|11993_12362_-	hypothetical protein	NA	V5YTL8	Pseudomonas_phage	40.2	1.1e-07
BBF76071.1|12470_12860_-	hypothetical protein	NA	V5YTF6	Pseudomonas_phage	37.8	2.7e-12
BBF76072.1|12862_13297_-	hypothetical protein	NA	G3EN88	Psychrobacter_phage	43.0	5.9e-24
BBF76073.1|13293_13686_-	hypothetical protein	NA	A0A2H4JE05	uncultured_Caudovirales_phage	37.1	4.4e-10
BBF76074.1|13678_14260_-	hypothetical protein	NA	NA	NA	NA	NA
BBF76075.1|14246_14420_-	hypothetical protein	NA	NA	NA	NA	NA
BBF76076.1|14416_15016_-	hypothetical protein	NA	NA	NA	NA	NA
BBF76077.1|15012_15891_-	hypothetical protein	NA	A0A0P0IKQ2	Acinetobacter_phage	85.4	2.2e-57
BBF76078.1|15887_16973_-	DNA-cytosine methyltransferase	NA	Q6V7R9	Burkholderia_virus	40.2	5.1e-56
BBF76079.1|16969_17683_-	phage DNA binding protein Roi	NA	A0A1X9SFG7	Acinetobacter_phage	51.1	1.2e-18
BBF76080.1|17728_18220_-	hypothetical protein	NA	NA	NA	NA	NA
BBF76081.1|18647_19406_+	phage repressor	NA	C8CLH0	Xylella_phage	35.2	1.1e-12
BBF76082.1|19619_19955_+	translation elongation factor	NA	U5P4J6	Shigella_phage	45.6	3.5e-16
BBF76083.1|20006_20834_+	phage protein	NA	NA	NA	NA	NA
BBF76084.1|20907_21093_+	hypothetical protein	NA	NA	NA	NA	NA
BBF76085.1|21322_22297_+	hypothetical protein	NA	NA	NA	NA	NA
BBF76086.1|22293_22917_+	hypothetical protein	NA	A0A220NQL7	Acinetobacter_phage	37.8	5.5e-31
BBF76087.1|23018_23171_+	hypothetical protein	NA	NA	NA	NA	NA
BBF76088.1|23170_23332_+	hypothetical protein	NA	NA	NA	NA	NA
BBF76089.1|23398_23677_+	hypothetical protein	NA	A0A0R6PH27	Moraxella_phage	47.6	1.6e-14
BBF76090.1|24080_24248_+|integrase	phage related integrase	integrase	NA	NA	NA	NA
BBF76091.1|24567_24852_+	mobile element protein	NA	NA	NA	NA	NA
BBF76092.1|24899_25706_+	mobile element protein	NA	U5P429	Shigella_phage	58.2	2.1e-83
BBF76093.1|25893_26577_-	mobile element protein	NA	U5P429	Shigella_phage	42.2	8.7e-46
BBF76094.1|26759_27053_-	mobile element protein	NA	Q9ETV7	Enterobacteria_phage	39.1	1.2e-07
BBF76095.1|27099_27507_+	3-oxoacyl-[acyl-carrier protein] reductase	NA	A0A0M4JSW6	Mollivirus	33.1	1.9e-08
>prophage 2
AP018824	Acinetobacter ursingii M3 DNA, chromosome 1, complete geonome	3429552	1193853	1202296	3429552		Enterobacteria_phage(33.33%)	9	NA	NA
BBF77210.1|1193853_1194759_+	dTDP-5-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	33.5	3.1e-27
BBF77211.1|1194760_1195657_+	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	68.3	2.7e-111
BBF77212.1|1195724_1196291_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	52.8	1.4e-46
BBF77213.1|1196294_1197584_+	membrane protein	NA	NA	NA	NA	NA
BBF77214.1|1197587_1198484_+	polyprotein	NA	A0A0N7KVX0	Yellowstone_lake_phycodnavirus	30.0	1.2e-23
BBF77215.1|1198511_1199471_+	hypothetical protein	NA	NA	NA	NA	NA
BBF77216.1|1199422_1200217_+	glycosyltransferase	NA	A0A1V0S9H0	Catovirus	24.7	8.3e-08
BBF77217.1|1200370_1201312_-	lipopolysaccharide core biosynthesis protein RfaS	NA	NA	NA	NA	NA
BBF77218.1|1201312_1202296_-	glycosyltransferase	NA	B6EFC4	Stygiolobus_rod-shaped_virus	33.3	1.7e-05
>prophage 3
AP018824	Acinetobacter ursingii M3 DNA, chromosome 1, complete geonome	3429552	2314689	2328542	3429552	protease	Acinetobacter_phage(72.73%)	13	NA	NA
BBF78236.1|2314689_2315238_-	GTP cyclohydrolase I type 1	NA	A0A0P0HSD2	Acinetobacter_phage	94.5	3.4e-93
BBF78237.1|2315597_2317097_+	xanthine dehydrogenase iron-sulfur subunit	NA	A0A0P0IVM8	Acinetobacter_phage	77.4	1.3e-219
BBF78238.1|2317099_2319478_+	xanthine dehydrogenase, molybdenum binding subunit	NA	A0A0P0I429	Acinetobacter_phage	87.5	0.0e+00
BBF78239.1|2319490_2320468_+	XdhC protein	NA	A0A0P0IKN7	Acinetobacter_phage	67.7	8.4e-119
BBF78240.1|2320478_2321183_-	hypothetical protein	NA	A0A0P0IDT4	Acinetobacter_phage	75.3	2.9e-89
BBF78241.1|2321337_2322348_-	mobile element protein	NA	A0A2K9V2S9	Faecalibacterium_phage	30.4	1.9e-25
BBF78242.1|2322390_2322819_+	hypothetical protein	NA	NA	NA	NA	NA
BBF78243.1|2322856_2323663_-	Indole-3-glycerol phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	87.7	2.2e-128
BBF78244.1|2323673_2324723_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	88.7	5.6e-169
BBF78245.1|2324723_2325308_-	anthranilate synthase, amidotransferase component	NA	A0A0P0IKJ1	Acinetobacter_phage	92.3	4.1e-105
BBF78246.1|2325654_2326281_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.0	4.8e-43
BBF78247.1|2326427_2327186_-	hypothetical protein YbgI	NA	NA	NA	NA	NA
BBF78248.1|2327357_2328542_+|protease	outer membrane stress sensor protease DegS	protease	W5SAB9	Pithovirus	30.3	1.1e-06
>prophage 4
AP018824	Acinetobacter ursingii M3 DNA, chromosome 1, complete geonome	3429552	2607917	2662287	3429552	integrase,protease,transposase	Escherichia_phage(25.0%)	50	2625987:2626004	2669796:2669813
BBF78520.1|2607917_2609483_-|protease	zinc protease	protease	NA	NA	NA	NA
BBF78521.1|2609493_2610861_-	peptidase, M16 family	NA	G3MBJ8	Bacillus_virus	25.6	4.8e-27
BBF78522.1|2611103_2612237_+	signal recognition particle receptor protein FtsY	NA	NA	NA	NA	NA
BBF78523.1|2612243_2612357_-	hypothetical protein	NA	NA	NA	NA	NA
BBF78524.1|2612427_2613024_+	nitroreductase family protein	NA	NA	NA	NA	NA
BBF78525.1|2613248_2613932_+	hypothetical protein	NA	NA	NA	NA	NA
BBF78526.1|2613992_2614289_-	YbgE protein	NA	NA	NA	NA	NA
BBF78527.1|2614413_2615559_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
BBF78528.1|2615555_2617142_-	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
BBF78529.1|2617723_2618335_-	hypothetical protein	NA	NA	NA	NA	NA
BBF78530.1|2618352_2618661_-	iron-sulfur cluster-binding protein, rieske family	NA	NA	NA	NA	NA
BBF78531.1|2618678_2619683_-	ribokinase	NA	NA	NA	NA	NA
BBF78532.1|2620055_2622995_+|protease	metalloprotease, insulinase family	protease	NA	NA	NA	NA
BBF78533.1|2623015_2624209_+	phospholipase A1 precursor outer membrane phospholipase A	NA	NA	NA	NA	NA
BBF78534.1|2624309_2625644_-	potassium uptake protein, integral membrane component, KtrB	NA	NA	NA	NA	NA
BBF78535.1|2625633_2626299_-	Trk system potassium uptake protein TrkA	NA	NA	NA	NA	NA
2625987:2626004	attL	GATGCGCTTTGGTTTTTG	NA	NA	NA	NA
BBF78536.1|2626470_2628009_-	threonine dehydratase biosynthetic	NA	NA	NA	NA	NA
BBF78537.1|2628117_2628789_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
BBF78538.1|2628845_2629463_+	putative predicted metal-dependent hydrolase	NA	NA	NA	NA	NA
BBF78539.1|2629496_2631014_-	hypothetical protein	NA	NA	NA	NA	NA
BBF78540.1|2631464_2632514_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
BBF78541.1|2632587_2633340_+	hypothetical protein	NA	NA	NA	NA	NA
BBF78542.1|2633358_2633772_+|protease	ATP-dependent Clp protease adaptor protein ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
BBF78543.1|2633782_2636059_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.0	9.0e-164
BBF78544.1|2636239_2636422_+	protein of unknown function UPF0060	NA	A0A218MNG8	uncultured_virus	63.6	5.2e-14
BBF78545.1|2636494_2637400_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
BBF78546.1|2637502_2638135_-	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
BBF78547.1|2638879_2639773_+	glutamate aspartate periplasmic binding protein precursor GltI	NA	NA	NA	NA	NA
BBF78548.1|2639876_2640719_+	glutamate aspartate transport system permease protein GltJ	NA	NA	NA	NA	NA
BBF78549.1|2640720_2641398_+	glutamate aspartate transport system permease protein GltJ	NA	NA	NA	NA	NA
BBF78550.1|2641411_2642155_+	glutamate aspartate transport ATP-binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.2	1.2e-29
BBF78551.1|2642269_2643682_-	DcaP protein	NA	NA	NA	NA	NA
BBF78552.1|2644432_2644903_+	transcriptional regulator, AsnC family	NA	NA	NA	NA	NA
BBF78553.1|2644939_2645689_-	hypothetical protein YebC	NA	NA	NA	NA	NA
BBF78554.1|2645800_2646361_-	acyltransferase family protein	NA	NA	NA	NA	NA
BBF78555.1|2646737_2646899_+	hypothetical protein	NA	NA	NA	NA	NA
BBF78556.1|2647055_2649224_-	ferrichrome-iron receptor	NA	NA	NA	NA	NA
BBF78557.1|2649580_2650111_-	bacterioferritin	NA	NA	NA	NA	NA
BBF78558.1|2650907_2651264_+	hypothetical protein	NA	NA	NA	NA	NA
BBF78559.1|2652021_2654949_+	hypothetical protein	NA	NA	NA	NA	NA
BBF78560.1|2655111_2655267_-	type I restriction-modification system, DNA-methyltransferase subunit M	NA	NA	NA	NA	NA
BBF78561.1|2655849_2656080_+	putative DNA binding protein	NA	NA	NA	NA	NA
BBF78562.1|2656459_2657479_+|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	46.4	6.2e-80
BBF78563.1|2657478_2658252_+	mobile element protein	NA	A0A2L1IVB6	Escherichia_phage	57.4	3.7e-77
BBF78564.1|2658337_2658493_+	hypothetical protein	NA	NA	NA	NA	NA
BBF78565.1|2658654_2658924_-	putative DNA binding protein	NA	NA	NA	NA	NA
BBF78566.1|2659024_2659465_+	predicted membrane protein	NA	NA	NA	NA	NA
BBF78567.1|2659552_2660077_+	hypothetical protein	NA	NA	NA	NA	NA
BBF78568.1|2660081_2660423_+	hypothetical protein	NA	NA	NA	NA	NA
BBF78569.1|2661111_2662287_+|integrase	phage integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	31.3	7.2e-32
2669796:2669813	attR	GATGCGCTTTGGTTTTTG	NA	NA	NA	NA
>prophage 5
AP018824	Acinetobacter ursingii M3 DNA, chromosome 1, complete geonome	3429552	3186571	3195163	3429552		Staphylococcus_phage(33.33%)	9	NA	NA
BBF79065.1|3186571_3187789_-	type I restriction-modification system, restriction subunit R	NA	A0A2H4PQP5	Staphylococcus_phage	27.1	2.1e-26
BBF79066.1|3187788_3189357_-	type I restriction-modification system, DNA-methyltransferase subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	56.4	6.8e-163
BBF79067.1|3189560_3190505_-	hypothetical protein	NA	A0A2I2MUI7	uncultured_Caudovirales_phage	63.9	3.1e-78
BBF79068.1|3190624_3191212_-	tellurite resistance protein-related protein	NA	A0A2H4J5G6	uncultured_Caudovirales_phage	88.8	4.5e-35
BBF79069.1|3191284_3191515_-	phage transcriptional regulator, AlpA	NA	NA	NA	NA	NA
BBF79070.1|3191611_3192508_-	hypothetical protein	NA	NA	NA	NA	NA
BBF79071.1|3192646_3193720_-	protein gp50	NA	A0A139ZPJ9	Marinitoga_camini_virus	35.2	7.5e-44
BBF79072.1|3193801_3194050_-	hypothetical protein	NA	NA	NA	NA	NA
BBF79073.1|3194125_3195163_-	mycobacteriophage Barnyard protein gp56	NA	A0A0H4INH5	Stenotrophomonas_phage	38.4	3.8e-61
>prophage 6
AP018824	Acinetobacter ursingii M3 DNA, chromosome 1, complete geonome	3429552	3238945	3249836	3429552		Bacillus_phage(33.33%)	10	NA	NA
BBF79117.1|3238945_3241585_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.3	9.5e-40
BBF79118.1|3241742_3241919_+	conserved hypothetical protein	NA	NA	NA	NA	NA
BBF79119.1|3242174_3242408_+	4Fe-7S ferredoxin	NA	NA	NA	NA	NA
BBF79120.1|3242536_3243256_+	hypothetical protein	NA	NA	NA	NA	NA
BBF79121.1|3243401_3244070_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	40.3	8.3e-25
BBF79122.1|3244189_3245032_-	UspA-related nucleotide-binding protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	32.8	2.5e-34
BBF79123.1|3245176_3245791_-	maltose O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	50.8	1.4e-10
BBF79124.1|3245783_3246380_-	hypothetical protein	NA	A0A1X9I5T8	Streptococcus_phage	38.7	1.2e-22
BBF79125.1|3246495_3247686_-	HlyD family secretion protein	NA	NA	NA	NA	NA
BBF79126.1|3247682_3249836_-	type I secretion system ATPase, LssB family LapB	NA	W8CYL7	Bacillus_phage	23.8	5.7e-27
>prophage 7
AP018824	Acinetobacter ursingii M3 DNA, chromosome 1, complete geonome	3429552	3384944	3429354	3429552	tRNA,integrase,tail,plate	Pseudomonas_phage(17.65%)	41	3388688:3388704	3415635:3415651
BBF79246.1|3384944_3385748_+|tRNA	tRNA pseudouridine synthase A	tRNA	NA	NA	NA	NA
BBF79247.1|3385757_3385889_+	hypothetical protein	NA	NA	NA	NA	NA
BBF79248.1|3385885_3388117_-	isocitrate dehydrogenase	NA	NA	NA	NA	NA
BBF79249.1|3388484_3388883_+	transthyretin family protein	NA	NA	NA	NA	NA
3388688:3388704	attL	TTATCCAGATGAAAAAA	NA	NA	NA	NA
BBF79250.1|3389410_3390721_-	2,7-dienoyl-CoA reductase	NA	NA	NA	NA	NA
BBF79251.1|3390769_3392368_-	oligopeptide transport ATP-binding protein OppF	NA	G9BWD6	Planktothrix_phage	33.5	1.2e-16
BBF79252.1|3392342_3393356_-	oligopeptide transport system permease protein OppC	NA	NA	NA	NA	NA
BBF79253.1|3393355_3394429_-	oligopeptide transport system permease protein OppB	NA	NA	NA	NA	NA
BBF79254.1|3394459_3396340_-	ABC transporter, periplasmic substrate-binding protein	NA	NA	NA	NA	NA
BBF79255.1|3396350_3399593_-	membrane-bound lytic murein transglycosylase D precursor	NA	A0A0A7NU10	Lactobacillus_phage	35.4	3.1e-24
BBF79256.1|3399800_3401279_+	ribonuclease HI	NA	A0A1X9SH08	Bradyrhizobium_phage	38.3	2.1e-36
BBF79257.1|3401508_3403155_+	hypothetical protein	NA	NA	NA	NA	NA
BBF79258.1|3403154_3403901_+	NADH pyrophosphatase	NA	NA	NA	NA	NA
BBF79259.1|3403951_3404836_-	esterase/lipase/thioesterase family protein	NA	NA	NA	NA	NA
BBF79260.1|3404825_3405527_-	21 kDa hemolysin precursor	NA	NA	NA	NA	NA
BBF79261.1|3405595_3406000_-	endonuclease	NA	NA	NA	NA	NA
BBF79262.1|3406012_3406951_-	LppC putative lipoprotein	NA	NA	NA	NA	NA
BBF79263.1|3406963_3407809_+	rRNA small subunit methyltransferase I	NA	M1PLC5	Streptococcus_phage	43.2	5.9e-44
BBF79264.1|3407850_3408105_-	hypothetical protein	NA	NA	NA	NA	NA
BBF79265.1|3408277_3409510_-	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
BBF79266.1|3409506_3410712_-	2-octaprenyl-6-methoxyphenol hydroxylase	NA	NA	NA	NA	NA
BBF79267.1|3410738_3412064_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
BBF79268.1|3412122_3412755_-	putative conserved exported protein precursor	NA	NA	NA	NA	NA
BBF79269.1|3412819_3413392_+	hypothetical protein	NA	NA	NA	NA	NA
BBF79270.1|3413388_3413673_+	Z-ring-associated protein ZapA	NA	NA	NA	NA	NA
BBF79271.1|3414117_3415398_+|integrase	phage related integrase	integrase	A0A0R6PGY7	Moraxella_phage	43.0	1.1e-86
BBF79272.1|3415404_3416391_-	phage protein D	NA	V5YTN9	Pseudomonas_phage	47.3	3.5e-80
3415635:3415651	attR	TTTTTTCATCTGGATAA	NA	NA	NA	NA
BBF79273.1|3416381_3416597_-	hypothetical protein	NA	D5LGY2	Escherichia_phage	52.1	1.3e-11
BBF79274.1|3416596_3417058_-|tail	phage tail protein	tail	A0A088FQM4	Escherichia_phage	53.3	3.9e-34
BBF79275.1|3417057_3419694_-|tail	phage tail length tape-measure protein	tail	A0A1W6JT50	Escherichia_phage	42.0	2.0e-143
BBF79276.1|3419782_3420484_-	hypothetical protein	NA	A0A1B1P9E5	Acinetobacter_phage	54.4	2.7e-66
BBF79277.1|3420819_3421647_-	Antirepressor protein ant	NA	I6S627	Salmonella_phage	46.2	9.8e-52
BBF79278.1|3421993_3422197_+	hypothetical protein	NA	NA	NA	NA	NA
BBF79279.1|3422233_3423037_-	hypothetical protein	NA	NA	NA	NA	NA
BBF79280.1|3423233_3423524_-	hypothetical protein	NA	A0A193GYZ8	Enterobacter_phage	52.6	8.0e-17
BBF79281.1|3423527_3424040_-|tail	phage major tail tube protein	tail	V5YTN5	Pseudomonas_phage	62.0	5.0e-54
BBF79282.1|3424050_3425247_-|tail	phage tail sheath monomer	tail	V5YTI0	Pseudomonas_phage	58.0	7.3e-149
BBF79283.1|3425474_3425738_-	hypothetical protein	NA	NA	NA	NA	NA
BBF79284.1|3425738_3427847_-|tail	phage tail fiber protein	tail	A0A1I9KF43	Aeromonas_phage	46.4	1.1e-25
BBF79285.1|3427849_3428461_-|tail	phage tail fiber	tail	A0A077KER5	Ralstonia_phage	37.6	4.3e-28
BBF79286.1|3428460_3429354_-|plate	baseplate assembly protein J	plate	E5G6N8	Salmonella_phage	47.5	4.4e-66
>prophage 1
AP018825	Acinetobacter ursingii M3 plasmid pAURM-1 DNA, complete geonome	105528	88	9860	105528		uncultured_Caudovirales_phage(55.56%)	12	NA	NA
BBF79287.1|88_1072_-	replication protein	NA	A0A218MNI2	uncultured_virus	37.4	1.2e-43
BBF79288.1|1431_2070_+	chromosome partitioning protein ParA	NA	Q2A085	Sodalis_phage	45.5	9.9e-44
BBF79289.1|2072_2360_+	hypothetical protein	NA	NA	NA	NA	NA
BBF79290.1|2642_2756_-	hypothetical protein	NA	NA	NA	NA	NA
BBF79291.1|3859_4288_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	59.7	8.1e-42
BBF79292.1|4332_4656_+	arsenical resistance operon repressor	NA	A0A2H4J145	uncultured_Caudovirales_phage	62.2	1.1e-22
BBF79293.1|4660_5134_+	arsenate reductase	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	51.9	1.9e-36
BBF79294.1|5139_6180_+	arsenical-resistance protein ACR3	NA	NA	NA	NA	NA
BBF79295.1|6184_6889_+	arsenic resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.8	3.1e-91
BBF79296.1|6907_7858_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	41.8	1.0e-60
BBF79297.1|7954_9040_+	putative monooxygenase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	57.7	7.0e-90
BBF79298.1|9155_9860_+	mobile element protein	NA	A0A077SL39	Escherichia_phage	84.5	5.1e-118
>prophage 2
AP018825	Acinetobacter ursingii M3 plasmid pAURM-1 DNA, complete geonome	105528	75927	87578	105528	transposase,integrase	uncultured_virus(20.0%)	12	75819:75878	97296:97373
75819:75878	attL	GGCAGCATAATTTAAATATTTAGAGCGGATTTATCACTTATAAAACTGAATTGAGTGGTC	NA	NA	NA	NA
BBF79372.1|75927_77127_-|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	29.1	1.2e-39
BBF79373.1|77520_78234_-	phosphoribosyl transferase domain	NA	A0A0R6PHM5	Moraxella_phage	42.1	1.4e-41
BBF79374.1|79092_79803_+	hypothetical protein	NA	NA	NA	NA	NA
BBF79375.1|79815_80922_+	transcriptional regulator, XRE family	NA	A0A0A7RTT7	Clostridium_phage	26.5	1.4e-29
BBF79376.1|81162_81804_+	hypothetical protein	NA	A0A218MNF5	uncultured_virus	53.3	3.4e-52
BBF79377.1|81915_82542_+	error-prone repair protein UmuD	NA	A0A2H4J538	uncultured_Caudovirales_phage	41.0	1.6e-25
BBF79378.1|82622_83852_+	error-prone, lesion bypass DNA polymerase V	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	50.1	9.0e-118
BBF79379.1|83856_84075_+	hypothetical protein	NA	NA	NA	NA	NA
BBF79380.1|84410_85127_-|transposase	putative transposase	transposase	A0A218MNI5	uncultured_virus	46.5	1.4e-46
BBF79381.1|85178_86198_+|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	46.4	6.2e-80
BBF79382.1|86197_86971_+	mobile element protein	NA	A0A2L1IVB6	Escherichia_phage	57.4	3.7e-77
BBF79383.1|86993_87578_-|transposase	putative transposase	transposase	F6MIM4	Haemophilus_phage	54.7	4.7e-08
97296:97373	attR	GGCAGCATAATTTAAATATTTAGAGCGGATTTATCACTTATAAAACTGAATTGAGTGGTCTAATTAACGGAACCACAT	NA	NA	NA	NA
