The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	600553	660477	5678205	integrase,portal,capsid,terminase,tail,lysis,tRNA,transposase,head,protease	Enterobacteria_phage(58.33%)	75	610714:610760	660900:660946
BBF57729.1|600553_601939_+|tRNA	cysteinyl-tRNA synthetase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
BBF57730.1|601974_602496_-	inner membrane protein	NA	NA	NA	NA	NA
BBF57731.1|602603_602816_-	ribosome-associated protein	NA	NA	NA	NA	NA
BBF57732.1|602817_603684_-	5,10-methylene-tetrahydrofolate dehydrogenase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
BBF57733.1|604164_604707_+	type-1 fimbrial protein subunit A	NA	NA	NA	NA	NA
BBF57734.1|604926_605619_+	periplasmic pilus chaperone	NA	NA	NA	NA	NA
BBF57735.1|605649_608259_+	outer membrane usher protein FimD	NA	NA	NA	NA	NA
BBF57736.1|608300_609278_+	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF57737.1|609288_609804_+	fimbrial protein	NA	NA	NA	NA	NA
BBF57738.1|609806_610439_-	response regulator	NA	NA	NA	NA	NA
610714:610760	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
BBF57739.1|610773_611937_-|integrase	integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
BBF57740.1|612135_612414_-	hypothetical protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
BBF57741.1|612461_612680_-	conjugal transfer protein	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
BBF57742.1|612778_612994_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
BBF57743.1|613070_613262_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
BBF57744.1|613234_613417_-	hypothetical protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
BBF57745.1|613413_614094_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
BBF57746.1|614090_614876_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
BBF57747.1|614881_615178_-	phage host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
BBF57748.1|615253_615460_-	phage Kil protein	NA	K7P6H3	Enterobacteria_phage	82.4	1.8e-26
BBF57749.1|616010_616289_-	hypothetical protein	NA	NA	NA	NA	NA
BBF57750.1|616466_616730_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
BBF57751.1|616811_617567_-	phage repressor protein CI	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
BBF57752.1|617605_617836_+	phage regulatory protein Cro	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
BBF57753.1|617905_618445_+	regulatory protein CII	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
BBF57754.1|618441_619461_+	phage replication protein	NA	M1FN81	Enterobacteria_phage	67.0	4.8e-109
BBF57755.1|619457_620159_+	phage replication protein	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
BBF57756.1|620363_620711_-	hypothetical protein	NA	NA	NA	NA	NA
BBF57757.1|621463_622072_+	phage antirepressor	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
BBF57758.1|622371_622788_+	hypothetical protein	NA	NA	NA	NA	NA
BBF57759.1|622766_623168_+	hypothetical protein	NA	NA	NA	NA	NA
BBF57760.1|623389_623845_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
BBF57761.1|623844_624015_+	putative phage protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
BBF57762.1|624007_624298_+	hypothetical protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
BBF57763.1|624294_624657_+	phage endonuclease RUS	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
BBF57764.1|624656_624794_+	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	70.7	1.1e-08
BBF57765.1|624879_625263_+	antiterminator	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
BBF57766.1|625451_626534_-	outer membrane porin protein	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
BBF57767.1|627122_627338_+|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
BBF57768.1|627337_627835_+	phage lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
BBF57769.1|627831_628293_+	phage murein endopeptidase	NA	A0A0K2FJD0	Enterobacteria_phage	98.7	9.2e-76
BBF57770.1|628324_628618_-	Bor protein precursor	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
BBF57771.1|628958_629846_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	98.3	2.2e-166
BBF57772.1|629845_630172_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF57773.1|630872_631418_+	phage DNA packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
BBF57774.1|631392_633318_+|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
BBF57775.1|633314_633521_+|head,tail	phage head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
BBF57776.1|633517_635119_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.0e-310
BBF57777.1|635099_635588_+|head,protease	phage prohead protease	head,protease	A0A0K2FI53	Enterobacteria_phage	99.4	1.9e-79
BBF57778.1|635591_637163_-|transposase	ISCro1 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
BBF57779.1|637182_637530_-|transposase	ISCro1 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
BBF57780.1|637529_638177_-|transposase	ISCro1 transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.1e-21
BBF57781.1|638247_639126_+|head,protease	phage prohead protease	head,protease	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
BBF57782.1|639135_639468_+|head	phage head-DNA stabilization protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
BBF57783.1|639523_640549_+|capsid	phage major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
BBF57784.1|640590_640986_+	phage DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
BBF57785.1|640997_641372_+|head,tail	phage head-tail adaptor protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
BBF57786.1|641362_641941_+|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
BBF57787.1|641937_642333_+|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
BBF57788.1|642340_643081_+|tail	phage major tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
BBF57789.1|643096_643519_+|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
BBF57790.1|643500_643935_+|tail	phage minor tail protein	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
BBF57791.1|643927_646489_+|tail	phage tail length tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
BBF57792.1|646485_646815_+|tail	phage minor tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
BBF57793.1|646814_647513_+|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
BBF57794.1|647518_648169_+|tail	phage tail assembly protein	tail	K7PLW1	Enterobacteria_phage	97.2	3.5e-129
BBF57795.1|648159_648831_+|tail	phage tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.7	3.4e-103
BBF57796.1|648891_652305_+	phage host specificity protein	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
BBF57797.1|652375_652975_+	outer membrane precursor Lom	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
BBF57798.1|653039_656000_+|tail	phage side tail fiber protein	tail	A0A2D1UII2	Escherichia_phage	97.4	6.6e-58
BBF57799.1|655999_656584_+|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
BBF57800.1|656638_657307_-	hypothetical protein	NA	NA	NA	NA	NA
BBF57801.1|657363_657669_+|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
BBF57802.1|657852_659337_-	hydrolase	NA	NA	NA	NA	NA
BBF57803.1|659523_660477_-|protease	outer membrane protease VII	protease	NA	NA	NA	NA
660900:660946	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 2
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	887075	940213	5678205	integrase,portal,terminase,tail,holin,transposase,head,protease	Enterobacteria_phage(53.52%)	76	882823:882838	891208:891223
882823:882838	attL	ATGGCGGCGCGGCAGG	NA	NA	NA	NA
BBF57999.1|887075_888146_-|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
BBF58000.1|888833_889160_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF58001.1|889159_890047_+|transposase	IS629 transposase OrfB	transposase	Q6H9S6	Enterobacteria_phage	99.7	1.2e-169
BBF58002.1|890135_890303_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
BBF58003.1|890375_890660_-	RNA-binding protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
BBF58004.1|890652_890796_-	hypothetical protein	NA	Q716F5	Shigella_phage	93.6	3.2e-19
BBF58005.1|890951_891569_-	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
891208:891223	attR	ATGGCGGCGCGGCAGG	NA	NA	NA	NA
BBF58006.1|891570_892128_-	hypothetical protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
BBF58007.1|892124_892682_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
BBF58008.1|892678_892843_-	hypothetical protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
BBF58009.1|892853_893147_-	ABC transporter ATP-binding protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
BBF58010.1|893170_893554_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
BBF58011.1|893553_894159_-	recombinase	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
BBF58012.1|894169_894340_-	hypothetical protein	NA	A5VWA7	Enterobacteria_phage	100.0	4.2e-26
BBF58013.1|894415_894568_-	phage host killing protein	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
BBF58014.1|894552_894684_-	phage regulatory protein CIII	NA	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
BBF58015.1|894708_895569_-	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
BBF58016.1|895932_896154_+	superinfection exclusion protein	NA	Q76H59	Enterobacteria_phage	58.8	2.5e-18
BBF58017.1|896205_896532_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF58018.1|896531_897419_+|transposase	IS629 transposase OrfB	transposase	Q6H9S6	Enterobacteria_phage	99.7	1.2e-169
BBF58019.1|897402_897729_+	phage regulatory protein CII	NA	A0A0P0ZBJ0	Stx2-converting_phage	98.9	8.6e-44
BBF58020.1|897761_898319_+	phage replication protein	NA	O48421	Enterobacteria_phage	100.0	4.5e-69
BBF58021.1|898258_898633_+	phage replication protein	NA	O48421	Enterobacteria_phage	98.4	4.0e-69
BBF58022.1|898629_899331_+	phage replication protein	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
BBF58023.1|899327_899618_+	phage exclusion protein	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
BBF58024.1|899914_900271_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
BBF58025.1|900242_900653_+	recombination protein	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
BBF58026.1|900649_900826_+	hypothetical protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
BBF58027.1|900828_901029_+	hypothetical protein	NA	G9L690	Escherichia_phage	100.0	2.9e-34
BBF58028.1|901068_901956_-|transposase	IS629 transposase OrfB	transposase	Q6H9S6	Enterobacteria_phage	99.7	1.2e-169
BBF58029.1|901955_902282_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF58030.1|902372_902543_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	5.1e-24
BBF58031.1|902651_903470_-|transposase	IS600 transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
BBF58032.1|903505_903808_-|transposase	IS600 transposase	transposase	NA	NA	NA	NA
BBF58033.1|903971_904694_+	hypothetical protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
BBF58034.1|904693_904984_+	hypothetical protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
BBF58035.1|904980_905343_+	phage endonuclease RUS	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
BBF58036.1|905339_905528_+	phage protein NinH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
BBF58037.1|905739_906699_-	outer membrane protein	NA	NA	NA	NA	NA
BBF58038.1|907173_907863_+	phage antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
BBF58039.1|908047_908791_+	membrane protein	NA	NA	NA	NA	NA
BBF58040.1|909333_909660_+	hypothetical protein	NA	H6WZJ9	Escherichia_phage	85.4	3.3e-35
BBF58041.1|909656_911198_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	97.7	2.2e-299
BBF58042.1|911645_911852_+|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
BBF58043.1|911851_912349_+	phage lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
BBF58044.1|912345_912783_+	phage murein endopeptidase	NA	A0A0P0ZBQ9	Stx2-converting_phage	97.2	1.1e-70
BBF58045.1|912932_913550_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
BBF58046.1|914327_914837_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
BBF58047.1|914808_916737_+|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
BBF58048.1|916720_916927_+|head,tail	phage head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
BBF58049.1|916923_918516_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
BBF58050.1|918505_918682_+|head,protease	phage prohead protease	head,protease	E4WL22	Enterobacteria_phage	56.4	1.1e-08
BBF58051.1|918759_919164_+	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
BBF58052.1|919160_919508_+|transposase	ISEc22 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	99.1	9.7e-62
BBF58053.1|919556_921095_+|transposase	ISEc22 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
BBF58054.1|921010_921253_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58055.1|921304_921460_+|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.4	4.7e-16
BBF58056.1|921467_922220_+|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	94.0	2.0e-128
BBF58057.1|922233_922665_+|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
BBF58058.1|922691_923105_+|tail	phage minor tail protein	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
BBF58059.1|923085_925665_+|tail	phage tail length tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
BBF58060.1|925661_925991_+|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
BBF58061.1|925990_926689_+|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
BBF58062.1|926694_927438_+|tail	phage tail assembly protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
BBF58063.1|927434_928016_+|tail	phage tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.1	3.4e-91
BBF58064.1|928261_931738_+	phage host specificity protein	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
BBF58065.1|931805_932405_+	outer membrane precursor Lom	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
BBF58066.1|932469_933684_+|tail	phage tail fiber protein	tail	B6DZB7	Enterobacteria_phage	95.8	6.6e-81
BBF58067.1|933685_933955_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	96.6	4.6e-43
BBF58068.1|934060_934942_+	T3SS secreted effector NleH	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
BBF58069.1|934976_935090_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58070.1|935158_935992_+	hypothetical protein	NA	A5LH49	Enterobacteria_phage	98.5	9.3e-151
BBF58071.1|936961_938533_-|transposase	ISCro1 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
BBF58072.1|938552_938900_-|transposase	ISCro1 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
BBF58073.1|938899_939547_-|transposase	ISCro1 transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.1e-21
BBF58074.1|939637_940213_+	T3SS secreted effector NleG	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
>prophage 3
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	1169116	1291709	5678205	integrase,portal,capsid,terminase,tail,lysis,tRNA,holin,transposase,head,protease	Escherichia_phage(36.13%)	157	1198757:1198772	1298063:1298078
BBF58276.1|1169116_1169446_-|tRNA	mnm(5)-s(2)U34-tRNA 2-thiolation sulfurtransferase	tRNA	NA	NA	NA	NA
BBF58277.1|1169536_1170196_-	membrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
BBF58278.1|1170603_1171623_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
BBF58279.1|1171600_1171843_-	phage excisionase	NA	NA	NA	NA	NA
BBF58280.1|1171910_1174361_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
BBF58281.1|1174454_1174646_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58282.1|1174642_1174831_-	cell division inhibition protein	NA	NA	NA	NA	NA
BBF58283.1|1175398_1175608_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58284.1|1175608_1176247_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	3.3e-07
BBF58285.1|1176258_1176411_-	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
BBF58286.1|1176967_1177159_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58287.1|1177186_1177588_-	repressor protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
BBF58288.1|1177696_1177969_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
BBF58289.1|1177952_1178378_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58290.1|1178584_1179040_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58291.1|1179118_1180234_+	phage replication protein	NA	V5URT9	Shigella_phage	68.4	3.4e-132
BBF58292.1|1180240_1180987_+	phage DNA replication protein	NA	A0A088CBP4	Shigella_phage	84.6	5.6e-115
BBF58293.1|1181008_1181779_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
BBF58294.1|1181794_1182208_+	phage exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
BBF58295.1|1182559_1183333_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58296.1|1183698_1183836_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
BBF58297.1|1183880_1184093_+	phage maintenance protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
BBF58298.1|1184540_1185590_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
BBF58299.1|1185602_1185974_+	endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
BBF58300.1|1185995_1186334_+	antiterminator	NA	Q777W5	Enterobacteria_phage	84.4	2.7e-48
BBF58301.1|1186485_1187304_+|protease	CAAX amino terminal protease family protein	protease	NA	NA	NA	NA
BBF58302.1|1187590_1187788_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
BBF58303.1|1187894_1188035_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58304.1|1188051_1188639_+	AraC-family transcriptional regulator	NA	NA	NA	NA	NA
BBF58305.1|1189406_1191257_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
BBF58306.1|1191704_1191911_+|holin	phage holine protein	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
BBF58307.1|1192166_1192403_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58308.1|1192598_1193132_+	phage endolysin	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
BBF58309.1|1193352_1193466_+	putative phage protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
BBF58310.1|1193467_1193935_+	phage endopeptidase	NA	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
BBF58311.1|1194399_1194714_+	PchABC family transcriptional regulator	NA	NA	NA	NA	NA
BBF58312.1|1195416_1195962_+	phage DNA packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
BBF58313.1|1195936_1197862_+|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
BBF58314.1|1197858_1198065_+|head,tail	phage head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
BBF58315.1|1198061_1199663_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
1198757:1198772	attL	GTTCATTCACGTCTTT	NA	NA	NA	NA
BBF58316.1|1199643_1200963_+|head,protease	phage prohead protease	head,protease	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
BBF58317.1|1200972_1201305_+|head	phage head-DNA stabilization protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
BBF58318.1|1201360_1202386_+|capsid	phage major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
BBF58319.1|1202427_1202823_+	phage DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
BBF58320.1|1202834_1203188_+|head,tail	phage head-tail adaptor protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
BBF58321.1|1203199_1203778_+|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
BBF58322.1|1203774_1204170_+|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
BBF58323.1|1204177_1204930_+|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	98.8	4.2e-134
BBF58324.1|1204943_1205366_+|tail	phage minor tail protein	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
BBF58325.1|1205392_1205806_+|tail	phage minor tail protein	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
BBF58326.1|1205786_1208399_+|tail	phage tail length tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
BBF58327.1|1208395_1208725_+|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BBF58328.1|1208724_1209423_+|tail	phage minor tail protein	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
BBF58329.1|1209433_1210177_+|tail	phage tail assembly protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
BBF58330.1|1210173_1210755_+|tail	phage tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	90.6	3.6e-85
BBF58331.1|1210990_1214467_+	phage host specificity protein	NA	Q6H9T2	Enterobacteria_phage	98.0	0.0e+00
BBF58332.1|1214535_1215159_+	outer membrane protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
BBF58333.1|1215223_1216438_+|tail	phage tail fiber protein	tail	B6DZB7	Enterobacteria_phage	95.3	1.6e-79
BBF58334.1|1216439_1216709_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	97.8	2.1e-43
BBF58335.1|1216833_1217586_-	T3SS secreted effector TccP2	NA	NA	NA	NA	NA
BBF58336.1|1217901_1218084_-	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
BBF58337.1|1218389_1218968_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	54.9	2.0e-51
BBF58338.1|1219141_1219417_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	98.9	3.5e-46
BBF58339.1|1219416_1220304_+|transposase	IS629 transposase OrfB	transposase	Q6H9S6	Enterobacteria_phage	99.7	1.2e-169
BBF58340.1|1220343_1220721_-|integrase	integrase	integrase	NA	NA	NA	NA
BBF58341.1|1220698_1220941_-	phage excisionase	NA	NA	NA	NA	NA
BBF58342.1|1221008_1223459_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
BBF58343.1|1223738_1223927_-	cell division inhibition protein	NA	NA	NA	NA	NA
BBF58344.1|1224327_1224492_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58345.1|1224495_1224714_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58346.1|1224806_1225007_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58347.1|1225420_1225723_+	toxin RelE	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
BBF58348.1|1225725_1226085_+	transcription regulator	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
BBF58349.1|1226131_1226524_-	repressor protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
BBF58350.1|1226650_1226911_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
BBF58351.1|1226907_1227345_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
BBF58352.1|1227431_1228442_+	replication protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
BBF58353.1|1228434_1228896_+	phage replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	2.0e-78
BBF58354.1|1228929_1229655_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
BBF58355.1|1229670_1230063_+	phage exclusion protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
BBF58356.1|1230059_1230356_+	hypothetical protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
BBF58357.1|1230352_1230814_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
BBF58358.1|1230791_1231148_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
BBF58359.1|1231198_1231411_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	98.6	2.5e-36
BBF58360.1|1231444_1231627_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
BBF58361.1|1231619_1231796_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	100.0	4.6e-28
BBF58362.1|1231792_1232428_+	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
BBF58363.1|1232515_1232734_+	hypothetical protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
BBF58364.1|1232735_1233101_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
BBF58365.1|1233097_1233442_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
BBF58366.1|1233646_1233946_-	plasmid stabilization protein	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
BBF58367.1|1233951_1234209_-	transcriptional regulator	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
BBF58368.1|1234344_1234617_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
BBF58369.1|1234618_1235665_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
BBF58370.1|1235677_1236037_+	phage endonuclease RUS	NA	V5URS4	Shigella_phage	60.0	1.8e-34
BBF58371.1|1236045_1236576_+	phage antiterminator	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
BBF58372.1|1236817_1237015_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
BBF58373.1|1237275_1237863_+	phage regulatory protein	NA	NA	NA	NA	NA
BBF58374.1|1238312_1238744_+	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
BBF58375.1|1238740_1238908_+	hypothetical protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
BBF58376.1|1239221_1241159_+	hypothetical protein	NA	Q6H9W1	Enterobacteria_phage	97.1	0.0e+00
BBF58377.1|1241294_1241474_+	hypothetical protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
BBF58378.1|1241514_1241760_+	hypothetical protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
BBF58379.1|1241837_1242053_+|lysis	phage lysis protein	lysis	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
BBF58380.1|1242057_1242591_+	phage endolysin	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
BBF58381.1|1242865_1243435_+	phage antirepressor	NA	A0A2R2Z339	Escherichia_phage	98.9	3.4e-104
BBF58382.1|1243434_1243584_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
BBF58383.1|1243591_1244059_+	phage endopeptidase	NA	Q7AYI6	Enterobacteria_phage	88.3	2.1e-67
BBF58384.1|1244522_1244837_+	PchABC family transcriptional regulator	NA	NA	NA	NA	NA
BBF58385.1|1244918_1245143_-	hypothetical protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
BBF58386.1|1245184_1245550_+	DNase	NA	B6ETE5	Enterobacteria_phage	95.9	5.4e-63
BBF58387.1|1245840_1246404_+|terminase	phage terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
BBF58388.1|1246400_1248062_+|terminase	phage terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
BBF58389.1|1248125_1250063_+|head,protease	phage prohead protease	head,protease	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
BBF58390.1|1250107_1250329_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
BBF58391.1|1250274_1251639_+|portal	phage portal protein	portal	A0A0P0ZCX8	Stx2-converting_phage	98.2	8.4e-258
BBF58392.1|1251635_1252859_+|portal	phage portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	100.0	1.7e-105
BBF58393.1|1252855_1253182_+	phage DNA packaging protein	NA	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
BBF58394.1|1253192_1253543_+|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BBF58395.1|1253539_1253986_+|tail	phage minor tail protein	tail	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
BBF58396.1|1253982_1254327_+|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
BBF58397.1|1254392_1255109_+|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
BBF58398.1|1255114_1255489_+|tail	phage tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	1.7e-64
BBF58399.1|1255584_1255794_+|tail	phage tail protein	tail	H6WZM0	Escherichia_phage	100.0	1.5e-33
BBF58400.1|1255841_1259084_+|tail	phage tail length tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.2	0.0e+00
BBF58401.1|1259076_1259418_+|tail	phage minor tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
BBF58402.1|1259417_1260116_+|tail	phage minor tail protein	tail	Q6H9T5	Enterobacteria_phage	99.1	1.6e-132
BBF58403.1|1260132_1260453_-	regulatory protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
BBF58404.1|1260560_1260734_+	transcriptional regulator	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
BBF58405.1|1260723_1261728_+	antirepressor	NA	A0A0N7KZK0	Stx2-converting_phage	98.2	3.0e-188
BBF58406.1|1261782_1262520_+|tail	phage tail assembly protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	7.2e-147
BBF58407.1|1262516_1263098_+|tail	phage tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.7	2.5e-94
BBF58408.1|1263343_1266820_+	phage host specificity protein	NA	Q687E8	Enterobacteria_phage	95.7	0.0e+00
BBF58409.1|1266886_1267486_+	outer membrane precursor Lom	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	1.3e-109
BBF58410.1|1267550_1268864_+|tail	phage tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	4.8e-77
BBF58411.1|1268865_1269135_+	hypothetical protein	NA	A0A1I9LJT0	Stx_converting_phage	96.6	4.2e-44
BBF58412.1|1269370_1269730_-	phage antirepressor	NA	V5URG2	Shigella_phage	96.6	3.6e-43
BBF58413.1|1270690_1270864_+	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
BBF58414.1|1270946_1272275_-	pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
BBF58415.1|1272295_1272790_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
BBF58416.1|1272800_1273391_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
BBF58417.1|1273400_1274201_-	reactive intermediate detoxifying aminoacrylate hydrolase	NA	NA	NA	NA	NA
BBF58418.1|1274208_1274595_-	aminoacrylate deaminase	NA	NA	NA	NA	NA
BBF58419.1|1274606_1275302_-	ureidoacrylate amidohydrolase	NA	NA	NA	NA	NA
BBF58420.1|1275298_1276390_-	pyrimidine oxygenase	NA	NA	NA	NA	NA
BBF58421.1|1276677_1277316_+	transcriptional regulator	NA	NA	NA	NA	NA
BBF58422.1|1277355_1281318_-	bifunctional proline dehydrogenase/pyrroline-5-carboxylate dehydrogenase	NA	NA	NA	NA	NA
BBF58423.1|1281372_1281582_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58424.1|1281740_1283249_+	proline:sodium symporter	NA	NA	NA	NA	NA
BBF58425.1|1283914_1284745_+	high-affinity Fe2+/Pb2+ permease	NA	NA	NA	NA	NA
BBF58426.1|1284802_1285930_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
BBF58427.1|1285935_1287207_+	deferrochelatase	NA	NA	NA	NA	NA
BBF58428.1|1287550_1287847_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58429.1|1287825_1288614_+	PhoH family P-loop ATPase	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
BBF58430.1|1289194_1289881_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58431.1|1289792_1290395_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58432.1|1290506_1291709_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
1298063:1298078	attR	AAAGACGTGAATGAAC	NA	NA	NA	NA
>prophage 4
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	1301852	1347760	5678205	transposase	Stx2-converting_phage(27.78%)	54	NA	NA
BBF58439.1|1301852_1303385_-|transposase	ISEc8 transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	7.1e-298
BBF58440.1|1303434_1303782_-|transposase	ISEc8 transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BBF58441.1|1303778_1304159_-	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BBF58442.1|1304234_1304546_-|transposase	IS30 transposase	transposase	NA	NA	NA	NA
BBF58443.1|1304685_1305504_+|transposase	IS600 transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	6.9e-66
BBF58444.1|1305616_1306156_+	complement resistance protein precursor TraT	NA	NA	NA	NA	NA
BBF58445.1|1306203_1306455_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58446.1|1306478_1306769_-	restriction endonuclease	NA	NA	NA	NA	NA
BBF58447.1|1307454_1307814_+	diacylglycerol kinase	NA	NA	NA	NA	NA
BBF58448.1|1307906_1309526_-	membrane-associated metal-dependent hydrolase	NA	NA	NA	NA	NA
BBF58449.1|1309788_1310025_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58450.1|1310405_1311185_+	urease accessory protein	NA	NA	NA	NA	NA
BBF58451.1|1311194_1311497_+	urease subunit gamma	NA	NA	NA	NA	NA
BBF58452.1|1311505_1311826_+	urease subunit beta	NA	NA	NA	NA	NA
BBF58453.1|1311851_1313522_+	urease subunit alpha	NA	NA	NA	NA	NA
BBF58454.1|1313531_1313996_+	urease accessory protein	NA	NA	NA	NA	NA
BBF58455.1|1313996_1314671_+	urease accessory protein	NA	NA	NA	NA	NA
BBF58456.1|1314682_1315300_+	urease accessory protein	NA	NA	NA	NA	NA
BBF58457.1|1315338_1315602_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58458.1|1315555_1315897_-|transposase	IS600 transposase OrfA	transposase	NA	NA	NA	NA
BBF58459.1|1315958_1316087_-	complement resistance protein precursor TraT	NA	NA	NA	NA	NA
BBF58460.1|1316509_1316773_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
BBF58461.1|1317074_1317215_+	hypothetical protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
BBF58462.1|1318085_1318757_-	membrane protein	NA	NA	NA	NA	NA
BBF58463.1|1320139_1320625_-	hypothetical protein	NA	A0A218MNE7	uncultured_virus	42.0	9.5e-31
BBF58464.1|1320944_1321370_+|transposase	IS682 transposase	transposase	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
BBF58465.1|1321366_1321717_+|transposase	IS682 transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
BBF58466.1|1321747_1323361_+|transposase	IS682 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
BBF58467.1|1323364_1324222_-|transposase	transposase	transposase	S5VLC8	Leptospira_phage	30.4	6.6e-27
BBF58468.1|1324264_1324645_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58469.1|1324631_1324961_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58470.1|1325221_1325689_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
BBF58471.1|1325706_1326915_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58472.1|1326925_1327882_-	ATP synthase	NA	NA	NA	NA	NA
BBF58473.1|1327881_1328961_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
BBF58474.1|1328962_1329736_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58475.1|1329728_1330871_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
BBF58476.1|1330880_1331939_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58477.1|1332261_1332843_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
BBF58478.1|1332842_1334000_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
BBF58479.1|1334022_1334478_+	tellurium resistance protein TerB	NA	NA	NA	NA	NA
BBF58480.1|1334500_1335541_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
BBF58481.1|1335589_1336168_+	tellurium resistance protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
BBF58482.1|1336236_1336812_+	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	3.0e-31
BBF58483.1|1337234_1337621_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
BBF58484.1|1338134_1340225_-	bifunctional enterobactin receptor/adhesin protein	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
BBF58485.1|1341677_1341896_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58486.1|1343174_1343303_-|transposase	transposase	transposase	NA	NA	NA	NA
BBF58487.1|1343645_1343840_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58488.1|1343891_1344071_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58489.1|1344159_1344432_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58490.1|1344996_1345194_+	regulatory protein	NA	NA	NA	NA	NA
BBF58491.1|1345923_1347048_+	glucosyl-transferase	NA	NA	NA	NA	NA
BBF58492.1|1347466_1347760_-|transposase	IS1 transposase InsB	transposase	U5P0U6	Shigella_phage	92.8	8.3e-46
>prophage 5
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	1472603	1635317	5678205	integrase,portal,capsid,terminase,tail,holin,tRNA,transposase,head,protease	Stx2-converting_phage(31.25%)	203	1586862:1586878	1622056:1622072
BBF58626.1|1472603_1473071_+	hypothetical protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
BBF58627.1|1473147_1474266_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.4	2.6e-84
BBF58628.1|1474234_1474504_-	phage excisionase	NA	NA	NA	NA	NA
BBF58629.1|1474565_1477037_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
BBF58630.1|1477129_1477321_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58631.1|1477317_1477506_-	cell division inhibition protein	NA	NA	NA	NA	NA
BBF58632.1|1477995_1478148_-	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
BBF58633.1|1478423_1479068_-	phage repressor protein CI	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
BBF58634.1|1479165_1479393_+	phage antirepressor protein Cro	NA	NA	NA	NA	NA
BBF58635.1|1479389_1479815_+	transcriptional regulator	NA	NA	NA	NA	NA
BBF58636.1|1479883_1480921_+	replication protein	NA	A0A0U2RT81	Escherichia_phage	67.1	1.7e-85
BBF58637.1|1480952_1481375_+	phage replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
BBF58638.1|1481409_1482108_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	59.1	4.7e-71
BBF58639.1|1482129_1482354_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
BBF58640.1|1482350_1482707_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
BBF58641.1|1482739_1482892_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58642.1|1482888_1483200_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
BBF58643.1|1483326_1483890_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	93.9	2.9e-47
BBF58644.1|1483999_1484104_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58645.1|1484290_1484503_+	regulatory protein MokC for HokC	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
BBF58646.1|1484950_1486006_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	47.8	1.5e-89
BBF58647.1|1486006_1486372_+	phage endonuclease RUS	NA	V5URS4	Shigella_phage	63.5	6.7e-37
BBF58648.1|1486380_1486923_+	phage antiterminator	NA	A0A0U2S606	Escherichia_phage	69.3	1.4e-67
BBF58649.1|1487235_1487433_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
BBF58650.1|1487583_1488633_+	DNA methylase	NA	Q8W637	Enterobacteria_phage	88.5	4.0e-183
BBF58651.1|1489104_1489536_+	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
BBF58652.1|1489348_1489867_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58653.1|1490106_1491957_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
BBF58654.1|1492247_1492454_+|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
BBF58655.1|1492709_1492946_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58656.1|1493141_1493675_+	phage endolysin	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
BBF58657.1|1493967_1494099_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	76.7	9.7e-07
BBF58658.1|1494110_1494569_+	phage murein endopeptidase	NA	A0A0H4IT10	Shigella_phage	86.8	8.6e-66
BBF58659.1|1494592_1494817_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58660.1|1495173_1495314_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58661.1|1495443_1495629_-	hypothetical protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
BBF58662.1|1495670_1496036_+	DNase	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
BBF58663.1|1496325_1496889_+|terminase	phage terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
BBF58664.1|1496885_1498547_+|terminase	phage terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
BBF58665.1|1498610_1500548_+|head,protease	phage prohead protease	head,protease	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
BBF58666.1|1500592_1500814_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
BBF58667.1|1500759_1502124_+|portal	phage portal protein	portal	A0A0P0ZCX8	Stx2-converting_phage	98.5	2.9e-258
BBF58668.1|1502120_1503344_+|portal	phage portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	100.0	1.7e-105
BBF58669.1|1503340_1503667_+	phage DNA packaging protein	NA	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
BBF58670.1|1503677_1504028_+|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BBF58671.1|1504024_1504471_+|tail	phage minor tail protein	tail	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
BBF58672.1|1504467_1504812_+|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
BBF58673.1|1504877_1505594_+|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
BBF58674.1|1505599_1505974_+|tail	phage tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	1.7e-64
BBF58675.1|1506069_1506279_+|tail	phage tail protein	tail	H6WZM0	Escherichia_phage	100.0	1.5e-33
BBF58676.1|1506326_1509569_+|tail	phage tail length tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.2	0.0e+00
BBF58677.1|1509561_1509903_+|tail	phage minor tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
BBF58678.1|1509902_1510601_+|tail	phage minor tail protein	tail	Q6H9T5	Enterobacteria_phage	97.8	4.0e-131
BBF58679.1|1510611_1511355_+|tail	phage tail assembly protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
BBF58680.1|1511351_1511933_+|tail	phage tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	90.6	3.6e-85
BBF58681.1|1512178_1515652_+	phage host specificity protein	NA	A0A0P0ZCI5	Stx2-converting_phage	97.1	0.0e+00
BBF58682.1|1515718_1516318_+	outer membrane precursor Lom	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
BBF58683.1|1516382_1517696_+|tail	phage tail fiber protein	tail	H6WZM9	Escherichia_phage	96.3	1.2e-72
BBF58684.1|1517781_1518429_+|transposase	ISCro1 transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.1e-21
BBF58685.1|1518428_1518776_+|transposase	ISCro1 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
BBF58686.1|1518795_1520367_+|transposase	ISCro1 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.4e-168
BBF58687.1|1520404_1520674_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	96.6	1.2e-43
BBF58688.1|1521128_1522490_-	T3SS secreted effector EspK	NA	Q9MBM1	Phage_Gifsy-1	39.8	4.4e-49
BBF58689.1|1523614_1524733_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
BBF58690.1|1524729_1526523_+	hydrogenase 1 large subunit	NA	NA	NA	NA	NA
BBF58691.1|1526541_1527249_+	hydrogenase 1 b-type cytochrome subunit	NA	NA	NA	NA	NA
BBF58692.1|1527245_1527833_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
BBF58693.1|1527829_1528228_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
BBF58694.1|1528224_1529082_+	hydrogenase-1 protein nickel incorporation factor	NA	NA	NA	NA	NA
BBF58695.1|1529336_1530761_+	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
BBF58696.1|1530772_1531909_+	cytochrome bd-II oxidase subunit II	NA	NA	NA	NA	NA
BBF58697.1|1531921_1532014_+	cytochrome bd-II oxidase subunit	NA	NA	NA	NA	NA
BBF58698.1|1532093_1533392_+	phosphoanhydride phosphorylase	NA	NA	NA	NA	NA
BBF58699.1|1533506_1535687_-	colanic acid production tyrosine-protein kinase	NA	NA	NA	NA	NA
BBF58700.1|1535706_1536153_-	O-antigen capsule forming protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
BBF58701.1|1536140_1537280_-	O-antigen capsule outer membrane auxiliary protein export channel	NA	NA	NA	NA	NA
BBF58702.1|1537325_1539422_-	O-antigen capsule production periplasmic protein	NA	NA	NA	NA	NA
BBF58703.1|1539421_1540168_-	O-antigen capsule production periplasmic protein	NA	NA	NA	NA	NA
BBF58704.1|1540164_1540809_-	O-antigen capsule production lipoprotein	NA	NA	NA	NA	NA
BBF58705.1|1540915_1541221_-	O-antigen capsule production threonine-rich inner membrane protein	NA	NA	NA	NA	NA
BBF58706.1|1542160_1542373_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
BBF58707.1|1542766_1542940_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58708.1|1542987_1544061_-	electron transporter	NA	NA	NA	NA	NA
BBF58709.1|1544132_1546832_-	hybrid sensory histidine kinase in two-component regulatory system with TorR	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
BBF58710.1|1546959_1547988_+	periplasmic sensory protein associated with the TorRS two-component regulatory system	NA	NA	NA	NA	NA
BBF58711.1|1547960_1548653_-	two-component regulatory system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
BBF58712.1|1548782_1549955_+	trimethylamine N-oxidoreductase I cytochrome c-type subunit	NA	NA	NA	NA	NA
BBF58713.1|1549954_1552501_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
BBF58714.1|1552497_1553097_+	TorA-maturation chaperone	NA	NA	NA	NA	NA
BBF58715.1|1553189_1553495_-	modulator of CbpA co-chaperone	NA	NA	NA	NA	NA
BBF58716.1|1553494_1554415_-	DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
BBF58717.1|1554674_1555934_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58718.1|1556225_1557467_+	glucose-1-phosphatase	NA	NA	NA	NA	NA
BBF58719.1|1557504_1557732_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58720.1|1557752_1558331_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
BBF58721.1|1558327_1559638_-|integrase	integrase	integrase	A0A0P0ZGA8	Escherichia_phage	99.5	6.0e-253
BBF58722.1|1559690_1559975_-	phage excisionase	NA	G9L654	Escherichia_phage	100.0	9.1e-50
BBF58723.1|1560020_1560272_-	hypothetical protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
BBF58724.1|1560259_1560493_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
BBF58725.1|1560636_1560999_-	hypothetical protein	NA	A0A0P0ZH73	Escherichia_phage	96.7	1.7e-56
BBF58726.1|1561034_1561190_-	hypothetical protein	NA	G3CFH1	Escherichia_phage	98.0	9.1e-20
BBF58727.1|1561182_1562094_-	putative phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	94.4	3.6e-164
BBF58728.1|1562090_1562606_-	hypothetical protein	NA	A0A1U9AJ58	Stx1_converting_phage	100.0	1.9e-101
BBF58729.1|1562607_1562805_-	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	93.4	3.2e-25
BBF58730.1|1562810_1563269_-	putative phage protein	NA	V5UT79	Shigella_phage	54.5	7.1e-20
BBF58731.1|1563271_1563463_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
BBF58732.1|1563464_1563872_-	hypothetical protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
BBF58733.1|1563868_1564498_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	73.9	3.1e-58
BBF58734.1|1564494_1564659_-	hypothetical protein	NA	K7P7R0	Enterobacteria_phage	98.1	9.3e-23
BBF58735.1|1564669_1564966_-	ABC transporter ATP-binding protein	NA	G9L665	Escherichia_phage	98.0	2.3e-48
BBF58736.1|1564989_1565577_-	hypothetical protein	NA	G9L666	Escherichia_phage	99.5	4.9e-106
BBF58737.1|1565573_1566254_-	hypothetical protein	NA	G9L667	Escherichia_phage	100.0	3.4e-127
BBF58738.1|1566262_1566451_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
BBF58739.1|1566447_1566561_-	phage host killing protein	NA	G9L669	Escherichia_phage	100.0	2.7e-13
BBF58740.1|1566553_1566694_-	phage regulatory protein CIII	NA	Q9AZ26	Salmonella_phage	100.0	3.3e-21
BBF58741.1|1566887_1567358_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
BBF58742.1|1567416_1567800_-	phage early gene regulator N	NA	G9L671	Escherichia_phage	100.0	3.9e-64
BBF58743.1|1568307_1568712_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	100.0	1.6e-68
BBF58744.1|1568708_1569365_-	transcription regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	100.0	2.6e-116
BBF58745.1|1569785_1570490_-	repressor protein	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
BBF58746.1|1570603_1570837_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
BBF58747.1|1570975_1571272_+	phage regulatory protein CII	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
BBF58748.1|1571304_1572243_+	phage replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
BBF58749.1|1572239_1572941_+	phage replication protein	NA	C1JJ58	Enterobacteria_phage	99.6	1.3e-129
BBF58750.1|1572937_1573228_+	phage exclusion protein	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
BBF58751.1|1573298_1573577_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
BBF58752.1|1573709_1573925_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
BBF58753.1|1573935_1574172_+	hypothetical protein	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
BBF58754.1|1574128_1574575_+	recombination protein	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
BBF58755.1|1574571_1575099_+	DNA methylase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
BBF58756.1|1575552_1576287_+	phage antirepressor protein	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
BBF58757.1|1576361_1577084_+	hypothetical protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
BBF58758.1|1577083_1577689_+	recombination endonuclease	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
BBF58759.1|1577685_1577880_+	hypothetical protein	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
BBF58760.1|1577830_1578307_+	antiterminator	NA	G9L695	Escherichia_phage	96.1	1.3e-85
BBF58761.1|1578813_1579761_+	Shiga toxin 1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
BBF58762.1|1579770_1580040_+	Shiga toxin 1 subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
BBF58763.1|1580539_1582477_+	hypothetical protein	NA	Q6H9W1	Enterobacteria_phage	100.0	0.0e+00
BBF58764.1|1582612_1582792_+	hypothetical protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
BBF58765.1|1582832_1583105_+	hypothetical protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
BBF58766.1|1583181_1583397_+|holin	phage holine protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
BBF58767.1|1583401_1583746_+	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
BBF58768.1|1583796_1584330_+	phage endolysin	NA	Q6H9V6	Enterobacteria_phage	100.0	1.6e-103
BBF58769.1|1584600_1585170_+	phage antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
BBF58770.1|1585169_1585316_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
BBF58771.1|1585323_1585791_+	phage endopeptidase	NA	Q6H9V3	Enterobacteria_phage	100.0	6.9e-79
BBF58772.1|1586153_1586381_-	hypothetical protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
BBF58773.1|1586422_1586788_+	DNase	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
1586862:1586878	attL	AAAATTCCTGTTTCAGG	NA	NA	NA	NA
BBF58774.1|1587077_1587641_+|terminase	phage terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
BBF58775.1|1587637_1589299_+|terminase	phage terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
BBF58776.1|1589362_1591300_+|head,protease	phage prohead protease	head,protease	A0A0P0ZAJ3	Stx2-converting_phage	99.5	0.0e+00
BBF58777.1|1591344_1591566_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
BBF58778.1|1591511_1592876_+|portal	phage portal protein	portal	A0A0P0ZCX8	Stx2-converting_phage	98.5	2.9e-258
BBF58779.1|1592872_1594096_+|portal	phage portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	100.0	1.7e-105
BBF58780.1|1594092_1594419_+	phage DNA packaging protein	NA	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
BBF58781.1|1594429_1594780_+|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BBF58782.1|1594776_1595223_+|tail	phage minor tail protein	tail	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
BBF58783.1|1595219_1595564_+|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
BBF58784.1|1595629_1596346_+|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
BBF58785.1|1596351_1596726_+|tail	phage tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
BBF58786.1|1596821_1597031_+|tail	phage tail protein	tail	H6WZM0	Escherichia_phage	100.0	1.5e-33
BBF58787.1|1597078_1599208_+|tail	phage tail length tape measure protein	tail	H6WZM1	Escherichia_phage	95.1	3.4e-274
BBF58788.1|1599306_1600320_+|tail	phage tail length tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.7	2.4e-161
BBF58789.1|1600312_1600654_+|tail	phage minor tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
BBF58790.1|1600653_1601352_+|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
BBF58791.1|1601357_1602101_+|tail	phage tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	99.2	9.2e-150
BBF58792.1|1602097_1602679_+|tail	phage tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.2	1.2e-93
BBF58793.1|1602924_1606401_+	phage host specificity protein	NA	Q6H9T2	Enterobacteria_phage	96.1	0.0e+00
BBF58794.1|1606469_1607093_+	outer membrane protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
BBF58795.1|1607158_1608472_+|tail	phage tail fiber protein	tail	H6WZM9	Escherichia_phage	98.2	2.8e-77
BBF58796.1|1608473_1608743_+	hypothetical protein	NA	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
BBF58797.1|1608856_1609432_+	T3SS secreted effector NleI/NleG	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
BBF58798.1|1609722_1610304_+	T3SS secreted effector NleG	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
BBF58799.1|1610371_1611007_+	T3SS secreted effector NleG	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
BBF58800.1|1611134_1612193_-	T3SS secreted effector EspW	NA	NA	NA	NA	NA
BBF58801.1|1612267_1612918_-	T3SS secreted effector NleG	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
BBF58802.1|1613100_1613691_+	T3SS secreted effector EspM	NA	NA	NA	NA	NA
BBF58803.1|1613964_1614828_-	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
BBF58804.1|1614811_1615948_-	spermidine/putrescine ABC transporter ATPase	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
BBF58805.1|1616197_1617427_+	peptidase T	NA	NA	NA	NA	NA
BBF58806.1|1617572_1618694_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
BBF58807.1|1618942_1620172_+|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	8.4e-132
BBF58808.1|1621226_1621406_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58809.1|1621605_1621812_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58810.1|1621801_1622266_+	hypothetical protein	NA	NA	NA	NA	NA
1622056:1622072	attR	CCTGAAACAGGAATTTT	NA	NA	NA	NA
BBF58811.1|1622258_1622492_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58812.1|1622497_1622797_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58813.1|1622793_1624194_+	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	1.2e-115
BBF58814.1|1624394_1624646_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58815.1|1624642_1625053_+	single stranded DNA-binding protein	NA	NA	NA	NA	NA
BBF58816.1|1625063_1625336_+	transcriptional regulator PchE	NA	NA	NA	NA	NA
BBF58817.1|1625462_1625687_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58818.1|1625938_1626145_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58819.1|1626144_1627200_+|capsid	phage major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
BBF58820.1|1627212_1627548_+|head	phage head-DNA stabilization protein	head	NA	NA	NA	NA
BBF58821.1|1627560_1627974_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58822.1|1628179_1628722_+|terminase	phage terminase small subunit	terminase	O64316	Escherichia_phage	44.2	5.1e-33
BBF58823.1|1628977_1629259_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58824.1|1629860_1631321_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
BBF58825.1|1631320_1631992_-	two-component regulatory system response regulator PhoP	NA	NA	NA	NA	NA
BBF58826.1|1632159_1633530_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
BBF58827.1|1633533_1634175_-	lysogenization regulator	NA	NA	NA	NA	NA
BBF58828.1|1634210_1635317_-|tRNA	tRNA(Gln,Lys,Glu) U34 2-thiouridylase	tRNA	NA	NA	NA	NA
>prophage 6
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	1740822	1768650	5678205	transposase,integrase,holin	Escherichia_phage(46.15%)	38	1739238:1739265	1772729:1772756
1739238:1739265	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
BBF58933.1|1740822_1743294_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
BBF58934.1|1743389_1743578_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58935.1|1743574_1743763_-	cell division inhibition protein	NA	NA	NA	NA	NA
BBF58936.1|1744323_1744557_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58937.1|1744534_1744942_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
BBF58938.1|1744964_1745183_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58939.1|1745255_1745612_-	hypothetical protein	NA	NA	NA	NA	NA
BBF58940.1|1745819_1746227_-	regulator for DicB	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
BBF58941.1|1746303_1746531_+	phage repressor protein	NA	NA	NA	NA	NA
BBF58942.1|1746514_1747066_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58943.1|1747037_1748078_+	phage replication protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
BBF58944.1|1748109_1748532_+	phage replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
BBF58945.1|1748565_1749153_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	87.8	3.5e-72
BBF58946.1|1750158_1750917_+	porcine attaching-effacing associated protein Paa/adherence factor AdfO	NA	NA	NA	NA	NA
BBF58947.1|1751195_1751408_+	phage maintenance protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
BBF58948.1|1751628_1751886_+	putative phage protein	NA	NA	NA	NA	NA
BBF58949.1|1751955_1752234_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
BBF58950.1|1752235_1753291_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
BBF58951.1|1753291_1753657_+	phage endonuclease RUS	NA	V5URS4	Shigella_phage	67.5	1.6e-38
BBF58952.1|1753653_1754343_+	phage late gene regulator Q	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
BBF58953.1|1755242_1755389_+	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	95.8	6.8e-17
BBF58954.1|1755385_1755553_+	hypothetical protein	NA	H6WZJ7	Escherichia_phage	70.6	5.4e-10
BBF58955.1|1755867_1757721_+	hypothetical protein	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
BBF58956.1|1757870_1758086_+|holin	phage holin protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
BBF58957.1|1758090_1758435_+	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
BBF58958.1|1758485_1759019_+	phage endolysin	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
BBF58959.1|1759289_1759835_+	phage antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	100.0	2.0e-93
BBF58960.1|1759855_1760125_+	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
BBF58961.1|1760269_1760812_+	T3SS secreted effector NleG	NA	H6WZN1	Escherichia_phage	67.2	1.1e-62
BBF58962.1|1761150_1762191_-	T3SS secreted effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.3e-165
BBF58963.1|1762154_1762475_-	T3SS secreted effector NleA	NA	Q6H9S2	Enterobacteria_phage	92.4	2.5e-43
BBF58964.1|1763133_1763826_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	88.6	1.3e-110
BBF58965.1|1764299_1765211_+	T3SS secreted effector NleH	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
BBF58966.1|1765276_1765846_+	T3SS secreted effector NleF	NA	NA	NA	NA	NA
BBF58967.1|1765892_1766150_-|transposase	transposase	transposase	NA	NA	NA	NA
BBF58968.1|1766179_1766527_-	hypothetical protein	NA	A0A218MNI5	uncultured_virus	51.5	2.1e-11
BBF58969.1|1766978_1767248_+	hypothetical protein	NA	NA	NA	NA	NA
BBF58970.1|1768002_1768650_-	T3SS secreted effector NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
1772729:1772756	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
>prophage 7
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	1863073	1921827	5678205	integrase,portal,capsid,terminase,tail,tRNA,holin,transposase,head,protease	Escherichia_phage(45.59%)	75	1862707:1862722	1878194:1878209
1862707:1862722	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
BBF59062.1|1863073_1864306_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
BBF59063.1|1864560_1865544_+	Zn(II) transporter	NA	NA	NA	NA	NA
BBF59064.1|1865818_1865992_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59065.1|1866021_1867395_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
BBF59066.1|1867523_1868459_-|tRNA	tRNA s(2)C32 thioltransferase	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
BBF59067.1|1868510_1869746_-|integrase	integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
BBF59068.1|1869747_1869963_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
BBF59069.1|1870062_1870251_-	hypothetical protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
BBF59070.1|1870493_1871303_-	recombination and repair protein	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
BBF59071.1|1871295_1873896_-	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	2.6e-247
BBF59072.1|1873997_1874273_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
BBF59073.1|1874347_1874518_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
BBF59074.1|1874517_1874739_-	phage cell division inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
BBF59075.1|1875159_1875393_-	hypothetical protein	NA	M4QQ57	Salicola_phage	55.3	3.5e-07
BBF59076.1|1875610_1876030_-	regulator for DicB	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
BBF59077.1|1876109_1876364_+	phage antirepressor Cro	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
BBF59078.1|1876360_1876783_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
BBF59079.1|1876795_1877326_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	83.6	1.6e-71
BBF59080.1|1877328_1878216_-|transposase	IS629 transposase OrfB	transposase	Q6H9S6	Enterobacteria_phage	99.7	1.2e-169
1878194:1878209	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
BBF59081.1|1878215_1878542_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF59082.1|1878971_1879718_+	phage DNA replication protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
BBF59083.1|1879740_1880502_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	89.7	3.8e-119
BBF59084.1|1880517_1880940_+	phage exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.0e-64
BBF59085.1|1880936_1881233_+	hypothetical protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
BBF59086.1|1881229_1881691_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
BBF59087.1|1881668_1882025_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
BBF59088.1|1882075_1882288_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
BBF59089.1|1882539_1882803_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
BBF59090.1|1882813_1883683_+	putative phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
BBF59091.1|1883798_1883903_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59092.1|1884091_1884304_+	regulatory protein MokC for HokC	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
BBF59093.1|1884406_1884724_-	transcriptional regulator	NA	NA	NA	NA	NA
BBF59094.1|1884716_1885088_-	addiction module toxin RelE	NA	NA	NA	NA	NA
BBF59095.1|1885344_1885539_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59096.1|1885592_1885862_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
BBF59097.1|1885863_1886913_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.6	6.9e-111
BBF59098.1|1886925_1887285_+	endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	4.7e-35
BBF59099.1|1887293_1887824_+	phage antiterminator	NA	A0A0U2S606	Escherichia_phage	72.6	7.1e-72
BBF59100.1|1888065_1888263_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
BBF59101.1|1888523_1889111_+	phage regulatory protein	NA	NA	NA	NA	NA
BBF59102.1|1889562_1889994_+	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	96.5	5.6e-67
BBF59103.1|1889990_1890158_+	hypothetical protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
BBF59104.1|1890471_1892325_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
BBF59105.1|1892474_1892690_+|holin	phage holine protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
BBF59106.1|1892693_1893485_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
BBF59107.1|1893996_1894530_+	phage endolysin	NA	G9L6J6	Escherichia_phage	94.9	6.9e-99
BBF59108.1|1894828_1895296_+	phage endopeptidase	NA	Q7AYI6	Enterobacteria_phage	99.4	6.5e-77
BBF59109.1|1895735_1896281_+	phage DNA packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
BBF59110.1|1896255_1898181_+|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
BBF59111.1|1898177_1898384_+|head,tail	phage head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
BBF59112.1|1898380_1899982_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
BBF59113.1|1899962_1901282_+|head,protease	phage prohead protease	head,protease	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
BBF59114.1|1901291_1901624_+|head	phage head-DNA stabilization protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
BBF59115.1|1901679_1902705_+|capsid	phage major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
BBF59116.1|1902746_1903142_+	phage DNA packaging protein	NA	A0A0K2FIR1	Enterobacteria_phage	90.2	7.2e-53
BBF59117.1|1903153_1903507_+|head,tail	phage head-tail adaptor protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	2.5e-57
BBF59118.1|1903521_1904055_+|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
BBF59119.1|1904051_1904447_+|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
BBF59120.1|1904454_1905207_+|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	99.6	3.8e-135
BBF59121.1|1905220_1905643_+|tail	phage minor tail protein	tail	Q687F5	Enterobacteria_phage	97.1	1.8e-70
BBF59122.1|1905669_1906083_+|tail	phage minor tail protein	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
BBF59123.1|1906063_1908676_+|tail	phage tail length tape measure protein	tail	Q687F3	Enterobacteria_phage	95.4	0.0e+00
BBF59124.1|1908672_1909002_+|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BBF59125.1|1909001_1909700_+|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
BBF59126.1|1909705_1910449_+|tail	phage tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	99.2	9.2e-150
BBF59127.1|1910445_1911027_+|tail	phage tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.2	1.2e-93
BBF59128.1|1911272_1914749_+	phage host specificity protein	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
BBF59129.1|1914816_1915416_+	outer membrane precursor Lom	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
BBF59130.1|1915480_1916794_+|tail	phage tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
BBF59131.1|1916795_1917065_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	95.5	8.7e-42
BBF59132.1|1917177_1917753_+	T3SS secreted effector NleG	NA	H6WZN1	Escherichia_phage	88.9	7.0e-89
BBF59133.1|1917825_1918455_+	T3SS secreted effector NleG	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
BBF59134.1|1918536_1919178_+	T3SS secreted effector NleG	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
BBF59135.1|1920118_1920553_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
BBF59136.1|1920693_1921827_-	outer membrane pore protein	NA	Q1MVN1	Enterobacteria_phage	58.5	4.1e-117
>prophage 8
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	2114074	2181095	5678205	integrase,portal,tail,terminase,lysis,transposase,protease	Enterobacteria_phage(46.43%)	81	2139122:2139137	2181623:2181638
BBF59301.1|2114074_2114368_-|transposase	IS1 transposase InsB	transposase	U5P0U6	Shigella_phage	92.8	8.3e-46
BBF59302.1|2114805_2115438_-	diguanylate cyclase	NA	NA	NA	NA	NA
BBF59303.1|2115692_2116085_-	hydrogen peroxide resistance OB fold protein	NA	NA	NA	NA	NA
BBF59304.1|2116360_2116879_+	inactive PncC family protein	NA	NA	NA	NA	NA
BBF59305.1|2116923_2118969_-	dipeptidyl carboxypeptidase II	NA	NA	NA	NA	NA
BBF59306.1|2119105_2119852_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
BBF59307.1|2119940_2120627_+	transcriptional repressor	NA	NA	NA	NA	NA
BBF59308.1|2120804_2121008_+	selenoprotein	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
BBF59309.1|2121043_2122090_-	NAD-dependent D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	3.4e-33
BBF59310.1|2122156_2122504_-	NAD-dependent D-mannonate oxidoreductase	NA	NA	NA	NA	NA
BBF59311.1|2122592_2123876_-	transport protein	NA	NA	NA	NA	NA
BBF59312.1|2124660_2124894_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
BBF59313.1|2125210_2125801_+	site-specific recombinase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
BBF59314.1|2125898_2126474_-|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
BBF59315.1|2126473_2129434_-|tail	phage side tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	54.1	4.0e-55
BBF59316.1|2129498_2130098_-	outer membrane precursor Lom	NA	H6WZM8	Escherichia_phage	94.5	6.5e-106
BBF59317.1|2130168_2133582_-	phage host specificity protein	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
BBF59318.1|2133642_2134191_-|tail	phage tail assembly protein	tail	K7PH50	Enterobacteria_phage	96.2	1.4e-91
BBF59319.1|2134187_2134931_-|tail	phage tail assembly protein	tail	K7PLW1	Enterobacteria_phage	95.5	4.0e-145
BBF59320.1|2134936_2135635_-|tail	phage minor tail protein	tail	A5LH40	Enterobacteria_phage	98.3	2.8e-132
BBF59321.1|2135644_2135974_-|tail	phage minor tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
BBF59322.1|2135973_2139039_-|tail	phage tail length tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
BBF59323.1|2139010_2139328_-|tail	phage minor tail protein	tail	A5LH37	Enterobacteria_phage	100.0	1.5e-53
2139122:2139137	attL	AAGGCTGAAATCAGCC	NA	NA	NA	NA
BBF59324.1|2139348_2139735_-|tail	phage minor tail protein	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
BBF59325.1|2139795_2140539_-|tail	phage major tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
BBF59326.1|2140549_2140951_-|tail	phage minor tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
BBF59327.1|2140947_2141526_-|tail	phage minor tail protein	tail	A5LH33	Enterobacteria_phage	98.4	3.0e-100
BBF59328.1|2141537_2141813_-	hypothetical protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
BBF59329.1|2141805_2142129_-	hypothetical protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
BBF59330.1|2142215_2142794_-|protease	phage protease/scaffold protein	protease	A5LH30	Enterobacteria_phage	100.0	1.4e-100
BBF59331.1|2142796_2144242_-|protease	phage protease/scaffold protein	protease	K7PGT6	Enterobacteria_phage	99.5	3.6e-235
BBF59332.1|2144186_2145695_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.5e-289
BBF59333.1|2145694_2145907_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
BBF59334.1|2145903_2147535_-|terminase	phage terminase large subunit	terminase	A5LH27	Enterobacteria_phage	95.5	0.0e+00
BBF59335.1|2147492_2147993_-|terminase	phage terminase large subunit	terminase	A5LH27	Enterobacteria_phage	100.0	1.1e-87
BBF59336.1|2148001_2148529_-|terminase	phage terminase small subunit	terminase	A5LH26	Enterobacteria_phage	100.0	2.1e-92
BBF59337.1|2148913_2149081_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59338.1|2149101_2149308_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	3.9e-26
BBF59339.1|2149608_2150019_+	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
BBF59340.1|2150170_2150344_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59341.1|2151017_2151230_-	hypothetical protein	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
BBF59342.1|2151592_2152090_-	Rz-like protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
BBF59343.1|2152086_2152620_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
BBF59344.1|2152616_2152928_-	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
BBF59345.1|2152932_2153139_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
BBF59346.1|2153901_2154117_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	76.5	4.5e-25
BBF59347.1|2154417_2154630_+	cold shock protein	NA	NA	NA	NA	NA
BBF59348.1|2155051_2155804_-	phage antitermination protein Q	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
BBF59349.1|2155817_2156867_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
BBF59350.1|2157213_2157465_-	putative phage protein	NA	NA	NA	NA	NA
BBF59351.1|2157681_2157837_-	small toxic polypeptide	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
BBF59352.1|2157908_2158196_-	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
BBF59353.1|2158195_2158435_-	antitoxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
BBF59354.1|2158967_2159300_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59355.1|2159367_2159694_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF59356.1|2159693_2160581_+|transposase	IS629 transposase OrfB	transposase	Q6H9S6	Enterobacteria_phage	99.7	1.2e-169
BBF59357.1|2161049_2162390_-|transposase	ISEsa1 transposase	transposase	NA	NA	NA	NA
BBF59358.1|2162423_2162843_-	phage exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
BBF59359.1|2162883_2163849_-	replication protein	NA	U5P0A0	Shigella_phage	61.3	6.5e-55
BBF59360.1|2163829_2164351_-	phage regulatory protein CII	NA	NA	NA	NA	NA
BBF59361.1|2164334_2164562_-	phage antirepressor protein Cro	NA	NA	NA	NA	NA
BBF59362.1|2164588_2165047_+	phage repressor CI	NA	I6PD69	Cronobacter_phage	46.2	2.1e-24
BBF59363.1|2165239_2165395_+	hypothetical protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
BBF59364.1|2165396_2165972_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59365.1|2166458_2166647_+	cell division inhibition protein	NA	NA	NA	NA	NA
BBF59366.1|2166643_2166835_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59367.1|2166928_2169400_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
BBF59368.1|2169487_2169592_+	phage excisionase	NA	NA	NA	NA	NA
BBF59369.1|2169595_2171167_-|transposase	ISCro1 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
BBF59370.1|2171186_2171534_-|transposase	ISCro1 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
BBF59371.1|2171533_2172181_-|transposase	ISCro1 transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.1e-21
BBF59372.1|2172465_2173746_+|integrase	integrase	integrase	B6DZ48	Enterobacteria_phage	61.8	4.3e-155
BBF59373.1|2173765_2173876_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59374.1|2173933_2174953_-	Zn-dependent NAD(P)-binding oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
BBF59375.1|2174964_2176179_-	bifunctional D-altronate/D-mannonate dehydratase	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
BBF59376.1|2176384_2176711_-	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
BBF59377.1|2176845_2177187_+	periplasmic protein	NA	NA	NA	NA	NA
BBF59378.1|2177221_2177782_+	spermidine N(1)-acetyltransferase	NA	NA	NA	NA	NA
BBF59379.1|2177784_2178531_-	lipoprotein	NA	NA	NA	NA	NA
BBF59380.1|2178602_2178908_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59381.1|2179106_2181095_+	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.3	8.7e-155
2181623:2181638	attR	AAGGCTGAAATCAGCC	NA	NA	NA	NA
>prophage 9
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	2370976	2468705	5678205	portal,tail,tRNA,transposase,head,protease	Shigella_phage(48.08%)	113	NA	NA
BBF59564.1|2370976_2372833_+|protease	protease IV	protease	NA	NA	NA	NA
BBF59565.1|2372999_2374016_+	cytoplasmic L-asparaginase 1	NA	NA	NA	NA	NA
BBF59566.1|2374026_2374668_+	nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
BBF59567.1|2374828_2375101_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59568.1|2375142_2375556_-	methionine sulfoxide reductase B	NA	NA	NA	NA	NA
BBF59569.1|2375897_2376893_+	glyceraldehyde-3-phosphate dehydrogenase A	NA	NA	NA	NA	NA
BBF59570.1|2376976_2377861_+	D-hexose-6-phosphate epimerase-like protein	NA	NA	NA	NA	NA
BBF59571.1|2377911_2378766_-	aldo-keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
BBF59572.1|2378855_2379602_-	MltA-interacting protein MipA	NA	NA	NA	NA	NA
BBF59573.1|2380037_2381972_+	protein kinase	NA	NA	NA	NA	NA
BBF59574.1|2382084_2383368_+	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
BBF59575.1|2383514_2384990_+	membrane-anchored diguanylate cyclase	NA	NA	NA	NA	NA
BBF59576.1|2385170_2386661_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
BBF59577.1|2386703_2387207_+|tRNA	aminoacyl-tRNA editing domain protein	tRNA	NA	NA	NA	NA
BBF59578.1|2387480_2387927_+	inner membrane protein	NA	NA	NA	NA	NA
BBF59579.1|2387883_2388702_-	transcriptional regulator	NA	NA	NA	NA	NA
BBF59580.1|2388801_2389983_+	MFS transporter	NA	NA	NA	NA	NA
BBF59581.1|2390037_2390385_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59582.1|2390406_2390661_-	outer membrane lipoprotein	NA	NA	NA	NA	NA
BBF59583.1|2390843_2391869_+	diguanylate cyclase	NA	NA	NA	NA	NA
BBF59584.1|2392135_2392384_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59585.1|2392611_2393760_-|transposase	IS609 transposase	transposase	A0A1W6JP07	Morganella_phage	96.9	4.5e-204
BBF59586.1|2393827_2394151_+|transposase	IS609 transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.7	1.3e-23
BBF59587.1|2394323_2394854_-	regulatory protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
BBF59588.1|2395294_2397385_+	DNA transposition protein	NA	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
BBF59589.1|2397455_2398388_+	DNA transposition protein	NA	A0A0C4UQR3	Shigella_phage	48.0	2.6e-69
BBF59590.1|2398390_2398612_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59591.1|2398624_2398879_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59592.1|2398880_2399162_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
BBF59593.1|2399158_2399431_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59594.1|2399435_2399729_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59595.1|2399740_2400271_+	host-nuclease inhibitor protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
BBF59596.1|2400368_2400911_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
BBF59597.1|2400914_2401448_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
BBF59598.1|2401447_2401963_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
BBF59599.1|2401966_2402518_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59600.1|2402514_2402700_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59601.1|2402696_2403071_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59602.1|2403063_2403261_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
BBF59603.1|2403250_2403547_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59604.1|2403543_2404053_+	hypothetical protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
BBF59605.1|2404122_2404548_+	transcription regulator	NA	NA	NA	NA	NA
BBF59606.1|2404619_2405120_+	phage lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
BBF59607.1|2405082_2405583_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59608.1|2405794_2406022_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
BBF59609.1|2406002_2406311_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59610.1|2406307_2406598_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
BBF59611.1|2406600_2407182_+	hypothetical protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
BBF59612.1|2407181_2408846_+|portal	phage portal protein	portal	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
BBF59613.1|2408845_2409760_+	hypothetical protein	NA	A0A0C4UQR8	Shigella_phage	66.3	1.1e-112
BBF59614.1|2409714_2410434_+	hypothetical protein	NA	A0A0C4UQR8	Shigella_phage	47.9	8.3e-47
BBF59615.1|2410417_2411629_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	62.6	4.2e-136
BBF59616.1|2411860_2412334_+	phage morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
BBF59617.1|2412510_2413635_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
BBF59618.1|2413634_2414582_+|head	phage major head subunit	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
BBF59619.1|2414625_2415042_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59620.1|2415038_2415458_+	hypothetical protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
BBF59621.1|2415454_2416015_+	hypothetical protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
BBF59622.1|2416015_2416261_+	hypothetical protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
BBF59623.1|2416257_2416689_+|tail	phage tail sheath protein	tail	A0A0C4UQS0	Shigella_phage	46.5	3.2e-22
BBF59624.1|2416835_2417759_+|tail	phage tail sheath protein	tail	A0A0C4UQS0	Shigella_phage	56.4	6.6e-97
BBF59625.1|2417767_2418133_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
BBF59626.1|2418147_2418624_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
BBF59627.1|2418750_2420826_+	phage tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
BBF59628.1|2420812_2422162_+	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
BBF59629.1|2422145_2423270_+|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
BBF59630.1|2423259_2423874_+	hypothetical protein	NA	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
BBF59631.1|2423866_2424304_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
BBF59632.1|2424303_2425386_+	hypothetical protein	NA	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
BBF59633.1|2425376_2425937_+|tail	phage tail protein	tail	C9DGQ7	Escherichia_phage	48.1	2.3e-44
BBF59634.1|2425936_2426848_+|tail	phage tail fiber	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
BBF59635.1|2426882_2427404_-|tail	phage tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
BBF59636.1|2427909_2428470_+	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
BBF59637.1|2428569_2430609_+	hypothetical protein	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
BBF59638.1|2430755_2430938_+	hypothetical protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
BBF59639.1|2430973_2431219_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59640.1|2431257_2431722_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59641.1|2431990_2432728_+	DNA modification protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
BBF59642.1|2433061_2433250_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59643.1|2433253_2433613_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59644.1|2433785_2434424_-	leucine efflux protein	NA	NA	NA	NA	NA
BBF59645.1|2434550_2435474_-	transcriptional activator of dmlA	NA	NA	NA	NA	NA
BBF59646.1|2435576_2436662_+	D-malate oxidase	NA	NA	NA	NA	NA
BBF59647.1|2436912_2438523_+	transporter	NA	NA	NA	NA	NA
BBF59648.1|2438554_2439679_+	dioxygenase alpha subunit	NA	NA	NA	NA	NA
BBF59649.1|2439734_2440700_+	putative dioxygenase beta subunit	NA	NA	NA	NA	NA
BBF59650.1|2440753_2441869_-	ribonuclease D	NA	NA	NA	NA	NA
BBF59651.1|2441950_2443702_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.6e-35
BBF59652.1|2443840_2444422_-	outer membrane lipoprotein	NA	NA	NA	NA	NA
BBF59653.1|2444461_2445157_-|tRNA	tRNA(ANN) t(6)A37 threonylcarbamoyladenosine modification protein	tRNA	NA	NA	NA	NA
BBF59654.1|2445214_2447125_-	ATP-dependent helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
BBF59655.1|2447253_2447601_+	reactive intermediate deaminase	NA	NA	NA	NA	NA
BBF59656.1|2448023_2448323_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59657.1|2448442_2448622_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59658.1|2448695_2450057_+	aminodeoxychorismate synthase subunit I	NA	S4VT78	Pandoravirus	33.4	3.4e-41
BBF59659.1|2450060_2450639_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
BBF59660.1|2450822_2452187_+	L-serine dehydratase 3	NA	NA	NA	NA	NA
BBF59661.1|2452317_2453916_+	membrane-anchored cyclic-di-GMP phosphodiesterase	NA	NA	NA	NA	NA
BBF59662.1|2453919_2455476_-	membrane protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
BBF59663.1|2455463_2455673_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59664.1|2455938_2456910_+	PTS system mannose-specific IIAB component	NA	NA	NA	NA	NA
BBF59665.1|2456972_2457773_+	mannose-specific enzyme IIC component of PTS	NA	NA	NA	NA	NA
BBF59666.1|2457785_2458637_+	mannose-specific enzyme IID component of PTS	NA	NA	NA	NA	NA
BBF59667.1|2458691_2459150_+	inner membrane protein	NA	NA	NA	NA	NA
BBF59668.1|2459578_2460145_+	Mn(2+) efflux pump	NA	NA	NA	NA	NA
BBF59669.1|2460141_2460951_-	23S rRNA m(1)G745 methyltransferase	NA	NA	NA	NA	NA
BBF59670.1|2461116_2461326_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
BBF59671.1|2462150_2462438_-	inner membrane protein	NA	NA	NA	NA	NA
BBF59672.1|2462814_2463054_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59673.1|2463196_2463988_-	KDG regulon transcriptional repressor	NA	NA	NA	NA	NA
BBF59674.1|2464164_2465538_+	transporter	NA	NA	NA	NA	NA
BBF59675.1|2465583_2466465_-	endopeptidase	NA	NA	NA	NA	NA
BBF59676.1|2466656_2468705_-|protease	carboxy-terminal protease for penicillin-binding protein 3	protease	A0A0R6PIZ1	Moraxella_phage	33.5	1.4e-86
>prophage 10
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	2476201	2528592	5678205	integrase,capsid,portal,tail,terminase,holin,transposase,head,protease	Escherichia_phage(34.43%)	69	2470905:2470919	2530039:2530053
2470905:2470919	attL	CCCGCTACGCCTGCG	NA	NA	NA	NA
BBF59684.1|2476201_2476858_-	serine/threonine-specific protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
BBF59685.1|2477749_2478463_+	T3SS secreted effector NleG	NA	B6ETE1	Enterobacteria_phage	99.1	1.3e-121
BBF59686.1|2478687_2479563_-	T3SS secreted effector OspB	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
BBF59687.1|2479703_2479973_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	95.5	8.7e-42
BBF59688.1|2479974_2481288_-|tail	phage tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
BBF59689.1|2481352_2481952_-	outer membrane precursor Lom	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
BBF59690.1|2482007_2483546_-|transposase	ISEc22 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
BBF59691.1|2483594_2483942_-|transposase	ISEc22 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
BBF59692.1|2483938_2484343_-	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
BBF59693.1|2484481_2487877_-	phage host specificity protein	NA	A0A0P0ZCI5	Stx2-converting_phage	83.6	0.0e+00
BBF59694.1|2488219_2488801_-|tail	phage tail assembly protein	tail	H6WZM5	Escherichia_phage	96.9	2.2e-90
BBF59695.1|2488797_2489541_-|tail	phage tail assembly protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
BBF59696.1|2489551_2490250_-|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
BBF59697.1|2490249_2490579_-|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BBF59698.1|2490575_2492732_-|tail	phage tail length tape measure protein	tail	Q687F3	Enterobacteria_phage	94.3	0.0e+00
BBF59699.1|2492845_2493187_-|tail	phage tail length tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.8	9.6e-38
BBF59700.1|2493167_2493581_-|tail	phage minor tail protein	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
BBF59701.1|2493607_2494030_-|tail	phage minor tail protein	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
BBF59702.1|2494043_2494796_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	99.6	1.7e-135
BBF59703.1|2494803_2495199_-|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
BBF59704.1|2495195_2495774_-|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
BBF59705.1|2495785_2496139_-|head,tail	phage head-tail adaptor protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
BBF59706.1|2496150_2496546_-	phage DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
BBF59707.1|2496587_2497613_-|capsid	phage major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
BBF59708.1|2497668_2498001_-|head	phage head-DNA stabilization protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
BBF59709.1|2498010_2499330_-|head,protease	phage prohead protease	head,protease	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
BBF59710.1|2499310_2500912_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
BBF59711.1|2500908_2501115_-|head,tail	phage head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
BBF59712.1|2501111_2503037_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
BBF59713.1|2503011_2503557_-	phage DNA packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
BBF59714.1|2504327_2504945_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
BBF59715.1|2505094_2505532_-	phage murein endopeptidase	NA	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
BBF59716.1|2505528_2506026_-	phage lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
BBF59717.1|2506025_2506232_-|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
BBF59718.1|2506679_2508530_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
BBF59719.1|2508936_2509104_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
BBF59720.1|2509100_2509247_-	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	97.9	4.0e-17
BBF59721.1|2509700_2510522_-	phage antitermination protein Q	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
BBF59722.1|2510518_2510893_-	phage endonuclease RUS	NA	V5URS4	Shigella_phage	63.6	5.4e-34
BBF59723.1|2510905_2511955_-	hypothetical protein	NA	U5P0K4	Shigella_phage	54.6	6.9e-111
BBF59724.1|2511956_2512229_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
BBF59725.1|2512350_2512695_-	hypothetical protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
BBF59726.1|2512814_2513027_-	regulatory protein MokC for HokC	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
BBF59727.1|2513260_2513818_-	putative phage protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
BBF59728.1|2514165_2514477_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
BBF59729.1|2514469_2514697_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
BBF59730.1|2514693_2514975_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
BBF59731.1|2515007_2515769_-	hypothetical protein	NA	A0A088CE47	Shigella_phage	67.2	3.9e-79
BBF59732.1|2515794_2516454_-	phage DNA replication protein	NA	V5UQI5	Shigella_phage	94.5	5.0e-115
BBF59733.1|2516422_2516536_-	phage DNA replication protein	NA	NA	NA	NA	NA
BBF59734.1|2516542_2517505_-	phage replication protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
BBF59735.1|2517527_2517953_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59736.1|2517949_2518252_-	phage antirepressor protein Cro	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
BBF59737.1|2518349_2518721_+	phage repressor protein CI	NA	NA	NA	NA	NA
BBF59738.1|2518741_2518933_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59739.1|2518934_2519213_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59740.1|2519418_2519652_+	hypothetical protein	NA	M4QQ57	Salicola_phage	55.3	3.5e-07
BBF59741.1|2520072_2520294_+	phage cell division inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
BBF59742.1|2520293_2520464_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
BBF59743.1|2520537_2520813_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
BBF59744.1|2520911_2523563_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
BBF59745.1|2523555_2524365_+	recombination and repair protein	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
BBF59746.1|2524608_2524797_+	hypothetical protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
BBF59747.1|2524903_2525185_+	phage excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
BBF59748.1|2525150_2526266_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.1	9.4e-98
BBF59749.1|2526618_2526960_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59750.1|2526972_2527845_-	inner membrane protein	NA	NA	NA	NA	NA
BBF59751.1|2527848_2528223_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59752.1|2528361_2528592_+	DNA polymerase III theta subunit HolE	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
2530039:2530053	attR	CGCAGGCGTAGCGGG	NA	NA	NA	NA
>prophage 11
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	2574864	2648786	5678205	integrase,portal,capsid,terminase,tail,tRNA,holin,plate	Enterobacteria_phage(75.0%)	80	2612399:2612458	2649729:2649849
BBF59798.1|2574864_2575836_+|tRNA	tRNA (cmo5U34)-carboxymethyltransferase	tRNA	NA	NA	NA	NA
BBF59799.1|2576000_2578430_-	biotin sulfoxide reductase	NA	NA	NA	NA	NA
BBF59800.1|2578454_2579555_-	TMAO reductase III cytochrome c-type subunit	NA	NA	NA	NA	NA
BBF59801.1|2579942_2580689_-	copper homeostasis protein	NA	NA	NA	NA	NA
BBF59802.1|2580702_2581269_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59803.1|2581484_2583218_+|tRNA	arginyl-tRNA synthetase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
BBF59804.1|2583394_2583883_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59805.1|2584002_2584395_-	flagellar protein FlhE	NA	NA	NA	NA	NA
BBF59806.1|2584394_2586473_-	flagellar export pore protein	NA	NA	NA	NA	NA
BBF59807.1|2586465_2587614_-	flagellin export apparatus substrate specificity protein	NA	NA	NA	NA	NA
BBF59808.1|2587815_2588460_-	chemotaxis protein CheZ	NA	NA	NA	NA	NA
BBF59809.1|2588470_2588860_-	chemotaxis regulator transmitting signal to flagellar motor component	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
BBF59810.1|2588874_2589924_-	chemotaxis-specific methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
BBF59811.1|2589926_2590787_-	chemotaxis protein methyltransferase CheR	NA	NA	NA	NA	NA
BBF59812.1|2590805_2592410_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	1.2e-13
BBF59813.1|2592455_2594117_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
BBF59814.1|2594261_2594765_-	purine-binding chemotaxis protein	NA	NA	NA	NA	NA
BBF59815.1|2594785_2596750_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
BBF59816.1|2596754_2597681_-	chemotaxis protein MotB	NA	NA	NA	NA	NA
BBF59817.1|2597677_2598565_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
BBF59818.1|2598691_2599270_-	flagellar class II regulon transcriptional activator	NA	NA	NA	NA	NA
BBF59819.1|2599272_2599623_-	flagellar class II regulon transcriptional activator	NA	NA	NA	NA	NA
BBF59820.1|2600402_2600831_+	universal stress protein	NA	NA	NA	NA	NA
BBF59821.1|2600837_2602262_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
BBF59822.1|2602236_2603037_-	trehalose-6-phosphate phosphatase	NA	NA	NA	NA	NA
BBF59823.1|2603203_2604190_-	L-arabinose ABC transporter permease	NA	NA	NA	NA	NA
BBF59824.1|2604204_2605719_-	L-arabinose ABC transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
BBF59825.1|2605788_2606778_-	L-arabinose ABC transporter periplasmic binding protein	NA	NA	NA	NA	NA
BBF59826.1|2607574_2608078_+	ferritin B	NA	NA	NA	NA	NA
BBF59827.1|2608156_2608408_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59828.1|2608871_2609195_+	lipoprotein	NA	NA	NA	NA	NA
BBF59829.1|2609365_2609863_+	ferritin iron storage protein	NA	NA	NA	NA	NA
BBF59830.1|2609900_2610140_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59831.1|2610330_2611542_+	tyrosine transporter	NA	NA	NA	NA	NA
BBF59832.1|2611603_2612269_-	hypothetical protein	NA	NA	NA	NA	NA
2612399:2612458	attL	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCT	NA	NA	NA	NA
BBF59833.1|2612625_2613627_-|integrase	integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
BBF59834.1|2613632_2613980_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59835.1|2614009_2614660_-	membrane protein	NA	NA	NA	NA	NA
BBF59836.1|2614675_2615080_-	phage repressor protein	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
BBF59837.1|2615169_2615307_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59838.1|2615378_2615582_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
BBF59839.1|2615963_2616242_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
BBF59840.1|2616253_2616496_+	hypothetical protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
BBF59841.1|2616492_2616606_+	membrane protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
BBF59842.1|2616692_2616896_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
BBF59843.1|2616892_2617111_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	50.8	8.6e-08
BBF59844.1|2617219_2617609_+	inositol monophosphatase 1	NA	NA	NA	NA	NA
BBF59845.1|2617605_2620446_+	replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
BBF59846.1|2620522_2621482_+	plasmid partition protein	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
BBF59847.1|2621486_2621798_+	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
BBF59848.1|2621861_2622452_+	hypothetical protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
BBF59849.1|2622941_2623988_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
BBF59850.1|2623987_2625739_-|terminase	phage terminase large subunit	terminase	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
BBF59851.1|2625893_2626730_+	phage scaffolding protein	NA	A0A0A7NRY7	Enterobacteria_phage	98.9	7.9e-150
BBF59852.1|2626753_2627806_+|capsid	phage major capsid protein	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
BBF59853.1|2627851_2628652_+|terminase	phage terminase small subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
BBF59854.1|2628753_2629248_+|capsid	phage capsid completion protein	capsid	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
BBF59855.1|2629247_2629448_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
BBF59856.1|2629450_2629774_+|holin	phage holin protein	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
BBF59857.1|2629770_2630163_+	phage endolysin	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
BBF59858.1|2630159_2630567_+	hypothetical protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
BBF59859.1|2630705_2632583_+	hypothetical protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
BBF59860.1|2632606_2633074_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
BBF59861.1|2633057_2633702_+|tail	phage tail completion protein	tail	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
BBF59862.1|2633698_2634280_+|plate	phage baseplate assembly protein	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
BBF59863.1|2634276_2634627_+|plate	phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
BBF59864.1|2634630_2635527_+|plate	phage baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
BBF59865.1|2635519_2636050_+|tail	phage tail protein	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
BBF59866.1|2636052_2638185_+|tail	phage side tail fiber protein	tail	U5N099	Enterobacteria_phage	66.2	8.0e-130
BBF59867.1|2638184_2638763_+|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
BBF59868.1|2638806_2639379_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59869.1|2639535_2640024_-|tail	phage tail assembly protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	7.5e-84
BBF59870.1|2640036_2642844_-|tail	phage tail protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.7	0.0e+00
BBF59871.1|2642994_2643360_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
BBF59872.1|2643414_2643927_-|tail	phage tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
BBF59873.1|2643926_2645111_-|tail	phage tail sheath protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
BBF59874.1|2645268_2646369_+	phage late gene regulator	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
BBF59875.1|2646783_2647908_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59876.1|2648194_2648455_+	phage regulatory protein	NA	NA	NA	NA	NA
BBF59877.1|2648645_2648786_+	hypothetical protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	5.9e-18
2649729:2649849	attR	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 12
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	2689306	2759084	5678205	transposase,integrase	Bacillus_phage(25.0%)	51	2688406:2688422	2740757:2740773
2688406:2688422	attL	GCGCTCAGCCAGCAGGT	NA	NA	NA	NA
BBF59923.1|2689306_2689600_+|transposase	IS1 transposase InsB	transposase	U5P0U6	Shigella_phage	92.8	8.3e-46
BBF59924.1|2689648_2690344_+	heat shock protein Hsp31	NA	NA	NA	NA	NA
BBF59925.1|2690451_2691810_-	two-component system sensor histidine kinase YedV	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
BBF59926.1|2691806_2692592_-	response regulator	NA	W8CYM9	Bacillus_phage	35.2	4.8e-32
BBF59927.1|2692613_2693027_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
BBF59928.1|2693135_2694140_+	reductase	NA	NA	NA	NA	NA
BBF59929.1|2694140_2694776_+	inner membrane heme subunit for periplasmic YedYZ reductase	NA	NA	NA	NA	NA
BBF59930.1|2695032_2695683_+	zinc and cadmium binding protein	NA	NA	NA	NA	NA
BBF59931.1|2696534_2697332_+	anti-repressor for DgsA	NA	NA	NA	NA	NA
BBF59932.1|2697669_2697831_+|integrase	integrase	integrase	A7X7X0	Dichelobacter_phage	51.3	1.7e-05
BBF59933.1|2697835_2698585_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.0	1.6e-40
BBF59934.1|2698778_2700083_-	salicylate synthetase	NA	NA	NA	NA	NA
BBF59935.1|2700110_2701391_-	MFS transporter	NA	NA	NA	NA	NA
BBF59936.1|2701383_2703186_-	transporter subunit	NA	W8CYL7	Bacillus_phage	26.5	4.6e-22
BBF59937.1|2703172_2704975_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	3.8e-32
BBF59938.1|2705141_2706101_+	transcriptional regulator	NA	NA	NA	NA	NA
BBF59939.1|2706291_2712399_+	siderophore biosynthetic protein	NA	A0A2K9L3I8	Tupanvirus	27.3	8.9e-33
BBF59940.1|2712486_2721054_+	siderophore biosynthetic protein	NA	D0R7J2	Paenibacillus_phage	36.8	1.5e-49
BBF59941.1|2721053_2721968_+	siderophore biosynthetic protein	NA	NA	NA	NA	NA
BBF59942.1|2721964_2723065_+	oxidoreductase	NA	NA	NA	NA	NA
BBF59943.1|2723061_2723865_+	thioesterase	NA	NA	NA	NA	NA
BBF59944.1|2723868_2725434_+	2,3-dihydroxybenzoate-AMP ligase	NA	NA	NA	NA	NA
BBF59945.1|2725564_2727586_+	ligand-gated channel protein	NA	NA	NA	NA	NA
BBF59946.1|2728235_2728985_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59947.1|2729117_2730380_+	adhesin	NA	NA	NA	NA	NA
BBF59948.1|2730428_2731076_+	adhesin	NA	NA	NA	NA	NA
BBF59949.1|2731203_2732256_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59950.1|2732570_2733887_+	shikimate transporter	NA	NA	NA	NA	NA
BBF59951.1|2733988_2735443_+	AMP nucleosidase	NA	NA	NA	NA	NA
BBF59952.1|2735785_2736502_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59953.1|2737132_2738587_-	MATE efflux family protein	NA	NA	NA	NA	NA
BBF59954.1|2738893_2739199_-	ssuEADCB/tauABCD operon transcriptional activator	NA	NA	NA	NA	NA
BBF59955.1|2739247_2739844_-	ssuEADCB/tauABCD operon transcriptional activator	NA	NA	NA	NA	NA
BBF59956.1|2739945_2740863_-	nitrogen assimilation regulon transcriptional regulator	NA	NA	NA	NA	NA
2740757:2740773	attR	ACCTGCTGGCTGAGCGC	NA	NA	NA	NA
BBF59957.1|2741307_2742255_-	L,D-transpeptidase linking Lpp to murein	NA	NA	NA	NA	NA
BBF59958.1|2742316_2743396_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
BBF59959.1|2743407_2744151_-	cobalamin synthase	NA	NA	NA	NA	NA
BBF59960.1|2744147_2744690_-	cobinamide kinase and cobinamide phosphate guanylyltransferase	NA	NA	NA	NA	NA
BBF59961.1|2746539_2747004_-|transposase	IS3 transposase OrfB	transposase	A0A0P0I4A4	Acinetobacter_phage	38.3	1.2e-17
BBF59962.1|2747000_2747300_-|transposase	IS3 transposase OrfA	transposase	NA	NA	NA	NA
BBF59963.1|2747386_2748085_+	phosphotriesterase	NA	NA	NA	NA	NA
BBF59964.1|2749011_2749728_-|transposase	ISEc38 transposase	transposase	NA	NA	NA	NA
BBF59965.1|2750424_2750943_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59966.1|2751128_2752097_+|transposase	transposase	transposase	NA	NA	NA	NA
BBF59967.1|2752106_2752499_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59968.1|2752664_2753234_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59969.1|2754946_2755153_+	putative phage protein	NA	NA	NA	NA	NA
BBF59970.1|2755239_2755842_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59971.1|2756163_2757102_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59972.1|2757154_2758687_-|transposase	ISEc8 transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	7.1e-298
BBF59973.1|2758736_2759084_-|transposase	ISEc8 transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
>prophage 13
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	2768505	2773823	5678205	transposase	Stx2-converting_phage(50.0%)	9	NA	NA
BBF59981.1|2768505_2770044_-|transposase	ISEc22 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
BBF59982.1|2770092_2770440_-|transposase	ISEc22 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
BBF59983.1|2770436_2770841_-	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
BBF59984.1|2770869_2771187_-	hypothetical protein	NA	NA	NA	NA	NA
BBF59985.1|2771349_2771583_+	hypothetical protein	NA	NA	NA	NA	NA
BBF59986.1|2771682_2772501_+	hypothetical protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
BBF59987.1|2772555_2773041_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
BBF59988.1|2773056_2773533_+	DNA repair protein	NA	NA	NA	NA	NA
BBF59989.1|2773601_2773823_+	hypothetical protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 14
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	2807457	2813759	5678205		Enterobacteria_phage(50.0%)	6	NA	NA
BBF60026.1|2807457_2808000_-	dTDP-4-deoxyrhamnose-3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	1.9e-51
BBF60027.1|2808004_2808883_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.1	2.5e-106
BBF60028.1|2808940_2809840_-	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	34.8	5.7e-29
BBF60029.1|2809839_2810925_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.4e-101
BBF60030.1|2811296_2812190_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
BBF60031.1|2812364_2813759_-	colanic acid biosynthesis protein	NA	A0A291LBB9	Klebsiella_phage	32.3	2.2e-19
>prophage 15
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	2905201	2916939	5678205	transposase	Enterobacteria_phage(63.64%)	14	NA	NA
BBF60110.1|2905201_2906338_+	VMA domain YehL ATPase stimulator	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
BBF60111.1|2906334_2908335_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
BBF60112.1|2908459_2908591_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	95.0	9.1e-13
BBF60113.1|2908666_2909047_+	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
BBF60114.1|2909043_2909391_+|transposase	ISEc8 transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BBF60115.1|2909440_2910826_+|transposase	ISEc8 transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
BBF60116.1|2910909_2911218_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.0	1.0e-46
BBF60117.1|2911257_2911728_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
BBF60118.1|2911774_2912494_-	two-component regulatory system response regulator YehT	NA	NA	NA	NA	NA
BBF60119.1|2912490_2914176_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
BBF60120.1|2914397_2915129_+	transcriptional activator of csgD and csgBA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
BBF60121.1|2915188_2915296_+	membrane protein	NA	NA	NA	NA	NA
BBF60122.1|2915276_2916008_-	ABC transporter permease	NA	NA	NA	NA	NA
BBF60123.1|2916012_2916939_-	transporter subunit: ATP-binding component of ABC superfamily protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 16
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	2985956	3088111	5678205	integrase,portal,tail,terminase,holin,transposase,head,protease	Enterobacteria_phage(37.97%)	119	3023106:3023124	3097327:3097345
BBF60183.1|2985956_2987198_+|integrase	integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.2e-98
BBF60184.1|2987694_2987901_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
BBF60185.1|2988280_2988454_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
BBF60186.1|2988584_2989145_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	45.5	9.0e-17
BBF60187.1|2989134_2989377_+	hypothetical protein	NA	NA	NA	NA	NA
BBF60188.1|2989349_2989571_+	hypothetical protein	NA	NA	NA	NA	NA
BBF60189.1|2989572_2989806_+	hypothetical protein	NA	NA	NA	NA	NA
BBF60190.1|2989811_2990111_+	hypothetical protein	NA	NA	NA	NA	NA
BBF60191.1|2990107_2991508_+	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
BBF60192.1|2991524_2991713_+	hypothetical protein	NA	NA	NA	NA	NA
BBF60193.1|2991709_2991955_+	hypothetical protein	NA	NA	NA	NA	NA
BBF60194.1|2992085_2992280_+	hypothetical protein	NA	NA	NA	NA	NA
BBF60195.1|2992283_2992445_+	hypothetical protein	NA	NA	NA	NA	NA
BBF60196.1|2992572_2993061_+|terminase	phage terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	4.6e-25
BBF60197.1|2993072_2993234_+	hypothetical protein	NA	NA	NA	NA	NA
BBF60198.1|2993223_2994147_+|head,protease	phage head protease	head,protease	A0A0R6PHC6	Moraxella_phage	24.9	6.9e-14
BBF60199.1|2994839_2997206_-	autotransporter outer membrane protein	NA	NA	NA	NA	NA
BBF60200.1|2997525_2998173_+	two-component regulatory system response regulator NarP	NA	NA	NA	NA	NA
BBF60201.1|2998207_2999260_-	heme lyase subunit CcmH	NA	NA	NA	NA	NA
BBF60202.1|2999256_2999814_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
BBF60203.1|2999810_3001754_-	heme lyase subunit CcmF	NA	NA	NA	NA	NA
BBF60204.1|3001750_3002230_-	cytochrome c-type biogenesis protein CcmE	NA	NA	NA	NA	NA
BBF60205.1|3002226_3002436_-	cytochrome c biogenesis protein	NA	NA	NA	NA	NA
BBF60206.1|3002432_3003170_-	heme export ABC transporter permease	NA	NA	NA	NA	NA
BBF60207.1|3003211_3003874_-	heme export ABC transporter permease	NA	NA	NA	NA	NA
BBF60208.1|3003870_3004488_-	heme export ABC transporter ATPase	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
BBF60209.1|3004506_3005109_-	quinol dehydrogenase	NA	NA	NA	NA	NA
BBF60210.1|3005118_3005568_-	cytochrome c-type protein NapB	NA	NA	NA	NA	NA
BBF60211.1|3005564_3006428_-	ferredoxin-type protein	NA	NA	NA	NA	NA
BBF60212.1|3006414_3007110_-	ferredoxin-type protein	NA	NA	NA	NA	NA
BBF60213.1|3007116_3009603_-	periplasmic nitrate reductase NapA	NA	NA	NA	NA	NA
BBF60214.1|3009599_3009863_-	nitrate reductase	NA	NA	NA	NA	NA
BBF60215.1|3009852_3010347_-	ferredoxin-type protein	NA	NA	NA	NA	NA
BBF60216.1|3010455_3010620_+	hypothetical protein	NA	NA	NA	NA	NA
BBF60217.1|3010755_3011244_+	ecotin	NA	NA	NA	NA	NA
BBF60218.1|3011392_3013039_-	malate dehydrogenase	NA	NA	NA	NA	NA
BBF60219.1|3013256_3014900_-	microcin J25 efflux ABC transporter permease/ATPase	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
BBF60220.1|3014975_3015626_-	oxidative demethylase of N1-methyladenine or N3-methylcytosine DNA lesions	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
BBF60221.1|3015625_3016690_-	bifunctional transcriptional activator/DNA repair enzyme Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
BBF60222.1|3016763_3017819_-	thiamine-synthetic flavin transferase lipoprotein	NA	NA	NA	NA	NA
BBF60223.1|3017930_3019022_-	outer membrane porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
BBF60224.1|3019760_3022433_+	phosphotransfer intermediate protein in two-component regulatory system with RcsBC	NA	NA	NA	NA	NA
BBF60225.1|3022449_3023100_+	two-component regulatory system response regulator RcsB	NA	NA	NA	NA	NA
3023106:3023124	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
BBF60226.1|3023185_3026035_-	hybrid sensory kinase in two-component regulatory system with RcsB and YojN	NA	A0A1V0SGX0	Hokovirus	27.0	1.7e-42
BBF60227.1|3026309_3027086_-	hypothetical protein	NA	NA	NA	NA	NA
BBF60228.1|3027090_3028740_-	hypothetical protein	NA	NA	NA	NA	NA
BBF60229.1|3028740_3033345_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
BBF60230.1|3033936_3035259_+	T3SS secreted effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
BBF60231.1|3035952_3036600_-	T3SS secreted effector NleG	NA	B6DZC0	Enterobacteria_phage	43.3	2.4e-37
BBF60232.1|3036809_3037079_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	94.4	7.3e-41
BBF60233.1|3037080_3038394_-|tail	phage tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
BBF60234.1|3038458_3039058_-	outer membrane precursor Lom	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
BBF60235.1|3039125_3039341_-	phage host specificity protein	NA	Q9LA64	Enterobacterial_phage	95.8	2.9e-32
BBF60236.1|3039403_3040942_-|transposase	ISEc22 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
BBF60237.1|3040990_3041338_-|transposase	ISEc22 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
BBF60238.1|3041334_3041739_-	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
BBF60239.1|3041767_3045067_-	phage host specificity protein	NA	A5LH43	Enterobacteria_phage	95.2	0.0e+00
BBF60240.1|3045127_3045700_-|tail	phage tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	98.9	2.6e-83
BBF60241.1|3045696_3046440_-|tail	phage tail assembly protein	tail	K7PLW1	Enterobacteria_phage	94.3	5.2e-145
BBF60242.1|3046445_3047144_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
BBF60243.1|3047143_3047473_-|tail	phage minor tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
BBF60244.1|3047469_3050031_-|tail	phage tail length tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
BBF60245.1|3050011_3050425_-|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
BBF60246.1|3050451_3050883_-|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
BBF60247.1|3050896_3051649_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
BBF60248.1|3051656_3052052_-|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
BBF60249.1|3052048_3052624_-|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
BBF60250.1|3052638_3052992_-|head,tail	phage head-tail adaptor protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
BBF60251.1|3052984_3053392_-	phage DNA packaging protein	NA	NA	NA	NA	NA
BBF60252.1|3053410_3054295_-|head	phage head protein	head	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
BBF60253.1|3054352_3054700_-|head	phage head-DNA stabilization protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
BBF60254.1|3054736_3056242_-|head,protease	phage prohead protease	head,protease	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
BBF60255.1|3056231_3057824_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	8.4e-185
BBF60256.1|3057820_3058027_-|head,tail	phage head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
BBF60257.1|3058010_3058217_-|terminase	phage terminase large subunit	terminase	A0A2I6TC92	Escherichia_phage	59.4	1.1e-12
BBF60258.1|3058229_3059327_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	66.8	5.5e-151
BBF60259.1|3059592_3059937_-|terminase	phage terminase large subunit	terminase	K7PGW7	Enterobacteria_phage	63.6	2.5e-25
BBF60260.1|3059908_3060418_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
BBF60261.1|3061366_3061660_+	Bor protein precursor	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
BBF60262.1|3061691_3062153_-	phage murein endopeptidase	NA	A0A0K2FJD0	Enterobacteria_phage	98.7	9.2e-76
BBF60263.1|3062149_3062647_-	phage lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
BBF60264.1|3062646_3062862_-|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
BBF60265.1|3063727_3064471_-	membrane protein	NA	NA	NA	NA	NA
BBF60266.1|3064723_3065347_-	phage antitermination protein Q	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
BBF60267.1|3065343_3066009_-	serine/threonine-specific protein phosphatase 1	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
BBF60268.1|3066005_3066608_-	recombination endonuclease	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
BBF60269.1|3066582_3067149_-	hypothetical protein	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
BBF60270.1|3067141_3067258_-	hypothetical protein	NA	NA	NA	NA	NA
BBF60271.1|3067648_3069484_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
BBF60272.1|3070166_3070694_-	DNA methylase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
BBF60273.1|3070690_3071137_-	recombination protein	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
BBF60274.1|3071144_3071351_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
BBF60275.1|3071423_3071714_-	phage exclusion protein	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
BBF60276.1|3071710_3072412_-	phage replication protein	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
BBF60277.1|3072408_3073347_-	phage replication protein	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
BBF60278.1|3073379_3073676_-	phage regulatory protein CII	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
BBF60279.1|3073785_3073971_-	phage repressor protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
BBF60280.1|3074342_3074702_+	phage repressor protein CI	NA	K7PM82	Enterobacteria_phage	100.0	2.8e-64
BBF60281.1|3075016_3075322_+	phage early gene regulator N	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
BBF60282.1|3075330_3075663_+	phage regulatory protein	NA	K7PJW2	Enterobacteria_phage	99.1	6.2e-58
BBF60283.1|3075796_3076267_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
BBF60284.1|3076416_3076785_+	single stranded DNA-binding protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
BBF60285.1|3076857_3077022_+	phage regulatory protein CIII	NA	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
BBF60286.1|3076990_3077155_+	phage kil protein	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
BBF60287.1|3077209_3077506_+	phage host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
BBF60288.1|3077511_3078297_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
BBF60289.1|3078293_3078971_+	exonuclease	NA	A0A1I9LJM9	Stx_converting_phage	99.6	3.0e-131
BBF60290.1|3078970_3079153_+	hypothetical protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
BBF60291.1|3079125_3079317_+	hypothetical protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
BBF60292.1|3079393_3079609_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
BBF60293.1|3079707_3079929_+	conjugal transfer protein	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
BBF60294.1|3079925_3080531_+	hypothetical protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
BBF60295.1|3080527_3080878_+	putative phage protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
BBF60296.1|3080952_3081195_+	hypothetical protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
BBF60297.1|3081313_3081658_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
BBF60298.1|3081959_3083030_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
BBF60299.1|3083044_3083650_-	hypothetical protein	NA	NA	NA	NA	NA
BBF60300.1|3083646_3085335_-	hypothetical protein	NA	NA	NA	NA	NA
BBF60301.1|3085483_3088111_-	DNA gyrase GyrA	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
3097327:3097345	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
>prophage 17
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	3164610	3261479	5678205	integrase,capsid,portal,terminase,tRNA,holin,transposase,head	Enterobacteria_phage(41.1%)	118	3158950:3158965	3268208:3268223
3158950:3158965	attL	TGATTATCTTGCTTAA	NA	NA	NA	NA
BBF60371.1|3164610_3165501_-|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	44.2	4.0e-67
BBF60372.1|3165697_3166471_-	histidine ABC transporter ATP-binding protein	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
BBF60373.1|3166478_3167195_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
BBF60374.1|3167191_3167878_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
BBF60375.1|3167967_3168750_-	histidine ABC transporter periplasmic binding protein	NA	NA	NA	NA	NA
BBF60376.1|3168970_3169753_-	lysine/arginine/ornithine transporter subunit	NA	NA	NA	NA	NA
BBF60377.1|3170018_3170588_-	3-octaprenyl-4-hydroxybenzoate carboxy-lyase	NA	NA	NA	NA	NA
BBF60378.1|3170682_3172200_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
BBF60379.1|3172236_3172725_-	colicin V production protein	NA	NA	NA	NA	NA
BBF60380.1|3172983_3173646_-	membrane-anchored periplasmic protein involved in septation	NA	NA	NA	NA	NA
BBF60381.1|3173635_3174904_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
BBF60382.1|3174973_3175888_-	acetyl-CoA carboxylase beta subunit	NA	NA	NA	NA	NA
BBF60383.1|3176043_3176703_-	DedA family inner membrane protein	NA	NA	NA	NA	NA
BBF60384.1|3176785_3177598_-|tRNA	tRNA pseudouridine(38-40) synthase	tRNA	NA	NA	NA	NA
BBF60385.1|3177597_3178611_-	semialdehyde dehydrogenase	NA	NA	NA	NA	NA
BBF60386.1|3178676_3179813_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
BBF60387.1|3179911_3180907_+	flagella assembly protein	NA	NA	NA	NA	NA
BBF60388.1|3180903_3182082_-	arabinose efflux transporter	NA	NA	NA	NA	NA
BBF60389.1|3182365_3183586_-	3-oxoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
BBF60390.1|3183744_3185751_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
BBF60391.1|3185871_3186150_-	hypothetical protein	NA	NA	NA	NA	NA
BBF60392.1|3186183_3186732_-	elongation factor	NA	NA	NA	NA	NA
BBF60393.1|3186731_3187541_-	TauE/TSUP family inner membrane protein	NA	NA	NA	NA	NA
BBF60394.1|3187540_3188365_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
BBF60395.1|3188368_3189454_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
BBF60396.1|3189488_3190421_-	adenine-specific methylase	NA	NA	NA	NA	NA
BBF60397.1|3190586_3191138_+	DNA endonuclease	NA	NA	NA	NA	NA
BBF60398.1|3191210_3192062_-	outer membrane protein	NA	NA	NA	NA	NA
BBF60399.1|3192063_3192603_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF60400.1|3192599_3193088_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF60401.1|3193084_3193594_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF60402.1|3193609_3194362_-	periplasmic pilin chaperone	NA	NA	NA	NA	NA
BBF60403.1|3194381_3197027_-	outer membrane usher protein	NA	NA	NA	NA	NA
BBF60404.1|3197108_3197672_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF60405.1|3198355_3198841_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
BBF60406.1|3199043_3201188_-	fatty acid oxidation complex subunit alpha	NA	NA	NA	NA	NA
BBF60407.1|3201187_3202498_-	beta-ketoacyl-CoA thiolase	NA	NA	NA	NA	NA
BBF60408.1|3202677_3202962_-	hypothetical protein	NA	NA	NA	NA	NA
BBF60409.1|3203333_3204674_+	long-chain fatty acid outer membrane transporter	NA	NA	NA	NA	NA
BBF60410.1|3205038_3206097_+	hypothetical protein	NA	NA	NA	NA	NA
BBF60411.1|3206278_3207034_-	phospholipid-binding lipoprotein	NA	NA	NA	NA	NA
BBF60412.1|3207327_3208260_+	inner membrane protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
BBF60413.1|3208571_3209729_+|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	99.2	1.1e-221
BBF60414.1|3209973_3211116_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.9	9.2e-24
BBF60415.1|3211186_3213313_-	hypothetical protein	NA	Q9AYY6	Salmonella_phage	92.7	3.3e-59
BBF60416.1|3213435_3214371_-	antirepressor	NA	A0A2H4FRZ6	Salmonella_phage	88.7	1.6e-103
BBF60417.1|3214439_3214601_-	transcriptional repressor	NA	B9UDL5	Salmonella_phage	94.3	3.8e-21
BBF60418.1|3214694_3214934_+	hypothetical protein	NA	I6R0M0	Salmonella_phage	76.6	5.9e-26
BBF60419.1|3214933_3215281_+	hypothetical protein	NA	NA	NA	NA	NA
BBF60420.1|3215273_3215774_+	hypothetical protein	NA	NA	NA	NA	NA
BBF60421.1|3215854_3216175_+	hypothetical protein	NA	NA	NA	NA	NA
BBF60422.1|3216183_3218187_-	DNA injection protein	NA	A0A2I7QW93	Vibrio_phage	36.9	2.6e-98
BBF60423.1|3218186_3219602_-	DNA injection protein	NA	I6RSG0	Salmonella_phage	80.9	1.7e-200
BBF60424.1|3219612_3220308_-	DNA transfer protein	NA	A0A2H4FUQ9	Salmonella_phage	98.7	2.8e-116
BBF60425.1|3220310_3220766_-|head	phage head assembly protein	head	G5DA79	Enterobacteria_phage	97.4	2.8e-85
BBF60426.1|3220765_3221614_-|head	phage head DNA stabilization protein	head	Q716G6	Shigella_phage	97.9	1.5e-100
BBF60427.1|3221613_3223032_-|head	phage head DNA stabilization protein	head	Q716G7	Shigella_phage	99.2	2.3e-274
BBF60428.1|3223040_3223523_-|head	phage head DNA stabilization protein	head	Q716G8	Shigella_phage	100.0	3.8e-88
BBF60429.1|3223497_3223683_-	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
BBF60430.1|3223725_3224499_-|capsid	phage major capsid protein	capsid	Q716H0	Shigella_phage	99.2	2.1e-133
BBF60431.1|3224482_3225370_-|transposase	IS629 transposase OrfB	transposase	Q6H9S6	Enterobacteria_phage	99.7	1.2e-169
BBF60432.1|3225369_3225696_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF60433.1|3225701_3226310_-|capsid	phage major capsid protein	capsid	Q716H0	Shigella_phage	96.4	2.4e-100
BBF60434.1|3226321_3227206_-|capsid	phage capsid scaffolding protein	capsid	Q716H1	Shigella_phage	98.6	3.4e-143
BBF60435.1|3227219_3229310_-|portal	phage portal protein	portal	Q9AYZ9	Salmonella_phage	99.3	0.0e+00
BBF60436.1|3229348_3230761_-|terminase	phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.6	2.2e-277
BBF60437.1|3230757_3231183_-|terminase	phage terminase small subunit	terminase	Q716H4	Shigella_phage	87.9	1.8e-65
BBF60438.1|3231262_3231505_-	hypothetical protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
BBF60439.1|3231608_3231980_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	88.6	3.2e-55
BBF60440.1|3232263_3232782_-	transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	1.2e-92
BBF60441.1|3232987_3233425_-	phage murein endopeptidase	NA	K7P710	Enterobacteria_phage	97.2	1.1e-70
BBF60442.1|3233421_3233898_-	phage endolysin	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
BBF60443.1|3233881_3234205_-|holin	phage holin protein	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
BBF60444.1|3235277_3235901_-	phage antitermination protein Q	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
BBF60445.1|3235897_3236086_-	phage protein NinH	NA	A5VW84	Enterobacteria_phage	95.2	1.0e-25
BBF60446.1|3236082_3236445_-	phage endonuclease RUS	NA	K7P6I9	Enterobacteria_phage	98.3	2.3e-61
BBF60447.1|3236441_3236732_-	hypothetical protein	NA	K7P7N7	Enterobacteria_phage	100.0	3.4e-52
BBF60448.1|3236731_3237001_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
BBF60449.1|3236993_3237170_-	phage protein NinF	NA	A0A220NRM2	Escherichia_phage	98.3	2.5e-26
BBF60450.1|3237169_3237529_-	hypothetical protein	NA	G8EYI2	Enterobacteria_phage	95.0	1.0e-61
BBF60451.1|3237704_3238232_-	DNA methylase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
BBF60452.1|3238228_3238675_-	recombination protein	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
BBF60453.1|3238682_3238889_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
BBF60454.1|3238961_3239252_-	phage exclusion protein	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
BBF60455.1|3239248_3239950_-	phage replication protein	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
BBF60456.1|3239946_3240885_-	phage replication protein	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
BBF60457.1|3240917_3241214_-	phage regulatory protein CII	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
BBF60458.1|3241311_3241536_-	phage regulatory protein Cro	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
BBF60459.1|3241785_3242355_+	phage repressor protein CI	NA	A0A0N7C1P9	Escherichia_phage	83.1	5.5e-86
BBF60460.1|3242395_3242692_+	hypothetical protein	NA	NA	NA	NA	NA
BBF60461.1|3243298_3243742_+	hypothetical protein	NA	K7P6R2	Enterobacteria_phage	100.0	7.6e-59
BBF60462.1|3243772_3244267_-	hypothetical protein	NA	K7PK22	Enterobacteria_phage	99.4	1.6e-89
BBF60463.1|3244467_3244938_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	7.0e-87
BBF60464.1|3245131_3245272_+	phage regulatory protein CIII	NA	Q9AZ26	Salmonella_phage	100.0	3.3e-21
BBF60465.1|3245264_3245378_+	phage host killing protein	NA	G9L669	Escherichia_phage	100.0	2.7e-13
BBF60466.1|3245374_3245563_+	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
BBF60467.1|3245571_3246252_+	hypothetical protein	NA	G9L667	Escherichia_phage	100.0	3.4e-127
BBF60468.1|3246248_3246836_+	hypothetical protein	NA	G9L666	Escherichia_phage	99.5	4.9e-106
BBF60469.1|3246859_3247156_+	ABC transporter ATP-binding protein	NA	G9L665	Escherichia_phage	98.0	2.3e-48
BBF60470.1|3247166_3247331_+	hypothetical protein	NA	K7P7R0	Enterobacteria_phage	98.1	9.3e-23
BBF60471.1|3247327_3247915_+	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	96.6	1.1e-57
BBF60472.1|3247911_3248652_+	hypothetical protein	NA	K7P6J7	Enterobacteria_phage	94.8	5.9e-56
BBF60473.1|3248648_3248987_+	putative phage protein	NA	Q9G077	Enterobacteria_phage	81.9	2.1e-37
BBF60474.1|3248986_3249265_+	hypothetical protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
BBF60475.1|3249422_3249722_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.4e-53
BBF60476.1|3249757_3249925_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
BBF60477.1|3249982_3250183_+	response regulator inhibitor for tor operon	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
BBF60478.1|3250446_3251112_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	53.2	3.2e-61
BBF60479.1|3251151_3251637_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	62.9	8.0e-54
BBF60480.1|3252902_3253058_+	transcriptional regulator	NA	NA	NA	NA	NA
BBF60481.1|3253054_3253579_-|integrase	integrase	integrase	U5P429	Shigella_phage	51.2	1.7e-46
BBF60482.1|3253517_3253898_-	hypothetical protein	NA	NA	NA	NA	NA
BBF60483.1|3253894_3254194_-|transposase	IS3 transposase OrfA	transposase	NA	NA	NA	NA
BBF60484.1|3254370_3256731_-	hypothetical protein	NA	NA	NA	NA	NA
BBF60485.1|3257374_3258391_-	hypothetical protein	NA	NA	NA	NA	NA
BBF60486.1|3258893_3259541_+|transposase	ISCro1 transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.1e-21
BBF60487.1|3259540_3259888_+|transposase	ISCro1 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
BBF60488.1|3259907_3261479_+|transposase	ISCro1 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.3e-169
3268208:3268223	attR	TTAAGCAAGATAATCA	NA	NA	NA	NA
>prophage 18
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	3420998	3464662	5678205	integrase,tail,terminase,holin,head	Escherichia_phage(50.91%)	56	3422837:3422853	3461548:3461564
BBF60632.1|3420998_3421151_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
BBF60633.1|3421186_3421360_+	hypothetical protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
BBF60634.1|3421673_3422189_+	outer membrane integrity lipoprotein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
BBF60635.1|3422204_3422744_+	nalidixic acid resistance protein	NA	G9L6F0	Escherichia_phage	99.4	9.9e-45
3422837:3422853	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
BBF60636.1|3422963_3423446_-	endopeptidase	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	88.1	3.6e-70
BBF60637.1|3423442_3424072_-	phage endolysin	NA	G9L6E8	Escherichia_phage	97.1	4.0e-114
BBF60638.1|3424061_3424370_-|holin	phage holin protein	holin	A0A193GYK3	Enterobacter_phage	97.0	1.1e-48
BBF60639.1|3424366_3424771_-	membrane protein	NA	T1SA79	Salmonella_phage	96.9	2.5e-61
BBF60640.1|3425266_3425374_+	bactoprenol glucosyl transferase	NA	U5P087	Shigella_phage	88.2	3.8e-09
BBF60641.1|3425406_3428028_-	endo-alpha-sialidase	NA	A0A193GYU1	Enterobacter_phage	70.1	4.3e-125
BBF60642.1|3428223_3428481_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	3.4e-43
BBF60643.1|3428512_3428809_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	2.5e-50
BBF60644.1|3429004_3431479_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.0	0.0e+00
BBF60645.1|3431484_3433287_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.5	0.0e+00
BBF60646.1|3433283_3435797_-	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	99.8	0.0e+00
BBF60647.1|3435796_3436342_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
BBF60648.1|3436341_3436806_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.9e-84
BBF60649.1|3436805_3439277_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.8	0.0e+00
BBF60650.1|3439276_3439882_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	98.5	4.0e-111
BBF60651.1|3439881_3440205_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	99.1	9.1e-54
BBF60652.1|3440255_3440591_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
BBF60653.1|3440601_3441039_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	96.6	7.7e-72
BBF60654.1|3441090_3442077_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
BBF60655.1|3442091_3442787_-	phage endopeptidase Rz	NA	G9L6C4	Escherichia_phage	97.8	3.7e-92
BBF60656.1|3442789_3443086_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
BBF60657.1|3443082_3444762_-|head,tail	phage head-tail connector protein	head,tail	G9L6C2	Escherichia_phage	99.3	2.3e-302
BBF60658.1|3444776_3444983_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
BBF60659.1|3445685_3446057_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	89.4	4.5e-57
BBF60660.1|3446147_3447623_-	phage DNA packaging protein	NA	G9L6B8	Escherichia_phage	99.4	1.3e-296
BBF60661.1|3447619_3448213_-|terminase	phage terminase small subunit	terminase	G9L6B7	Escherichia_phage	100.0	1.2e-104
BBF60662.1|3448334_3448673_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	8.3e-58
BBF60663.1|3448665_3448947_-	RNA-binding protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	92.5	1.0e-45
BBF60664.1|3448939_3449506_-	hypothetical protein	NA	K7PK20	Enterobacteria_phage	91.3	2.3e-76
BBF60665.1|3449502_3449712_-	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
BBF60666.1|3449713_3449905_-	hypothetical protein	NA	A0A0F6R8N3	Escherichia_coli_O157_typing_phage	98.4	8.6e-28
BBF60667.1|3450269_3450875_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	95.1	8.7e-58
BBF60668.1|3450840_3451125_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	51.8	3.0e-16
BBF60669.1|3451121_3451703_-	hypothetical protein	NA	A0A125RPT9	Escherichia_phage	85.4	2.2e-42
BBF60670.1|3451699_3452332_-	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	68.0	1.9e-63
BBF60671.1|3452393_3452738_-	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	1.4e-60
BBF60672.1|3452855_3453641_-	phage replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	98.5	6.7e-151
BBF60673.1|3453637_3454453_-	primosomal protein DnaT	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
BBF60674.1|3454468_3454669_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
BBF60675.1|3454818_3455049_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
BBF60676.1|3455203_3455788_+	transcriptional repressor	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
BBF60677.1|3455941_3456094_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
BBF60678.1|3456096_3456396_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	2.2e-46
BBF60679.1|3456392_3457214_+	exonuclease VIII	NA	G9L6A3	Escherichia_phage	96.7	1.8e-159
BBF60680.1|3457210_3458092_+	DNA recombinase	NA	G9L6A2	Escherichia_phage	98.6	2.6e-159
BBF60681.1|3458141_3458390_+	AlpA family transcriptional regulator	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
BBF60682.1|3458547_3458799_+	hypothetical protein	NA	G9L6A0	Escherichia_phage	97.6	4.4e-40
BBF60683.1|3458791_3459442_+	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	98.6	2.5e-127
BBF60684.1|3459438_3460098_+	serine/threonine-specific protein phosphatase 1	NA	K7P6H8	Enterobacteria_phage	79.5	3.3e-103
BBF60685.1|3460100_3461357_-|integrase	integrase	integrase	G9L697	Escherichia_phage	99.3	1.7e-236
BBF60686.1|3461549_3463127_-	glutamine aminotransferase	NA	NA	NA	NA	NA
3461548:3461564	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
BBF60687.1|3463195_3464662_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 19
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	3542151	3647023	5678205	integrase,portal,tail,terminase,tRNA,holin,transposase,head,protease	Stx2-converting_phage(30.0%)	108	3623507:3623522	3653775:3653790
BBF60754.1|3542151_3542889_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
BBF60755.1|3543020_3544355_+	ATP-dependent RNA helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
BBF60756.1|3544563_3545445_-	transcriptional regulator	NA	NA	NA	NA	NA
BBF60757.1|3545547_3546135_+	cysteine and O-acetylserine exporter	NA	NA	NA	NA	NA
BBF60758.1|3546190_3546574_-	autonomous glycyl radical cofactor	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
BBF60759.1|3546878_3547568_+	uracil-DNA-glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
BBF60760.1|3547615_3548653_-	methyltransferase	NA	NA	NA	NA	NA
BBF60761.1|3548859_3549279_+	thioredoxin 2	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
BBF60762.1|3549347_3550046_+	hypothetical protein	NA	NA	NA	NA	NA
BBF60763.1|3550077_3552738_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
BBF60764.1|3552851_3554207_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
BBF60765.1|3554303_3554576_+	lipoprotein	NA	NA	NA	NA	NA
BBF60766.1|3554572_3555871_-	alpha-ketoglutarate transporter	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
BBF60767.1|3561723_3564297_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
BBF60768.1|3564426_3565158_-	hypothetical protein	NA	NA	NA	NA	NA
BBF60769.1|3565154_3566135_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
BBF60770.1|3566269_3567007_+	BamABCDE complex OM biogenesis lipoprotein	NA	NA	NA	NA	NA
BBF60771.1|3567277_3567619_+	translation inhibitor protein RaiA	NA	NA	NA	NA	NA
BBF60772.1|3567868_3569029_+	chorismate mutase and prephenate dehydratase	NA	NA	NA	NA	NA
BBF60773.1|3569071_3570193_-	chorismate mutase-T and prephenate dehydrogenase	NA	NA	NA	NA	NA
BBF60774.1|3570203_3571274_-	3-deoxy-D-arabino-heptulosonate-7-phosphate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
BBF60775.1|3571483_3571849_+	lipoprotein	NA	NA	NA	NA	NA
BBF60776.1|3571998_3572517_+	periplasmic inhibitor of YfiN activity	NA	NA	NA	NA	NA
BBF60777.1|3572506_3573733_+	membrane-anchored diguanylate cyclase	NA	NA	NA	NA	NA
BBF60778.1|3573748_3574231_+	OM lipoprotein positive effector of YfiN activity	NA	NA	NA	NA	NA
BBF60779.1|3574307_3574655_-	50S ribosomal subunit protein L19	NA	NA	NA	NA	NA
BBF60780.1|3574696_3575464_-|tRNA	tRNA m(1)G37 methyltransferase	tRNA	NA	NA	NA	NA
BBF60781.1|3575494_3576043_-	ribosome maturation factor	NA	NA	NA	NA	NA
BBF60782.1|3576061_3576310_-	30S ribosomal subunit protein S16	NA	NA	NA	NA	NA
BBF60783.1|3576558_3577920_-	signal recognition particle protein	NA	NA	NA	NA	NA
BBF60784.1|3578011_3578878_+	cytochrome c assembly protein family inner membrane protein	NA	NA	NA	NA	NA
BBF60785.1|3578943_3580185_+	inner membrane protein	NA	NA	NA	NA	NA
BBF60786.1|3580239_3580833_-	co-chaperone GrpE	NA	NA	NA	NA	NA
BBF60787.1|3580955_3581834_+	NAD kinase	NA	NA	NA	NA	NA
BBF60788.1|3581919_3583581_+	recombination and repair protein RecN	NA	NA	NA	NA	NA
BBF60789.1|3583729_3584071_+	lipoprotein component of BamABCDE OM biogenesis complex	NA	NA	NA	NA	NA
BBF60790.1|3584132_3584423_-	hypothetical protein	NA	NA	NA	NA	NA
BBF60791.1|3584412_3584889_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
BBF60792.1|3585020_3585503_+	tmRNA-binding trans-translation protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
BBF60793.1|3585678_3585804_+	hypothetical protein	NA	NA	NA	NA	NA
BBF60794.1|3587257_3588619_+	T3SS secreted effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	5.6e-52
BBF60795.1|3588446_3588827_-	hypothetical protein	NA	NA	NA	NA	NA
BBF60796.1|3588995_3589496_-	T3SS secreted effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	56.6	1.5e-50
BBF60797.1|3589822_3592396_-	T3SS secreted effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	33.9	5.8e-119
BBF60798.1|3592988_3593237_-	T3SS secreted effector EspX	NA	NA	NA	NA	NA
BBF60799.1|3593179_3595336_-	T3SS secreted effector EspX	NA	NA	NA	NA	NA
BBF60800.1|3595355_3595445_-	hypothetical protein	NA	NA	NA	NA	NA
BBF60801.1|3595551_3595821_-	hypothetical protein	NA	H6WZN0	Escherichia_phage	100.0	3.8e-45
BBF60802.1|3595822_3597136_-|tail	phage tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
BBF60803.1|3597200_3597800_-	outer membrane precursor Lom	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.7e-109
BBF60804.1|3597867_3601341_-	phage host specificity protein	NA	A0A0P0ZCI5	Stx2-converting_phage	97.4	0.0e+00
BBF60805.1|3601579_3602161_-|tail	phage tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.9	3.6e-93
BBF60806.1|3602157_3602901_-|tail	phage tail assembly protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
BBF60807.1|3602911_3603610_-|tail	phage minor tail protein	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
BBF60808.1|3603609_3603951_-|tail	phage minor tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
BBF60809.1|3603943_3607186_-|tail	phage tail length tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.9	0.0e+00
BBF60810.1|3607233_3607443_-|tail	phage tail protein	tail	H6WZM0	Escherichia_phage	100.0	1.5e-33
BBF60811.1|3607538_3607913_-|tail	phage tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	1.7e-64
BBF60812.1|3607918_3608635_-|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
BBF60813.1|3608700_3609045_-|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
BBF60814.1|3609041_3609488_-|tail	phage minor tail protein	tail	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
BBF60815.1|3609484_3609835_-|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BBF60816.1|3609845_3610172_-	phage DNA packaging protein	NA	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
BBF60817.1|3610168_3611392_-|portal	phage portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	100.0	1.7e-105
BBF60818.1|3611388_3612753_-|portal	phage portal protein	portal	A0A0P0ZCX8	Stx2-converting_phage	98.5	2.9e-258
BBF60819.1|3612698_3612920_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
BBF60820.1|3612964_3614902_-|head,protease	phage prohead protease	head,protease	H6WZL0	Escherichia_phage	99.5	0.0e+00
BBF60821.1|3614965_3616627_-|terminase	phage terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
BBF60822.1|3616623_3617187_-|terminase	phage terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
BBF60823.1|3617478_3617844_-	DNase	NA	B6ETE5	Enterobacteria_phage	99.2	5.3e-66
BBF60824.1|3617885_3618110_+	hypothetical protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	7.8e-20
BBF60825.1|3618191_3618506_-	PchABC family transcriptional regulator	NA	NA	NA	NA	NA
BBF60826.1|3618971_3619439_-	phage murein endopeptidase	NA	Q7AYI6	Enterobacteria_phage	79.5	1.5e-57
BBF60827.1|3619435_3619933_-	phage lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
BBF60828.1|3619932_3620139_-|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
BBF60829.1|3620586_3622437_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	99.4	0.0e+00
3623507:3623522	attL	TTTTTAAGATTTTGTT	NA	NA	NA	NA
BBF60830.1|3623716_3624469_-	phage antitermination protein Q	NA	K7PGU5	Enterobacteria_phage	98.8	7.6e-136
BBF60831.1|3624482_3625472_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.2e-192
BBF60832.1|3625479_3626277_-	hypothetical protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
BBF60833.1|3626296_3626686_-	phage holliday junction resolvase	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
BBF60834.1|3626682_3627009_-	repressor	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
BBF60835.1|3627005_3627659_-	DNA adenine methylase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
BBF60836.1|3627658_3628147_-	hypothetical protein	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	9.8e-84
BBF60837.1|3628149_3628968_-	phage replication protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.1e-122
BBF60838.1|3628964_3629189_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
BBF60839.1|3629185_3630337_-	phage antirepressor Ant	NA	K7PLX4	Enterobacteria_phage	96.3	6.9e-205
BBF60840.1|3630333_3630885_-	transcriptional regulator	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
BBF60841.1|3630928_3631129_-	antirepressor	NA	U5P445	Shigella_phage	100.0	7.9e-32
BBF60842.1|3631219_3631894_+	phage repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
BBF60843.1|3632560_3632923_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
BBF60844.1|3632988_3633813_+	hypothetical protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
BBF60845.1|3633941_3634478_+	hypothetical protein	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
BBF60846.1|3634468_3635347_+	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	94.9	1.9e-170
BBF60847.1|3635343_3635547_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
BBF60848.1|3635539_3635779_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
BBF60849.1|3635775_3636105_+	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
BBF60850.1|3636106_3636970_+	putative phage protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
BBF60851.1|3637054_3637297_+	hypothetical protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
BBF60852.1|3637300_3637447_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
BBF60853.1|3637455_3637665_+	phage excisionase	NA	I6PBM8	Cronobacter_phage	88.2	1.6e-30
BBF60854.1|3637619_3638795_+|integrase	integrase	integrase	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
BBF60855.1|3639277_3640186_+	hypothetical protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
BBF60856.1|3640484_3641714_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
BBF60857.1|3641752_3642169_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
BBF60858.1|3642240_3643989_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
BBF60859.1|3643990_3645709_-	histidine kinase-like protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
BBF60860.1|3646262_3646727_-|transposase	IS3 transposase OrfB	transposase	A0A0P0I4A4	Acinetobacter_phage	38.3	1.2e-17
BBF60861.1|3646723_3647023_-|transposase	IS3 transposase OrfA	transposase	NA	NA	NA	NA
3653775:3653790	attR	TTTTTAAGATTTTGTT	NA	NA	NA	NA
>prophage 20
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	3718500	3725640	5678205		Escherichia_phage(83.33%)	6	NA	NA
BBF60935.1|3718500_3721062_+	methyl-directed mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
BBF60936.1|3721167_3721824_+	serine/threonine-specific protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
BBF60937.1|3721874_3722642_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
BBF60938.1|3722837_3723746_+	dehydrogenase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
BBF60939.1|3723742_3725005_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
BBF60940.1|3725001_3725640_+	class II aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 21
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	3877448	3885397	5678205	transposase,integrase	Stx2-converting_phage(42.86%)	8	3875405:3875421	3884490:3884506
3875405:3875421	attL	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
BBF61091.1|3877448_3879020_-|transposase	ISCro1 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.3e-169
BBF61092.1|3879039_3879387_-|transposase	ISCro1 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
BBF61093.1|3879386_3880034_-|transposase	ISCro1 transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.1e-21
BBF61094.1|3880256_3880457_-	hypothetical protein	NA	NA	NA	NA	NA
BBF61095.1|3880458_3881187_-	transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
BBF61096.1|3882095_3882755_-	hypothetical protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
BBF61097.1|3882747_3884355_-|integrase	integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
BBF61098.1|3884641_3885397_-	hypothetical protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
3884490:3884506	attR	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
>prophage 22
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	3970712	4018047	5678205	transposase,integrase,tRNA,protease	Escherichia_phage(33.33%)	46	3988439:3988454	4024393:4024408
BBF61173.1|3970712_3971471_+|protease	metalloprotease	protease	NA	NA	NA	NA
BBF61174.1|3971526_3972270_-	4-hydroxy-2-ketovalerate aldolase	NA	NA	NA	NA	NA
BBF61175.1|3972256_3973366_-	transferase	NA	NA	NA	NA	NA
BBF61176.1|3973369_3974227_-	PTS fructose transporter subunit IID	NA	NA	NA	NA	NA
BBF61177.1|3974226_3974976_-	enzyme IIC component of PTS	NA	NA	NA	NA	NA
BBF61178.1|3975001_3975487_-	enzyme IIB component of PTS	NA	NA	NA	NA	NA
BBF61179.1|3975497_3975926_-	enzyme IIB component of PTS	NA	NA	NA	NA	NA
BBF61180.1|3976044_3978885_-	transcriptional regulator	NA	NA	NA	NA	NA
BBF61181.1|3979101_3980022_-	agmatinase	NA	NA	NA	NA	NA
BBF61182.1|3980157_3980889_-	lipoprotein	NA	NA	NA	NA	NA
BBF61183.1|3981034_3983011_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
BBF61184.1|3983498_3983750_-	inner membrane protein	NA	NA	NA	NA	NA
BBF61185.1|3983805_3984960_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
BBF61186.1|3985395_3986790_+	D-galactose transporter	NA	NA	NA	NA	NA
BBF61187.1|3986908_3987364_+	hypothetical protein	NA	NA	NA	NA	NA
BBF61188.1|3987458_3988166_+	DNA-specific endonuclease I	NA	NA	NA	NA	NA
BBF61189.1|3988245_3988977_+	16S rRNA m(3)U1498 methyltransferase	NA	NA	NA	NA	NA
3988439:3988454	attL	AGGTGCTGGAAGGCAA	NA	NA	NA	NA
BBF61190.1|3988989_3989940_+	glutathione synthetase	NA	NA	NA	NA	NA
BBF61191.1|3989976_3990612_+	hypothetical protein	NA	NA	NA	NA	NA
BBF61192.1|3990611_3991028_+	holliday junction resolvase	NA	NA	NA	NA	NA
BBF61193.1|3991203_3992184_-	twitching motility protein PilT	NA	NA	NA	NA	NA
BBF61194.1|3992201_3992906_+	hypothetical protein	NA	NA	NA	NA	NA
BBF61195.1|3992923_3993490_+	hypothetical protein	NA	NA	NA	NA	NA
BBF61196.1|3993486_3993777_+	hypothetical protein	NA	NA	NA	NA	NA
BBF61197.1|3993784_3994378_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
BBF61198.1|3994370_3995507_+	oxidoreductase	NA	NA	NA	NA	NA
BBF61199.1|3995818_3996805_+	C4-dicarboxylate-binding periplasmic protein	NA	NA	NA	NA	NA
BBF61200.1|3996849_3997353_+	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
BBF61201.1|3997352_3998654_+	C4-dicarboxylate transport system large permease component	NA	NA	NA	NA	NA
BBF61202.1|3998709_3999717_-	hypothetical protein	NA	NA	NA	NA	NA
BBF61203.1|3999833_4000880_-	periplasmic L-asparaginase 2	NA	NA	NA	NA	NA
BBF61204.1|4001055_4001775_-	hypothetical protein	NA	NA	NA	NA	NA
BBF61205.1|4001958_4002285_-	hypothetical protein	NA	NA	NA	NA	NA
BBF61206.1|4002284_4003004_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
BBF61207.1|4003164_4004217_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
BBF61208.1|4004244_4004520_+	oxidative damage protective factor for iron-sulfur proteins	NA	NA	NA	NA	NA
BBF61209.1|4004584_4005664_+	membrane-bound lytic murein transglycosylase C	NA	NA	NA	NA	NA
BBF61210.1|4005865_4007122_+	nucleoside transporter	NA	NA	NA	NA	NA
BBF61211.1|4007171_4009307_-	ornithine decarboxylase isozyme	NA	NA	NA	NA	NA
BBF61212.1|4009704_4010412_+	inner membrane protein	NA	NA	NA	NA	NA
BBF61213.1|4010790_4012056_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	5.3e-81
BBF61214.1|4012382_4012700_+|transposase	ISSfl4 transposase OrfC	transposase	A0A0P0ZBS5	Stx2-converting_phage	64.6	4.6e-34
BBF61215.1|4013081_4015172_+	bifunctional enterobactin receptor/adhesin protein	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
BBF61216.1|4016002_4016770_+|transposase	transposase	transposase	NA	NA	NA	NA
BBF61217.1|4016833_4017721_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	98.0	8.3e-166
BBF61218.1|4017720_4018047_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
4024393:4024408	attR	TTGCCTTCCAGCACCT	NA	NA	NA	NA
>prophage 23
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	4281490	4336049	5678205	transposase,tRNA,protease	Escherichia_phage(30.0%)	52	NA	NA
BBF61473.1|4281490_4281988_-|protease	ClpXP protease specificity enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
BBF61474.1|4281993_4282632_-	stringent starvation protein A	NA	NA	NA	NA	NA
BBF61475.1|4283025_4283418_-	30S ribosomal subunit protein S9	NA	NA	NA	NA	NA
BBF61476.1|4283433_4283862_-	50S ribosomal subunit protein L13	NA	NA	NA	NA	NA
BBF61477.1|4284080_4285208_-	cell division protein ZapE	NA	NA	NA	NA	NA
BBF61478.1|4285401_4285800_+	inner membrane-anchored protein	NA	NA	NA	NA	NA
BBF61479.1|4285953_4287321_+|protease	serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
BBF61480.1|4287410_4288478_+|protease	serine endoprotease	protease	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
BBF61481.1|4288540_4289479_-	malate dehydrogenase	NA	NA	NA	NA	NA
BBF61482.1|4289913_4290384_+	l-arginine-responsive arginine metabolism regulon transcriptional regulator	NA	NA	NA	NA	NA
BBF61483.1|4290748_4291012_+	cadmium and peroxide resistance protein	NA	NA	NA	NA	NA
BBF61484.1|4291067_4291340_-	barnase inhibitor	NA	NA	NA	NA	NA
BBF61485.1|4291431_4293399_-	p-hydroxybenzoic acid efflux system component	NA	NA	NA	NA	NA
BBF61486.1|4293404_4294337_-	p-hydroxybenzoic acid efflux system component	NA	NA	NA	NA	NA
BBF61487.1|4294344_4294548_-	hypothetical protein	NA	NA	NA	NA	NA
BBF61488.1|4294730_4295660_+	transcriptional regulator	NA	NA	NA	NA	NA
BBF61489.1|4295787_4297233_-|protease	protease TldD	protease	NA	NA	NA	NA
BBF61490.1|4297388_4301189_-	hypothetical protein	NA	NA	NA	NA	NA
BBF61491.1|4301256_4302726_-	ribonuclease G	NA	NA	NA	NA	NA
BBF61492.1|4302715_4303309_-	septum formation inhibitor	NA	NA	NA	NA	NA
BBF61493.1|4303317_4303806_-	cell wall structural complex MreBCD transmembrane component MreD	NA	NA	NA	NA	NA
BBF61494.1|4303805_4304909_-	cell wall structural complex MreBCD transmembrane component MreC	NA	NA	NA	NA	NA
BBF61495.1|4304974_4306018_-	cell wall structural complex MreBCD actin-like component MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
BBF61496.1|4306322_4308263_-	regulatory protein CsrD	NA	NA	NA	NA	NA
BBF61497.1|4308414_4309389_+	acryloyl-CoA reductase	NA	NA	NA	NA	NA
BBF61498.1|4309425_4310256_+	hypothetical protein	NA	NA	NA	NA	NA
BBF61499.1|4311120_4311591_+	acetyl CoA carboxylase	NA	NA	NA	NA	NA
BBF61500.1|4311601_4312951_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
BBF61501.1|4313042_4314089_-	hypothetical protein	NA	NA	NA	NA	NA
BBF61502.1|4314085_4315048_-	fructokinase	NA	NA	NA	NA	NA
BBF61503.1|4315069_4316059_-	carbohydrate ABC transport system permease	NA	NA	NA	NA	NA
BBF61504.1|4316059_4317559_-	sugar uptake ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	5.8e-18
BBF61505.1|4317619_4318510_-	sugar uptake ABC transporter periplasmic solute-binding protein precursor	NA	NA	NA	NA	NA
BBF61506.1|4318545_4319400_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
BBF61507.1|4319756_4320572_+	transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	9.2e-10
BBF61508.1|4320582_4321539_+	sugar kinases	NA	NA	NA	NA	NA
BBF61509.1|4321631_4321874_+	inner membrane protein	NA	NA	NA	NA	NA
BBF61510.1|4321863_4323315_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
BBF61511.1|4323326_4324208_+	methyltransferase for 50S ribosomal subunit protein L11	NA	NA	NA	NA	NA
BBF61512.1|4324536_4325502_+|tRNA	tRNA-dihydrouridine synthase B	tRNA	NA	NA	NA	NA
BBF61513.1|4325527_4325824_+	global DNA-binding transcriptional dual regulator	NA	NA	NA	NA	NA
BBF61514.1|4325909_4326794_+	DNA adenine methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
BBF61515.1|4326877_4327057_+	hypothetical protein	NA	NA	NA	NA	NA
BBF61516.1|4327059_4327722_-	transcriptional regulator	NA	NA	NA	NA	NA
BBF61517.1|4328120_4329278_+	multidrug transporter	NA	NA	NA	NA	NA
BBF61518.1|4329289_4332394_+	multidrug efflux system protein	NA	NA	NA	NA	NA
BBF61519.1|4332250_4332541_-	hypothetical protein	NA	NA	NA	NA	NA
BBF61520.1|4332646_4332868_+	outer membrane protein	NA	NA	NA	NA	NA
BBF61521.1|4333298_4334324_+	periplasmic binding transport protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
BBF61522.1|4334391_4334784_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
BBF61523.1|4334835_4335162_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF61524.1|4335161_4336049_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
>prophage 24
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	4893370	4949908	5678205	transposase,integrase,capsid	Enterobacteria_phage(40.0%)	58	4936069:4936091	4950069:4950091
BBF62043.1|4893370_4894351_+|transposase	IS621 transposase	transposase	NA	NA	NA	NA
BBF62044.1|4894649_4895048_+	hypothetical protein	NA	NA	NA	NA	NA
BBF62045.1|4895162_4895975_+	sugar phosphate phosphatase	NA	NA	NA	NA	NA
BBF62046.1|4896020_4896677_-	lipoprotein	NA	NA	NA	NA	NA
BBF62047.1|4896954_4897644_+	D-galactonate catabolism operon transcriptional repressor	NA	NA	NA	NA	NA
BBF62048.1|4897640_4898519_+	2-oxo-3-deoxygalactonate kinase	NA	NA	NA	NA	NA
BBF62049.1|4898502_4899120_+	2-oxo-3-deoxygalactonate 6-phosphate aldolase	NA	NA	NA	NA	NA
BBF62050.1|4899116_4900265_+	D-galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
BBF62051.1|4900384_4901677_+	D-galactonate transporter	NA	NA	NA	NA	NA
BBF62052.1|4901673_4902738_-	oxidoreductase	NA	NA	NA	NA	NA
BBF62053.1|4902838_4904053_+	hypothetical protein	NA	NA	NA	NA	NA
BBF62054.1|4904054_4904315_-	outer membrane protein	NA	NA	NA	NA	NA
BBF62055.1|4904692_4905106_+	heat shock chaperone	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
BBF62056.1|4905217_4905646_+	heat shock chaperone	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
BBF62057.1|4905842_4907504_+	transporter	NA	NA	NA	NA	NA
BBF62058.1|4907500_4908217_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
BBF62059.1|4908512_4910129_+	PTS system arbutin-like IIC component	NA	NA	NA	NA	NA
BBF62060.1|4910128_4910767_+	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
BBF62061.1|4910766_4910943_+	putative 6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
BBF62062.1|4910939_4911833_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
BBF62063.1|4911999_4913715_+	transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
BBF62064.1|4913711_4915205_+	sulfatase/phosphatase	NA	A0A2K9L1A5	Tupanvirus	25.2	5.5e-29
BBF62065.1|4915251_4915701_-	inner membrane protein	NA	NA	NA	NA	NA
BBF62066.1|4915810_4916158_+	inner membrane protein	NA	NA	NA	NA	NA
BBF62067.1|4916147_4916510_+	inner membrane protein	NA	NA	NA	NA	NA
BBF62068.1|4916506_4917004_+	hypothetical protein	NA	NA	NA	NA	NA
BBF62069.1|4917011_4918196_-	multidrug efflux system protein	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
BBF62070.1|4918614_4918704_-	toxic membrane persister formation peptide	NA	NA	NA	NA	NA
BBF62071.1|4919472_4921161_+	acetolactate synthase isozyme I large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	1.6e-56
BBF62072.1|4921164_4921455_+	acetolactate synthase 1 small subunit	NA	NA	NA	NA	NA
BBF62073.1|4921529_4922120_+	two-component regulatory system response regulator UhpA	NA	NA	NA	NA	NA
BBF62074.1|4922119_4923622_+	two-component system sensor histidine kinase UhpB	NA	NA	NA	NA	NA
BBF62075.1|4923631_4924951_+	regulatory protein	NA	NA	NA	NA	NA
BBF62076.1|4925206_4926598_+	hexose phosphate transporter	NA	NA	NA	NA	NA
BBF62077.1|4926642_4928409_-	cryptic adenine deaminase	NA	NA	NA	NA	NA
BBF62078.1|4928583_4929918_+	adenine permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
BBF62079.1|4929970_4930423_+	hypothetical protein	NA	NA	NA	NA	NA
BBF62080.1|4930585_4931824_+	transporter	NA	NA	NA	NA	NA
BBF62081.1|4931864_4932158_-	periplasmic protein	NA	NA	NA	NA	NA
BBF62082.1|4932379_4933213_+	cytoplasmic membrane lipoprotein-28	NA	NA	NA	NA	NA
BBF62083.1|4933216_4934140_-	EamA family inner membrane transporter	NA	NA	NA	NA	NA
BBF62084.1|4934250_4935435_-	lactose/glucose efflux system	NA	NA	NA	NA	NA
BBF62085.1|4935821_4935962_-	hypothetical protein	NA	NA	NA	NA	NA
4936069:4936091	attL	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
BBF62086.1|4936575_4938909_-	phage DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
BBF62087.1|4938923_4939244_-	hypothetical protein	NA	NA	NA	NA	NA
BBF62088.1|4939429_4940077_+|transposase	ISCro1 transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.1e-21
BBF62089.1|4940076_4940424_+|transposase	ISCro1 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
BBF62090.1|4940443_4942015_+|transposase	ISCro1 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
BBF62091.1|4942090_4942546_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
BBF62092.1|4942538_4942826_-	helper derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
BBF62093.1|4942818_4943418_-	phage repressor protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
BBF62094.1|4943414_4943681_-	transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
BBF62095.1|4944232_4944967_+|capsid	phage capsid size determining protein	capsid	Q7M2A2	Enterobacteria_phage	98.0	5.7e-128
BBF62096.1|4944963_4945464_+	transactivation protein	NA	NA	NA	NA	NA
BBF62097.1|4945537_4946110_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
BBF62098.1|4946437_4946863_-	hypothetical protein	NA	NA	NA	NA	NA
BBF62099.1|4946859_4948719_-	hypothetical protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
BBF62100.1|4948738_4949908_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
4950069:4950091	attR	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 25
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	5302986	5370839	5678205	transposase,integrase,tRNA	Stx2-converting_phage(22.22%)	59	5347243:5347257	5373586:5373600
BBF62407.1|5302986_5304504_-|tRNA	lysine tRNA synthetase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
BBF62408.1|5304740_5306198_-	dipeptide and tripeptide permease D	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.8e-48
BBF62409.1|5306256_5308404_-	lysine decarboxylase 2	NA	NA	NA	NA	NA
BBF62410.1|5308483_5309818_-	lysine/cadaverine transporter	NA	NA	NA	NA	NA
BBF62411.1|5310183_5311722_-	cadBA operon transcriptional activator	NA	NA	NA	NA	NA
BBF62412.1|5312744_5313110_-|transposase	IS2 transposase Orf1	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
BBF62413.1|5313198_5313777_-	T3SS secreted effector OspB	NA	A0A0P0ZCT1	Stx2-converting_phage	78.1	8.6e-79
BBF62414.1|5313982_5314801_-	hypothetical protein	NA	NA	NA	NA	NA
BBF62415.1|5314947_5316093_-	T3SS secreted effector EspG	NA	NA	NA	NA	NA
BBF62416.1|5317300_5317672_+	transcription regulator Ler	NA	NA	NA	NA	NA
BBF62417.1|5317686_5317905_+	T3SS component	NA	NA	NA	NA	NA
BBF62418.1|5317917_5318232_+	T3SS component	NA	NA	NA	NA	NA
BBF62419.1|5318228_5318828_+	T3SS component	NA	NA	NA	NA	NA
BBF62420.1|5318814_5319468_+	T3SS component	NA	NA	NA	NA	NA
BBF62421.1|5319472_5320126_+	T3SS structure protein EscR	NA	NA	NA	NA	NA
BBF62422.1|5320125_5320395_+	T3SS structure protein EscS	NA	NA	NA	NA	NA
BBF62423.1|5320394_5321171_+	T3SS structure protein EscT	NA	NA	NA	NA	NA
BBF62424.1|5321163_5322201_+	T3SS structure protein EscU	NA	NA	NA	NA	NA
BBF62425.1|5322197_5322662_-	hypothetical protein	NA	NA	NA	NA	NA
BBF62426.1|5322852_5323209_+	negative regulator GrlR	NA	NA	NA	NA	NA
BBF62427.1|5323283_5323697_+	positive regulator GrlA	NA	NA	NA	NA	NA
BBF62428.1|5324082_5324538_-	T3SS chaperone CesD	NA	NA	NA	NA	NA
BBF62429.1|5324551_5326090_-	T3SS structure protein EscC	NA	D0U184	Enterobacteria_phage	28.9	2.0e-10
BBF62430.1|5326089_5326545_-	T3SS secretion switching protein SepD	NA	NA	NA	NA	NA
BBF62431.1|5326550_5327123_-	T3SS structure protein EscJ	NA	NA	NA	NA	NA
BBF62432.1|5327124_5327553_-	T3SS component	NA	NA	NA	NA	NA
BBF62433.1|5327585_5327888_-	T3SS secreted effector EspZ	NA	NA	NA	NA	NA
BBF62434.1|5328071_5328425_+	regulator Mpc	NA	NA	NA	NA	NA
BBF62435.1|5328421_5330449_+	T3SS structure protein EscV	NA	NA	NA	NA	NA
BBF62436.1|5330432_5331773_+	T3SS structure protein EscN	NA	NA	NA	NA	NA
BBF62437.1|5331832_5332153_+	T3SS component	NA	NA	NA	NA	NA
BBF62438.1|5332145_5332562_+	T3SS component	NA	NA	NA	NA	NA
BBF62439.1|5332524_5333442_+	T3SS structure protein SepQ	NA	NA	NA	NA	NA
BBF62440.1|5333472_5333988_+	T3SS secreted effector EspH	NA	NA	NA	NA	NA
BBF62441.1|5334206_5334566_-	T3SS chaperone CesF	NA	NA	NA	NA	NA
BBF62442.1|5334816_5335428_+	T3SS secreted effector Map	NA	NA	NA	NA	NA
BBF62443.1|5335874_5337443_+	T3SS translocated intimin receptor Tir	NA	NA	NA	NA	NA
BBF62444.1|5337622_5338093_+	T3SS chaperone CesT	NA	NA	NA	NA	NA
BBF62445.1|5338153_5340973_+	T3SS intimin	NA	NA	NA	NA	NA
BBF62446.1|5341187_5342408_-	T3SS structure protein EscD	NA	NA	NA	NA	NA
BBF62447.1|5342550_5343606_+	T3SS secretion switching protein SepL	NA	NA	NA	NA	NA
BBF62448.1|5343663_5344242_+	T3SS translocator EspA	NA	NA	NA	NA	NA
BBF62449.1|5344254_5345397_+	T3SS translocator EspD	NA	NA	NA	NA	NA
BBF62450.1|5345417_5346362_+	T3SS translocator EspB	NA	NA	NA	NA	NA
BBF62451.1|5346368_5346776_+	T3SS chaperone CesD2	NA	NA	NA	NA	NA
BBF62452.1|5346812_5347034_+	T3SS structure protein EscF	NA	NA	NA	NA	NA
BBF62453.1|5347039_5347318_+	T3SS component EscG	NA	NA	NA	NA	NA
5347243:5347257	attL	TATGGATGATGAGAC	NA	NA	NA	NA
BBF62454.1|5347533_5348157_+	T3SS secreted effector EspF	NA	NA	NA	NA	NA
BBF62455.1|5348646_5348919_-|transposase	transposase	transposase	F6MIM4	Haemophilus_phage	69.8	3.6e-11
BBF62456.1|5349090_5350605_-	adherence factor Efa1	NA	NA	NA	NA	NA
BBF62457.1|5350712_5358761_-	adherence factor Efa1	NA	NA	NA	NA	NA
BBF62458.1|5359415_5360204_-	endonuclease	NA	NA	NA	NA	NA
BBF62459.1|5360637_5361312_-	T3SS secreted effector NleE	NA	NA	NA	NA	NA
BBF62460.1|5361360_5362350_-	T3SS secreted effector NleB	NA	Q8HAB2	Salmonella_phage	58.5	6.3e-98
BBF62461.1|5362957_5364607_-	T3SS secreted effector EspL	NA	NA	NA	NA	NA
BBF62462.1|5365394_5366135_-|transposase	transposase	transposase	NA	NA	NA	NA
BBF62463.1|5366269_5367889_+|transposase	ISEc38 transposase	transposase	NA	NA	NA	NA
BBF62464.1|5367885_5369457_+|transposase	ISEc8 transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	5.8e-295
BBF62465.1|5369573_5370839_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
5373586:5373600	attR	TATGGATGATGAGAC	NA	NA	NA	NA
>prophage 26
AP018808	Escherichia coli E2865 DNA, complete genome	5678205	5472062	5548982	5678205	transposase,integrase,tRNA,capsid	Stx2-converting_phage(39.47%)	78	5462361:5462374	5511147:5511160
5462361:5462374	attL	CGCGAACATCTTTT	NA	NA	NA	NA
BBF62569.1|5472062_5473601_-|transposase	ISEc22 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	3.3e-295
BBF62570.1|5473649_5473997_-|transposase	ISEc22 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
BBF62571.1|5473993_5474398_-	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
BBF62572.1|5474486_5474789_+	cytochrome b562	NA	NA	NA	NA	NA
BBF62573.1|5474833_5475298_-	anaerobic ribonucleotide reductase activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
BBF62574.1|5475456_5477595_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
BBF62575.1|5477988_5479644_-	trehalose-6-P hydrolase	NA	NA	NA	NA	NA
BBF62576.1|5479693_5481115_-	trehalose-specific PTS enzyme IIB and IIC component	NA	NA	NA	NA	NA
BBF62577.1|5481233_5482181_-	trehalose 6-phosphate-inducible trehalose regulon transcriptional repressor	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
BBF62578.1|5482559_5485256_+	magnesium transporter	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
BBF62579.1|5485483_5486464_-|transposase	IS621 transposase	transposase	NA	NA	NA	NA
BBF62580.1|5486740_5487127_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
BBF62581.1|5487199_5487661_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
BBF62582.1|5487673_5488609_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
BBF62583.1|5489027_5489423_-	hypothetical protein	NA	NA	NA	NA	NA
BBF62584.1|5489553_5490267_-	oxidoreductase	NA	NA	NA	NA	NA
BBF62585.1|5490337_5490931_+	transcriptional repressor	NA	NA	NA	NA	NA
BBF62586.1|5491075_5491528_+	hypothetical protein	NA	NA	NA	NA	NA
BBF62587.1|5491650_5493162_+	SopA-central-domain-like hexapeptide repeat protein	NA	NA	NA	NA	NA
BBF62588.1|5493338_5494352_-	ornithine carbamoyltransferase 1	NA	NA	NA	NA	NA
BBF62589.1|5494513_5494930_+	RNase E inhibitor protein	NA	NA	NA	NA	NA
BBF62590.1|5494975_5495479_-	acetyltransferase	NA	NA	NA	NA	NA
BBF62591.1|5495671_5496103_+	inner membrane protein	NA	NA	NA	NA	NA
BBF62592.1|5496127_5496868_+	inner membrane protein	NA	NA	NA	NA	NA
BBF62593.1|5496921_5499777_-|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
BBF62594.1|5499776_5500220_-	DNA polymerase III chi subunit HolC	NA	NA	NA	NA	NA
BBF62595.1|5500574_5502086_-	multifunctional aminopeptidase A	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
BBF62596.1|5502352_5503453_+	lipopolysaccharide export ABC permease	NA	NA	NA	NA	NA
BBF62597.1|5503452_5504535_+	lipopolysaccharide export ABC permease	NA	NA	NA	NA	NA
BBF62598.1|5504653_5506156_-	hypothetical protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
BBF62599.1|5506285_5507305_-	alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
BBF62600.1|5507748_5509011_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.8e-74
BBF62601.1|5509254_5510094_-	hypothetical protein	NA	NA	NA	NA	NA
BBF62602.1|5510232_5511819_-	hypothetical protein	NA	NA	NA	NA	NA
5511147:5511160	attR	CGCGAACATCTTTT	NA	NA	NA	NA
BBF62603.1|5512138_5512786_+|transposase	ISCro1 transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.1e-21
BBF62604.1|5512785_5513133_+|transposase	ISCro1 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
BBF62605.1|5513152_5514724_+|transposase	ISCro1 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
BBF62606.1|5515462_5516032_+	hypothetical protein	NA	NA	NA	NA	NA
BBF62607.1|5516197_5516599_+	hypothetical protein	NA	NA	NA	NA	NA
BBF62608.1|5516586_5517021_+	hypothetical protein	NA	NA	NA	NA	NA
BBF62609.1|5517020_5517257_+	hypothetical protein	NA	NA	NA	NA	NA
BBF62610.1|5517375_5517756_+	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
BBF62611.1|5517752_5518100_+|transposase	ISEc8 transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BBF62612.1|5518149_5519535_+|transposase	ISEc8 transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
BBF62613.1|5519773_5521132_-	hypothetical protein	NA	NA	NA	NA	NA
BBF62614.1|5521864_5522122_-	hypothetical protein	NA	NA	NA	NA	NA
BBF62615.1|5522882_5523092_-|transposase	IS1 transposase InsB	transposase	U5P0U6	Shigella_phage	98.6	2.2e-32
BBF62616.1|5523092_5523386_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	87.9	7.2e-42
BBF62617.1|5523871_5524393_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
BBF62618.1|5524389_5525343_+	anti-sigma transmembrane signal transducer for ferric citrate transport	NA	NA	NA	NA	NA
BBF62619.1|5525429_5527754_+	TonB-dependent outer membrane ferric citrate transporter and signal transducer	NA	NA	NA	NA	NA
BBF62620.1|5527798_5528701_+	ferric citrate ABC transporter periplasmic binding protein	NA	NA	NA	NA	NA
BBF62621.1|5528697_5529696_+	ferric citrate ABC transporter permease	NA	NA	NA	NA	NA
BBF62622.1|5529692_5530649_+	ferric citrate ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
BBF62623.1|5530649_5531417_+	ferric citrate ABC transporter ATPase	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
BBF62624.1|5531974_5532232_-	hypothetical protein	NA	NA	NA	NA	NA
BBF62625.1|5532314_5532557_-|transposase	IS911 transposase	transposase	Q716C2	Shigella_phage	92.4	4.7e-39
BBF62626.1|5532553_5532967_-|transposase	IS911 transposase OrfB	transposase	Q716C2	Shigella_phage	95.6	1.5e-61
BBF62627.1|5533179_5533485_-|transposase	IS911 transposase	transposase	Q716C1	Shigella_phage	97.0	5.2e-43
BBF62628.1|5533585_5534158_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
BBF62629.1|5534206_5535031_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
BBF62630.1|5535936_5538270_-	phage DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
BBF62631.1|5538284_5538608_-	hypothetical protein	NA	NA	NA	NA	NA
BBF62632.1|5538604_5538829_-	hypothetical protein	NA	NA	NA	NA	NA
BBF62633.1|5538828_5539422_-	phage repressor protein	NA	Q7M2A7	Enterobacteria_phage	64.8	6.4e-29
BBF62634.1|5539373_5539634_-	transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
BBF62635.1|5540538_5541291_+|capsid	phage capsid size determining protein	capsid	NA	NA	NA	NA
BBF62636.1|5541287_5541842_+	phage polarity suppression protein	NA	NA	NA	NA	NA
BBF62637.1|5541843_5542116_+	transcription activator	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
BBF62638.1|5542425_5543997_-|transposase	ISCro1 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
BBF62639.1|5544016_5544364_-|transposase	ISCro1 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
BBF62640.1|5544363_5545011_-|transposase	ISCro1 transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.1e-21
BBF62641.1|5545108_5545285_-	hemolysin expression modulating protein	NA	NA	NA	NA	NA
BBF62642.1|5545990_5546197_+	putative phage protein	NA	NA	NA	NA	NA
BBF62643.1|5546291_5546618_+	hypothetical protein	NA	NA	NA	NA	NA
BBF62644.1|5546646_5547051_+	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
BBF62645.1|5547047_5547395_+|transposase	ISEc22 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
BBF62646.1|5547443_5548982_+|transposase	ISEc22 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	3.3e-295
>prophage 1
AP018809	Escherichia coli E2865 plasmid pE2865-1 DNA, complete genome	99498	206	98780	99498	transposase,tail,lysis,protease	Escherichia_phage(63.39%)	115	NA	NA
BBF62773.1|206_428_+	hypothetical protein	NA	A0A077SLI9	Escherichia_phage	100.0	3.4e-36
BBF62774.1|435_1467_+	recombinase	NA	A0A077SLE7	Escherichia_phage	99.7	2.2e-194
BBF62775.1|1517_1829_+	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	91.3	5.3e-43
BBF62776.1|2068_3181_-	hypothetical protein	NA	A0A077SLR9	Escherichia_phage	90.1	1.6e-182
BBF62777.1|3177_3399_-	ash family protein	NA	Q38557	Escherichia_phage	80.8	3.7e-30
BBF62778.1|3993_4635_+	hypothetical protein	NA	A0A077SK30	Escherichia_phage	99.1	1.8e-114
BBF62779.1|4691_5996_+	hypothetical protein	NA	Q38324	Lactococcus_phage	25.5	5.8e-06
BBF62780.1|6169_9082_-	hypothetical protein	NA	Q71TG1	Escherichia_phage	93.7	0.0e+00
BBF62781.1|9084_11040_-	adenine-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	59.5	4.6e-201
BBF62782.1|11184_11433_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
BBF62783.1|11520_11670_-	hypothetical protein	NA	Q1MVN7	Enterobacteria_phage	89.6	5.3e-17
BBF62784.1|11745_13455_+	hypothetical protein	NA	A0A077SL38	Escherichia_phage	99.6	0.0e+00
BBF62785.1|13447_14467_+	hypothetical protein	NA	Q71TR6	Escherichia_phage	96.7	2.2e-178
BBF62786.1|14506_15655_-|transposase	IS609 transposase	transposase	A0A077SL42	Escherichia_phage	96.6	4.1e-205
BBF62787.1|16094_16652_-|lysis	phage lysis protein	lysis	Q1MVN3	Enterobacteria_phage	99.5	4.7e-106
BBF62788.1|16821_17310_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	90.1	2.3e-77
BBF62789.1|17507_18185_+	hypothetical protein	NA	A0A1B0VBT1	Salmonella_phage	97.8	1.9e-125
BBF62790.1|18191_18974_+	hypothetical protein	NA	A0A1B0VDP8	Salmonella_phage	100.0	1.9e-145
BBF62791.1|18966_20061_+	phage DNA packaging protein	NA	Q5QBP2	Enterobacteria_phage	36.3	1.3e-40
BBF62792.1|20092_20401_-	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
BBF62793.1|20390_23378_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.3	0.0e+00
BBF62794.1|23390_23756_-	hypothetical protein	NA	A0A077SK35	Escherichia_phage	100.0	7.9e-46
BBF62795.1|23752_24061_-	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	100.0	1.7e-46
BBF62796.1|24057_25671_-	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	94.9	2.3e-283
BBF62797.1|25672_26275_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
BBF62798.1|26261_26705_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	99.3	2.9e-82
BBF62799.1|26701_27031_-	hypothetical protein	NA	Q37876	Escherichia_phage	100.0	1.3e-52
BBF62800.1|27059_27296_+|tail	phage tail fiber assembly protein	tail	A0A222YXY8	Escherichia_phage	80.8	4.9e-25
BBF62801.1|27786_28359_+	hypothetical protein	NA	NA	NA	NA	NA
BBF62802.1|28402_28981_-|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
BBF62803.1|28980_31830_-|tail	phage tail fiber protein	tail	Q71TP5	Escherichia_phage	96.3	0.0e+00
BBF62804.1|31841_32276_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
BBF62805.1|32354_33191_-	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	98.9	1.7e-152
BBF62806.1|33190_34624_-	hypothetical protein	NA	Q71TP2	Escherichia_phage	99.2	4.5e-270
BBF62807.1|34620_34977_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
BBF62808.1|34976_38369_-	DNA transfer protein	NA	Q1MVL3	Enterobacteria_phage	98.4	0.0e+00
BBF62809.1|38450_39332_-	hypothetical protein	NA	Q71TC9	Escherichia_phage	99.7	4.8e-174
BBF62810.1|39346_39958_-	hypothetical protein	NA	A0A077SLH8	Escherichia_phage	100.0	5.8e-110
BBF62811.1|39968_40535_-	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	100.0	6.6e-100
BBF62812.1|40593_41070_-	hypothetical protein	NA	NA	NA	NA	NA
BBF62813.1|41121_41769_-	hypothetical protein	NA	Q71TC4	Escherichia_phage	92.7	1.1e-13
BBF62814.1|42196_42418_+	ash family protein	NA	Q38557	Escherichia_phage	94.5	6.9e-37
BBF62815.1|42414_43461_+	hypothetical protein	NA	Q1MVK6	Enterobacteria_phage	98.0	1.3e-186
BBF62816.1|43625_44426_+	hypothetical protein	NA	Q1MVK4	Enterobacteria_phage	99.6	5.4e-148
BBF62817.1|44491_45301_+	hypothetical protein	NA	Q71TB9	Escherichia_phage	97.8	1.2e-142
BBF62818.1|45469_46174_+	hypothetical protein	NA	Q71TB8	Escherichia_phage	99.6	7.9e-135
BBF62819.1|46173_46638_+	hypothetical protein	NA	Q71TB7	Escherichia_phage	97.4	1.5e-86
BBF62820.1|46804_47101_-	hypothetical protein	NA	Q71TM6	Escherichia_phage	91.8	8.9e-48
BBF62821.1|47185_47695_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	98.8	5.6e-90
BBF62822.1|47706_48171_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	96.8	5.3e-79
BBF62823.1|48323_49139_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
BBF62824.1|49148_50738_-	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	98.9	6.9e-304
BBF62825.1|50798_52505_-	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	99.8	0.0e+00
BBF62826.1|52730_53732_-	plasmid partition protein B	NA	Q38420	Escherichia_phage	99.7	6.3e-178
BBF62827.1|53748_54945_-	plasmid partition protein A	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
BBF62828.1|55113_55923_-	hypothetical protein	NA	A0A077SK46	Escherichia_phage	97.8	2.1e-155
BBF62829.1|56215_57100_-	replication protein RepFIB	NA	A0A1B0VDL5	Salmonella_phage	99.3	4.0e-160
BBF62830.1|57433_57826_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
BBF62831.1|58003_58426_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
BBF62832.1|58465_59254_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	89.3	9.2e-108
BBF62833.1|59716_60001_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
BBF62834.1|59993_60899_+	recombination-associated protein rdgC	NA	A0A077SK17	Escherichia_phage	99.3	5.9e-159
BBF62835.1|60895_63937_+	DNA adenine methyltransferase	NA	A0A077SL51	Escherichia_phage	86.7	0.0e+00
BBF62836.1|65093_65222_+	hypothetical protein	NA	NA	NA	NA	NA
BBF62837.1|65730_65967_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	50.0	2.1e-07
BBF62838.1|65947_66775_+|protease	serine protease	protease	A0A077SLJ6	Escherichia_phage	99.3	1.1e-130
BBF62839.1|67158_68523_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	99.6	3.6e-253
BBF62840.1|68522_69521_+	hypothetical protein	NA	Q71TK3	Escherichia_phage	98.8	9.0e-193
BBF62841.1|69900_70122_+	ash family protein	NA	Q38557	Escherichia_phage	82.2	2.1e-30
BBF62842.1|70118_71153_+	hypothetical protein	NA	Q71TN2	Escherichia_phage	80.0	7.5e-150
BBF62843.1|71223_71856_-	hypothetical protein	NA	A0A077SK50	Escherichia_phage	99.4	9.0e-90
BBF62844.1|71848_72865_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.7	5.9e-192
BBF62845.1|72866_73652_-	hypothetical protein	NA	Q71T90	Escherichia_phage	99.6	4.6e-144
BBF62846.1|73638_74367_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
BBF62847.1|74370_75588_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
BBF62848.1|75597_75858_-	hypothetical protein	NA	Q38620	Escherichia_phage	98.8	1.1e-44
BBF62849.1|76121_76367_+	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	98.8	2.1e-39
BBF62850.1|76369_76948_+	hypothetical protein	NA	A0A077SLK0	Escherichia_phage	99.5	2.0e-107
BBF62851.1|77015_77171_+	hypothetical protein	NA	A0A077SK20	Escherichia_phage	100.0	1.2e-19
BBF62852.1|77672_78299_+	hypothetical protein	NA	Q1MVG8	Enterobacteria_phage	99.0	1.5e-121
BBF62853.1|78295_78973_+	serine/threonine-specific protein phosphatase 1	NA	Q71TJ1	Escherichia_phage	99.1	4.2e-133
BBF62854.1|78969_79671_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	98.3	3.3e-141
BBF62855.1|79752_79971_+	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
BBF62856.1|79972_81235_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.8	1.6e-234
BBF62857.1|81307_81814_+	hypothetical protein	NA	A0A077SK53	Escherichia_phage	98.8	5.4e-93
BBF62858.1|82008_82737_+	morphogenetic protein	NA	Q71T76	Escherichia_phage	97.4	2.3e-137
BBF62859.1|82740_83619_+	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	94.9	1.1e-170
BBF62860.1|83615_83819_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
BBF62861.1|83811_84051_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	89.9	7.7e-34
BBF62862.1|84047_84629_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	98.4	2.6e-115
BBF62863.1|84688_85381_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	56.2	9.4e-40
BBF62864.1|85377_86031_+	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	56.2	5.9e-52
BBF62865.1|86030_86207_+	hypothetical protein	NA	A0A0F6TJP6	Escherichia_coli_O157_typing_phage	100.0	4.1e-24
BBF62866.1|86203_86392_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
BBF62867.1|86393_86909_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	100.0	2.4e-101
BBF62868.1|86905_87796_+	hypothetical protein	NA	A0A088CE95	Shigella_phage	71.7	2.8e-113
BBF62869.1|87878_88112_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	6.1e-36
BBF62870.1|88160_88283_+	hypothetical protein	NA	A0A1B0V7K1	Salmonella_phage	97.5	6.9e-15
BBF62871.1|88290_88584_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	3.1e-45
BBF62872.1|88590_88965_+	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	96.0	2.7e-65
BBF62873.1|88946_89597_+	hypothetical protein	NA	A0A077SK55	Escherichia_phage	96.7	4.9e-99
BBF62874.1|89580_89865_+	hypothetical protein	NA	A0A222YXZ5	Escherichia_phage	100.0	2.4e-05
BBF62875.1|89849_90200_-	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	100.0	2.3e-58
BBF62876.1|90232_90484_+	DNA polymerase III theta subunit HolE	NA	A0A077SLL5	Escherichia_phage	100.0	1.4e-38
BBF62877.1|90607_90997_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
BBF62878.1|91069_91291_+	hypothetical protein	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
BBF62879.1|91290_91671_+	death on curing protein	NA	Q71T66	Escherichia_phage	99.2	2.5e-63
BBF62880.1|91675_91855_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
BBF62881.1|91882_92926_+	hypothetical protein	NA	A0A1B0VBU2	Salmonella_phage	99.4	3.0e-207
BBF62882.1|93014_93467_+	hypothetical protein	NA	Q71T63	Escherichia_phage	99.3	6.7e-79
BBF62883.1|93553_94747_+	hypothetical protein	NA	Q5QBP3	Enterobacteria_phage	95.5	7.7e-199
BBF62884.1|94746_96240_+	phage DNA packaging protein	NA	Q71T61	Escherichia_phage	100.0	1.1e-292
BBF62885.1|96565_96787_+	hypothetical protein	NA	Q38557	Escherichia_phage	80.3	2.1e-25
BBF62886.1|96783_97896_+	hypothetical protein	NA	A0A077SLR9	Escherichia_phage	86.3	3.2e-175
BBF62887.1|97928_98780_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	2.3e-157
>prophage 1
AP018810	Escherichia coli E2865 plasmid pE2865-2 DNA, complete genome	92186	8065	50925	92186	transposase	Stx2-converting_phage(34.78%)	44	NA	NA
BBF62894.1|8065_8848_-	resolvase ResA	NA	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
BBF62895.1|8849_9263_-	hypothetical protein	NA	NA	NA	NA	NA
BBF62896.1|9822_10053_+	plasmid maintenance protein VagC	NA	NA	NA	NA	NA
BBF62897.1|10064_10466_+	plasmid maintenance protein	NA	NA	NA	NA	NA
BBF62898.1|10627_11173_-	hypothetical protein	NA	NA	NA	NA	NA
BBF62899.1|11240_11543_+|transposase	IS600 transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
BBF62900.1|11578_12397_+|transposase	IS600 transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
BBF62901.1|12554_13415_-	hypothetical protein	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
BBF62902.1|13542_13929_+	recombinase	NA	NA	NA	NA	NA
BBF62903.1|13982_14657_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
BBF62904.1|14653_15001_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
BBF62905.1|15004_16573_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
BBF62906.1|16576_16966_-	inner membrane protein	NA	NA	NA	NA	NA
BBF62907.1|17232_17898_-	conjugal transfer protein TraC	NA	NA	NA	NA	NA
BBF62908.1|18038_18680_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
BBF62909.1|19388_20420_+	replication protein	NA	NA	NA	NA	NA
BBF62910.1|21380_23747_-	adherence factor Efa1	NA	NA	NA	NA	NA
BBF62911.1|23812_30880_-	adherence factor Efa1	NA	NA	NA	NA	NA
BBF62912.1|31338_31443_+|transposase	IS3 family transposase OrfA	transposase	NA	NA	NA	NA
BBF62913.1|31439_31646_+|transposase	IS3 family transposase OrfB	transposase	NA	NA	NA	NA
BBF62914.1|31706_32009_-|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	68.4	5.2e-35
BBF62915.1|32667_33207_-|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	8.4e-28
BBF62916.1|33349_33856_-	hypothetical protein	NA	Q716C2	Shigella_phage	99.4	4.5e-92
BBF62917.1|34068_34371_-|transposase	IS911 transposase	transposase	Q716C1	Shigella_phage	99.0	4.2e-45
BBF62918.1|34351_34828_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
BBF62919.1|35319_35583_-|transposase	transposase	transposase	NA	NA	NA	NA
BBF62920.1|35876_36632_-|transposase	transposase	transposase	A4PE56	Ralstonia_virus	26.2	7.9e-08
BBF62921.1|37209_37785_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF62922.1|38016_38532_-|transposase	transposase	transposase	NA	NA	NA	NA
BBF62923.1|38807_39995_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF62924.1|39994_40360_-|transposase	transposase	transposase	NA	NA	NA	NA
BBF62925.1|40760_41105_-	recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
BBF62926.1|41183_42752_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
BBF62927.1|42755_43103_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
BBF62928.1|43099_43774_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
BBF62929.1|44217_45195_-	replication protein RepFIB	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
BBF62930.1|46000_46327_+|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	97.2	4.1e-54
BBF62931.1|46326_47214_+|transposase	IS629 transposase OrfB	transposase	H6WZH1	Escherichia_phage	99.7	1.4e-168
BBF62932.1|47386_47599_+	catalase-peroxidase HPI	NA	NA	NA	NA	NA
BBF62933.1|47586_49596_+	catalase-peroxidase HPI	NA	NA	NA	NA	NA
BBF62934.1|49639_50029_+	hypothetical protein	NA	NA	NA	NA	NA
BBF62935.1|50228_50468_+|transposase	transposase	transposase	A0A0N7C1Z2	Escherichia_phage	97.2	1.5e-32
BBF62936.1|50467_50716_+|transposase	transposase	transposase	A0A0N7C035	Escherichia_phage	87.9	5.6e-27
BBF62937.1|50700_50925_+|transposase	IS629 transposase	transposase	A0A0N7C1X7	Escherichia_phage	91.4	2.7e-28
>prophage 2
AP018810	Escherichia coli E2865 plasmid pE2865-2 DNA, complete genome	92186	66775	84418	92186	transposase,protease	Stx2-converting_phage(57.14%)	20	NA	NA
BBF62960.1|66775_67078_+|transposase	IS600 transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
BBF62961.1|67113_67530_+|transposase	transposase	transposase	A0A0N7C1Y0	Escherichia_phage	91.7	1.4e-06
BBF62962.1|67504_67711_-|transposase	transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	8.7e-34
BBF62963.1|67774_69346_-|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
BBF62964.1|69365_69713_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
BBF62965.1|69712_70360_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.1e-21
BBF62966.1|70439_71099_-|transposase	IS629 transposase OrfB	transposase	H6WZH1	Escherichia_phage	99.1	2.3e-120
BBF62967.1|71098_71425_-|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	98.1	6.3e-55
BBF62968.1|71633_71837_+	inner membrane protein	NA	NA	NA	NA	NA
BBF62969.1|71833_72097_-|transposase	transposase	transposase	NA	NA	NA	NA
BBF62970.1|72640_76543_-|protease	serine protease EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
BBF62971.1|77220_77484_+|transposase	transposase	transposase	NA	NA	NA	NA
BBF62972.1|77480_77825_-	inner membrane protein	NA	NA	NA	NA	NA
BBF62973.1|77830_78505_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
BBF62974.1|78501_78849_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
BBF62975.1|78852_80421_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
BBF62976.1|80699_81887_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF62977.1|81886_82252_-|transposase	transposase	transposase	NA	NA	NA	NA
BBF62978.1|82488_82836_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
BBF62979.1|82885_84418_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	4.6e-297
