The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	326349	337371	5470440	integrase,transposase	Escherichia_phage(30.0%)	11	329944:329958	344479:344493
BBF45937.1|326349_327405_-	outer membrane phosphoporin protein E	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
BBF45938.1|327692_328796_+	gamma-glutamate kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
BBF45939.1|328807_330061_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
329944:329958	attL	TCTGGGTGCGGAAGT	NA	NA	NA	NA
BBF45940.1|330416_331631_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
BBF45941.1|331773_332655_+	hypothetical protein	NA	NA	NA	NA	NA
BBF45942.1|332852_333050_+	putative phage protein	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
BBF45943.1|333049_333481_+	putative phage protein	NA	A0A1W6JPH9	Morganella_phage	49.0	5.1e-28
BBF45944.1|333493_334327_+	phage antirepressor	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
BBF45945.1|334460_334787_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF45946.1|334786_335674_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF45947.1|336045_337371_-	pyridine nucleotide-dependent disulfide oxidoreductase of reactive chlorine stress species resistance	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
344479:344493	attR	TCTGGGTGCGGAAGT	NA	NA	NA	NA
>prophage 2
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	346832	472968	5470440	holin,transposase,capsid,protease,head,tail,tRNA	Escherichia_phage(25.71%)	113	NA	NA
BBF45956.1|346832_348866_+|holin	choline transporter of high affinity	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
BBF45957.1|349438_353422_+	AidA-I family adhesin	NA	A0A2L1IV18	Escherichia_phage	38.1	2.5e-124
BBF45958.1|353563_354652_+	c-di-GMP-specific phosphodiesterase	NA	NA	NA	NA	NA
BBF45959.1|354693_355626_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
BBF45960.1|355717_356215_-	hypothetical protein	NA	NA	NA	NA	NA
BBF45961.1|356472_357078_+	ankyrin domain-containing protein	NA	NA	NA	NA	NA
BBF45962.1|357117_357981_+	hypothetical protein	NA	NA	NA	NA	NA
BBF45963.1|357970_359518_+	NAD(P)-binding succinyl-CoA synthase	NA	NA	NA	NA	NA
BBF45964.1|359517_360936_+	hypothetical protein	NA	NA	NA	NA	NA
BBF45965.1|361079_362030_+	carbamate kinase	NA	NA	NA	NA	NA
BBF45966.1|362039_363422_+	metallo-dependent hydrolase domain deaminase	NA	NA	NA	NA	NA
BBF45967.1|363720_364131_+	hypothetical protein	NA	NA	NA	NA	NA
BBF45968.1|364381_365368_+	sugar-binding protein	NA	NA	NA	NA	NA
BBF45969.1|365416_366901_+	ATP-binding component of sugar ABC transporter	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
BBF45970.1|366893_367865_+	permease	NA	NA	NA	NA	NA
BBF45971.1|367861_368818_+	permease	NA	NA	NA	NA	NA
BBF45972.1|368904_369954_+	broad specificity NADPH-dependent aldehyde reductase	NA	A0A2K9L339	Tupanvirus	45.0	8.3e-72
BBF45973.1|370196_371012_+	hypothetical protein	NA	NA	NA	NA	NA
BBF45974.1|371685_372318_-	neutral amino-acid efflux system	NA	NA	NA	NA	NA
BBF45975.1|372503_372779_+	hypothetical protein	NA	NA	NA	NA	NA
BBF45976.1|372876_374463_-	propionate catabolism operon regulatory protein	NA	NA	NA	NA	NA
BBF45977.1|374701_375592_+	2-methylisocitrate lyase	NA	NA	NA	NA	NA
BBF45978.1|375636_376806_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
BBF45979.1|376839_378291_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
BBF45980.1|378330_380217_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
BBF45981.1|380555_381815_+	cytosine transporter	NA	NA	NA	NA	NA
BBF45982.1|381804_383088_+	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
BBF45983.1|383127_384027_-	transcriptional activator of cyn operon	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
BBF45984.1|384136_384796_+	carbonic anhydrase	NA	NA	NA	NA	NA
BBF45985.1|384826_385297_+	cyanate aminohydrolase	NA	NA	NA	NA	NA
BBF45986.1|385302_386484_+	cyanate transporter	NA	NA	NA	NA	NA
BBF45987.1|386562_387816_-	lactose permease	NA	NA	NA	NA	NA
BBF45988.1|387867_390942_-	beta-D-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.8	0.0e+00
BBF45989.1|391064_392156_-	lactose operon repressor	NA	C6ZCU4	Enterobacteria_phage	98.9	7.1e-191
BBF45990.1|392223_393171_-	mhp operon transcriptional activator	NA	NA	NA	NA	NA
BBF45991.1|393247_394912_+	3-(3-hydroxyphenyl)propionate hydroxylase	NA	NA	NA	NA	NA
BBF45992.1|394913_395858_+	2,3-dihydroxyphenylpropionate 1,2-dioxygenase	NA	NA	NA	NA	NA
BBF45993.1|395875_396742_+	2-hydroxy-6-ketonona-2,4-dienedioic acid hydrolase	NA	NA	NA	NA	NA
BBF45994.1|396751_397561_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
BBF45995.1|397557_398508_+	acetaldehyde-CoA dehydrogenase II	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
BBF45996.1|398504_399518_+	4-hyroxy-2-oxovalerate/4-hydroxy-2-oxopentanoic acid aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
BBF45997.1|399792_401004_+	3-hydroxyphenylpropionic transporter	NA	NA	NA	NA	NA
BBF45998.1|401105_401645_+	hypothetical protein	NA	NA	NA	NA	NA
BBF45999.1|401769_402603_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
BBF46000.1|402695_403805_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
BBF46001.1|403839_404115_-	regulator protein that represses frmRAB operon	NA	NA	NA	NA	NA
BBF46002.1|404299_405073_-	hypothetical protein	NA	NA	NA	NA	NA
BBF46003.1|405633_406830_-	glycosyl transferase	NA	NA	NA	NA	NA
BBF46004.1|406839_407511_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
BBF46005.1|408126_409089_+	taurine ABC transporter periplasmic binding protein	NA	NA	NA	NA	NA
BBF46006.1|409101_409869_+	taurine ABC transporter ATPase	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
BBF46007.1|409934_410693_+	taurine ABC transporter permease	NA	NA	NA	NA	NA
BBF46008.1|410689_411541_+	taurine dioxygenase	NA	NA	NA	NA	NA
BBF46009.1|411645_412620_-	5-aminolevulinate dehydratase	NA	NA	NA	NA	NA
BBF46010.1|413144_413858_+	flagellin structural protein	NA	NA	NA	NA	NA
BBF46011.1|413984_414872_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF46012.1|414871_415198_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF46013.1|415203_417384_-|tail	phage tail length tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
BBF46014.1|417376_417811_-|tail	phage minor tail protein	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
BBF46015.1|417792_418215_-|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
BBF46016.1|418230_418971_-|tail	phage major tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
BBF46017.1|418978_419374_-|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
BBF46018.1|419370_419949_-|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
BBF46019.1|420041_420788_-|transposase	IS602 transposase	transposase	Q716C2	Shigella_phage	59.0	4.3e-83
BBF46020.1|420907_421219_-|transposase	IS602 transposase	transposase	Q716C1	Shigella_phage	40.8	2.4e-11
BBF46021.1|421275_421575_-|head,tail	phage head-tail adaptor protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
BBF46022.1|421586_421982_-	phage DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
BBF46023.1|422023_423049_-|capsid	phage major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
BBF46024.1|423104_423437_-|head	phage head-DNA stabilization protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
BBF46025.1|423446_423965_-|head,protease	phage prohead protease	head,protease	A0A0K2FI53	Enterobacteria_phage	97.7	1.7e-81
BBF46026.1|424647_425280_+	response regulator	NA	NA	NA	NA	NA
BBF46027.1|425282_425798_-	fimbrial protein	NA	NA	NA	NA	NA
BBF46028.1|425842_426808_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF46029.1|426849_429459_-	outer membrane usher protein FimD	NA	NA	NA	NA	NA
BBF46030.1|429489_430182_-	periplasmic pilus chaperone	NA	NA	NA	NA	NA
BBF46031.1|430401_430944_-	type-1 fimbrial protein subunit A	NA	NA	NA	NA	NA
BBF46032.1|431424_432291_+	5,10-methylene-tetrahydrofolate dehydrogenase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
BBF46033.1|432292_432505_+	ribosome-associated protein	NA	NA	NA	NA	NA
BBF46034.1|432612_433134_+	inner membrane protein	NA	NA	NA	NA	NA
BBF46035.1|433169_434555_-|tRNA	cysteinyl-tRNA synthetase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
BBF46036.1|434728_435223_+	peptidyl-prolyl cis-trans isomerase B	NA	NA	NA	NA	NA
BBF46037.1|435225_435948_+	UDP-2,3-diacylglucosamine pyrophosphohydrolase	NA	NA	NA	NA	NA
BBF46038.1|436065_436575_+	N5-carboxyaminoimidazole ribonucleotide mutase	NA	NA	NA	NA	NA
BBF46039.1|436571_437639_+	N5-carboxyaminoimidazole ribonucleotide synthase	NA	NA	NA	NA	NA
BBF46040.1|437775_438669_-	carbonate kinase	NA	NA	NA	NA	NA
BBF46041.1|438665_439481_-	anaerobic allantoin catabolic oxamate carbamoyltransferase	NA	NA	NA	NA	NA
BBF46042.1|439491_440751_-	hypothetical protein	NA	NA	NA	NA	NA
BBF46043.1|440760_442428_-	NAD(P)-binding acyl-CoA synthetase	NA	NA	NA	NA	NA
BBF46044.1|442744_443794_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
BBF46045.1|443815_445051_+	allantoate amidohydrolase	NA	NA	NA	NA	NA
BBF46046.1|445061_445847_+	hypothetical protein	NA	NA	NA	NA	NA
BBF46047.1|445975_447121_-	glycerate kinase II	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
BBF46048.1|447142_448444_-	uracil/xanthine transporter	NA	NA	NA	NA	NA
BBF46049.1|448500_449862_-	allantoinase	NA	NA	NA	NA	NA
BBF46050.1|449921_451376_-	allantoin transporter	NA	NA	NA	NA	NA
BBF46051.1|451544_452423_-	tartronate semialdehyde reductase	NA	NA	NA	NA	NA
BBF46052.1|452522_453299_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
BBF46053.1|453311_455093_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
BBF46054.1|455182_455998_-	glyoxylate-inducible transcriptional repressor of all and gcl operons	NA	NA	NA	NA	NA
BBF46055.1|456075_456558_-	ureidoglycolate hydrolase	NA	NA	NA	NA	NA
BBF46056.1|456787_457714_+	allD operon transcriptional activator	NA	NA	NA	NA	NA
BBF46057.1|457782_458877_+|tRNA	tRNA 2-selenouridine synthase	tRNA	NA	NA	NA	NA
BBF46058.1|458992_459364_+	transcriptional regulator	NA	A0A077SLK2	Escherichia_phage	75.4	3.1e-50
BBF46059.1|460108_460369_-	hypothetical protein	NA	NA	NA	NA	NA
BBF46060.1|460791_464562_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.0	1.9e-17
BBF46061.1|464990_467405_-	ABC transporter permease	NA	NA	NA	NA	NA
BBF46062.1|467401_468088_-	ABC transporter ATPase	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
BBF46063.1|468088_468682_+	acyl-CoA thioesterase I	NA	NA	NA	NA	NA
BBF46064.1|468671_469481_+	oxidoreductase	NA	NA	NA	NA	NA
BBF46065.1|469541_470396_+	thioredoxin	NA	NA	NA	NA	NA
BBF46066.1|470458_471241_-	iron export ABC transporter permease	NA	NA	NA	NA	NA
BBF46067.1|471227_471905_-	iron export ABC transporter ATPase	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
BBF46068.1|472050_472968_+|protease	protease	protease	NA	NA	NA	NA
>prophage 3
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	480538	533483	5470440	tRNA,transposase,protease	Bacillus_phage(21.43%)	47	NA	NA
BBF46077.1|480538_481018_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase	tRNA	NA	NA	NA	NA
BBF46078.1|481054_482707_-	UDP-sugar hydrolase	NA	NA	NA	NA	NA
BBF46079.1|482924_484145_+	fosmidomycin resistance protein	NA	NA	NA	NA	NA
BBF46080.1|484382_486059_+	inner membrane NAD(P)-binding transporter	NA	NA	NA	NA	NA
BBF46081.1|486191_487496_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
BBF46082.1|487647_488607_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
BBF46083.1|488603_489566_-	ferrochelatase	NA	NA	NA	NA	NA
BBF46084.1|489801_490446_-	adenylate kinase	NA	NA	NA	NA	NA
BBF46085.1|490626_492501_-	heat shock protein Hsp90	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
BBF46086.1|492610_493216_-	recombination protein RecR	NA	NA	NA	NA	NA
BBF46087.1|493215_493545_-	hypothetical protein	NA	NA	NA	NA	NA
BBF46088.1|493597_495529_-	DNA polymerase III/DNA elongation factor III tau and gamma subunits DnaX	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
BBF46089.1|495657_496209_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
BBF46090.1|496361_496739_-	inner membrane protein	NA	NA	NA	NA	NA
BBF46091.1|496808_497336_+	primosomal replication protein PriC	NA	NA	NA	NA	NA
BBF46092.1|497349_497511_+	hypothetical protein	NA	NA	NA	NA	NA
BBF46093.1|497782_498679_+|transposase	IS621 transposase	transposase	NA	NA	NA	NA
BBF46094.1|498648_499395_-|transposase	IS602 transposase	transposase	Q716C2	Shigella_phage	59.0	4.3e-83
BBF46095.1|499514_499826_-|transposase	IS602 transposase	transposase	Q716C1	Shigella_phage	40.8	2.4e-11
BBF46096.1|500262_503625_-	mechanosensitive channel protein	NA	NA	NA	NA	NA
BBF46097.1|503752_504400_-	transcriptional repressor	NA	NA	NA	NA	NA
BBF46098.1|504541_505735_+	multidrug efflux system	NA	NA	NA	NA	NA
BBF46099.1|505757_508907_+	multidrug efflux system protein	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
BBF46100.1|509452_509827_+	Hha toxicity attenuator TomB	NA	NA	NA	NA	NA
BBF46101.1|509852_510071_+	modulator of gene expression with H-NS	NA	NA	NA	NA	NA
BBF46102.1|510242_510794_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
BBF46103.1|510909_511380_+	hypothetical protein	NA	NA	NA	NA	NA
BBF46104.1|511543_513094_+	membrane-anchored cyclic-di-GMP phosphodiesterase	NA	NA	NA	NA	NA
BBF46105.1|513135_513489_-	hypothetical protein	NA	NA	NA	NA	NA
BBF46106.1|513867_514179_+	6-O-methylguanine DNA methyltransferase	NA	NA	NA	NA	NA
BBF46107.1|514209_514782_-	outer membrane lipoprotein	NA	NA	NA	NA	NA
BBF46108.1|514999_515860_+	acyl-CoA thioesterase 2	NA	NA	NA	NA	NA
BBF46109.1|515907_517194_-	ammonium transporter	NA	NA	NA	NA	NA
BBF46110.1|517223_517562_-	nitrogen regulatory protein P-II 2	NA	NA	NA	NA	NA
BBF46111.1|517742_519524_-	multidrug ABC transporter ATPase	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
BBF46112.1|519516_521289_-	multidrug ABC transporter ATPase	NA	W8CYL7	Bacillus_phage	30.1	3.4e-49
BBF46113.1|521318_521777_-	transcriptional regulator	NA	NA	NA	NA	NA
BBF46114.1|521929_522748_-	thiamine pyrimidine pyrophosphate hydrolase	NA	NA	NA	NA	NA
BBF46115.1|522847_524548_+	ABC transporter periplasmic binding protein	NA	NA	NA	NA	NA
BBF46116.1|524612_525308_+	7-cyano-7-deazaguanine synthase	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
BBF46117.1|525359_525758_-	long-chain acyl-CoA thioesterase III	NA	NA	NA	NA	NA
BBF46118.1|525851_526223_-	competence-suppressing periplasmic helix-hairpin-helix DNA-binding protein	NA	NA	NA	NA	NA
BBF46119.1|526373_528245_-	peptidyl-prolyl cis-trans isomerase D	NA	NA	NA	NA	NA
BBF46120.1|528436_528709_-	transcriptional regulator HU subunit beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
BBF46121.1|528917_531272_-|protease	lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
BBF46122.1|531459_532734_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
BBF46123.1|532859_533483_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 4
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	832980	865708	5470440	integrase,transposase,holin,protease,head,tail	Enterobacteria_phage(53.66%)	44	827573:827589	857480:857496
827573:827589	attL	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
BBF46393.1|832980_833931_-|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.3	2.1e-159
BBF46394.1|833896_834784_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF46395.1|834783_835110_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF46396.1|835135_835309_-	phage lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	1.2e-17
BBF46397.1|835308_835515_-|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
BBF46398.1|835962_837813_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
BBF46399.1|838355_839099_-	membrane protein	NA	NA	NA	NA	NA
BBF46400.1|839283_839973_-	phage antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
BBF46401.1|840449_841409_+	outer membrane protein	NA	NA	NA	NA	NA
BBF46402.1|841620_841809_-	phage protein NinH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
BBF46403.1|841805_842168_-	phage endonuclease RUS	NA	A5VW85	Enterobacteria_phage	98.3	3.5e-62
BBF46404.1|842164_842455_-	hypothetical protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
BBF46405.1|842447_842660_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
BBF46406.1|842652_842829_-	phage protein NinF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
BBF46407.1|842828_843188_-	hypothetical protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
BBF46408.1|843190_843367_-	hypothetical protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
BBF46409.1|843363_843774_-	recombination protein	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	2.1e-71
BBF46410.1|843745_844108_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	67.9	4.4e-33
BBF46411.1|844125_844332_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	98.5	7.9e-27
BBF46412.1|844404_844695_-	phage exclusion protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
BBF46413.1|845071_845320_+|tail	phage tail protein	tail	E4WL21	Enterobacteria_phage	63.2	6.2e-18
BBF46414.1|845309_846815_+|head,protease	phage prohead protease	head,protease	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
BBF46415.1|846851_847199_+|head	phage head-DNA stabilization protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
BBF46416.1|847256_848285_+|head	phage head protein	head	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
BBF46417.1|848336_848711_+	phage DNA packaging protein	NA	NA	NA	NA	NA
BBF46418.1|848703_849057_+|head,tail	phage head-tail adaptor protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
BBF46419.1|849071_849647_+|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
BBF46420.1|849643_850039_+|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
BBF46421.1|850046_850799_+|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	97.2	3.9e-132
BBF46422.1|850812_851244_+|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
BBF46423.1|851270_851684_+|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
BBF46424.1|851664_854244_+|tail	phage tail length tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.4	0.0e+00
BBF46425.1|854240_854570_+|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BBF46426.1|854569_854917_+|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	2.0e-51
BBF46427.1|854874_855267_+|tail	phage minor tail protein	tail	Q9EYE3	Enterobacteria_phage	99.2	4.0e-72
BBF46428.1|855277_856021_+|tail	phage tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
BBF46429.1|856017_856596_+|tail	phage tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.4e-99
BBF46430.1|856836_860313_+	phage host specificity protein	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
857480:857496	attR	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
BBF46431.1|860380_860980_+	outer membrane precursor Lom	NA	Q687E7	Enterobacteria_phage	98.0	1.8e-108
BBF46432.1|861044_862358_+|tail	phage tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
BBF46433.1|862359_862629_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	96.6	4.6e-43
BBF46434.1|863007_863616_+	T3SS secreted effector NleH	NA	A5LH48	Enterobacteria_phage	89.6	1.4e-95
BBF46435.1|863930_864671_+	hypothetical protein	NA	A5LH49	Enterobacteria_phage	98.4	2.8e-138
BBF46436.1|865609_865708_+	T3SS secreted effector NleG	NA	H6WZN1	Escherichia_phage	93.5	1.7e-08
>prophage 5
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	989818	998667	5470440	tRNA,protease	Planktothrix_phage(33.33%)	8	NA	NA
BBF46556.1|989818_990268_+	macrolide ABC transporter permease/ATPase	NA	G9BWD6	Planktothrix_phage	35.6	1.6e-16
BBF46557.1|990295_991765_+	macrolide ABC transporter permease/ATPase	NA	G9BWD6	Planktothrix_phage	47.5	1.4e-08
BBF46558.1|991837_992062_-	inhibitor of DNA replication cold shock protein homolog	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
BBF46559.1|992384_992705_+|protease	ATP-dependent Clp protease adaptor protein ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
BBF46560.1|992735_995012_+|protease	ATP-binding component of serine protease	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
BBF46561.1|995696_995915_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
BBF46562.1|996199_996904_-|tRNA	leucyl/phenylalanyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
BBF46563.1|996945_998667_-	glutathione ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
>prophage 6
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	1100086	1231109	5470440	integrase,terminase,transposase,holin,protease,capsid,tail,lysis,portal,tRNA	Escherichia_phage(64.41%)	162	1112182:1112205	1173400:1173423
BBF46647.1|1100086_1100416_-|tRNA	mnm(5)-s(2)U34-tRNA 2-thiolation sulfurtransferase	tRNA	NA	NA	NA	NA
BBF46648.1|1100506_1101166_-	membrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
BBF46649.1|1101573_1101843_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	56.1	1.4e-20
BBF46650.1|1101875_1102589_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	47.9	9.7e-48
BBF46651.1|1102566_1102809_-	phage excisionase	NA	NA	NA	NA	NA
BBF46652.1|1102876_1103917_-	exodeoxyribonuclease VIII	NA	K7PLW7	Enterobacteria_phage	61.2	2.1e-59
BBF46653.1|1103971_1104859_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF46654.1|1104858_1105185_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF46655.1|1105236_1106661_-	exonuclease family protein	NA	NA	NA	NA	NA
BBF46656.1|1106753_1106945_-	hypothetical protein	NA	NA	NA	NA	NA
BBF46657.1|1106941_1107130_-	cell division inhibition protein	NA	NA	NA	NA	NA
BBF46658.1|1107661_1108036_-	hypothetical protein	NA	NA	NA	NA	NA
BBF46659.1|1108047_1108281_-	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	7.8e-07
BBF46660.1|1108472_1109189_-	phage repressor protein CI	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
BBF46661.1|1109238_1109454_+	phage antirepressor protein Cro	NA	NA	NA	NA	NA
BBF46662.1|1109450_1109876_+	hypothetical protein	NA	NA	NA	NA	NA
BBF46663.1|1109947_1111018_+	phage replication protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
BBF46664.1|1111058_1111481_+	phage exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
BBF46665.1|1111477_1111774_+	hypothetical protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	7.5e-47
BBF46666.1|1111770_1112232_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
1112182:1112205	attL	GCTGGCATTCGCATCAAAGGAGAG	NA	NA	NA	NA
BBF46667.1|1112209_1112566_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
BBF46668.1|1112616_1112829_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
BBF46669.1|1113080_1113344_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
BBF46670.1|1113354_1114224_+	putative phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
BBF46671.1|1114339_1114444_+	hypothetical protein	NA	NA	NA	NA	NA
BBF46672.1|1114432_1114588_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	83.8	1.9e-09
BBF46673.1|1114632_1114845_+	phage maintenance protein	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
BBF46674.1|1115292_1116342_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
BBF46675.1|1116354_1116726_+	endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
BBF46676.1|1116715_1117087_+	antiterminator	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
BBF46677.1|1117238_1118057_+|protease	CAAX amino terminal protease family protein	protease	NA	NA	NA	NA
BBF46678.1|1118343_1118541_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
BBF46679.1|1118804_1119392_+	AraC-family transcriptional regulator	NA	NA	NA	NA	NA
BBF46680.1|1120159_1122010_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
BBF46681.1|1122457_1122664_+|holin	phage holine protein	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
BBF46682.1|1122746_1123634_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF46683.1|1123633_1123960_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF46684.1|1124232_1124505_-	hypothetical protein	NA	NA	NA	NA	NA
BBF46685.1|1124664_1125198_+	phage endolysin	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
BBF46686.1|1125418_1125532_+	putative phage protein	NA	A0A2L1IV24	Escherichia_phage	97.3	5.6e-11
BBF46687.1|1125533_1126001_+	phage endopeptidase	NA	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
BBF46688.1|1126465_1126780_+	PchABC family transcriptional regulator	NA	NA	NA	NA	NA
BBF46689.1|1127135_1128023_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF46690.1|1128022_1128349_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF46691.1|1128435_1129329_-	T3SS secreted effector TccP2	NA	NA	NA	NA	NA
BBF46692.1|1129774_1130158_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
BBF46693.1|1130775_1131894_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
BBF46694.1|1131890_1133684_+	hydrogenase 1 large subunit	NA	NA	NA	NA	NA
BBF46695.1|1133702_1134410_+	hydrogenase 1 b-type cytochrome subunit	NA	NA	NA	NA	NA
BBF46696.1|1134406_1134994_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
BBF46697.1|1134990_1135389_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
BBF46698.1|1135385_1136243_+	hydrogenase-1 protein nickel incorporation factor	NA	NA	NA	NA	NA
BBF46699.1|1136376_1137921_+	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
BBF46700.1|1137932_1139069_+	cytochrome bd-II oxidase subunit II	NA	NA	NA	NA	NA
BBF46701.1|1139081_1139174_+	cytochrome bd-II oxidase subunit	NA	NA	NA	NA	NA
BBF46702.1|1139253_1140552_+	phosphoanhydride phosphorylase	NA	NA	NA	NA	NA
BBF46703.1|1140666_1142847_-	colanic acid production tyrosine-protein kinase	NA	NA	NA	NA	NA
BBF46704.1|1142866_1143313_-	O-antigen capsule forming protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
BBF46705.1|1143300_1144440_-	O-antigen capsule outer membrane auxiliary protein export channel	NA	NA	NA	NA	NA
BBF46706.1|1144485_1146582_-	O-antigen capsule production periplasmic protein	NA	NA	NA	NA	NA
BBF46707.1|1146581_1147328_-	O-antigen capsule production periplasmic protein	NA	NA	NA	NA	NA
BBF46708.1|1147324_1147969_-	O-antigen capsule production lipoprotein	NA	NA	NA	NA	NA
BBF46709.1|1148075_1148381_-	O-antigen capsule production threonine-rich inner membrane protein	NA	NA	NA	NA	NA
BBF46710.1|1149320_1149533_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
BBF46711.1|1149926_1150100_+	hypothetical protein	NA	NA	NA	NA	NA
BBF46712.1|1150147_1151221_-	electron transporter	NA	NA	NA	NA	NA
BBF46713.1|1151292_1153992_-	hybrid sensory histidine kinase in two-component regulatory system with TorR	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
BBF46714.1|1154119_1155148_+	periplasmic sensory protein associated with the TorRS two-component regulatory system	NA	NA	NA	NA	NA
BBF46715.1|1155120_1155813_-	two-component regulatory system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
BBF46716.1|1155942_1157115_+	trimethylamine N-oxidoreductase I cytochrome c-type subunit	NA	NA	NA	NA	NA
BBF46717.1|1157114_1159661_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
BBF46718.1|1159657_1160257_+	TorA-maturation chaperone	NA	NA	NA	NA	NA
BBF46719.1|1160349_1160655_-	modulator of CbpA co-chaperone	NA	NA	NA	NA	NA
BBF46720.1|1160654_1161575_-	DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
BBF46721.1|1161834_1163094_+	hypothetical protein	NA	NA	NA	NA	NA
BBF46722.1|1163385_1164627_+	glucose-1-phosphatase	NA	NA	NA	NA	NA
BBF46723.1|1164664_1164892_-	hypothetical protein	NA	NA	NA	NA	NA
BBF46724.1|1164912_1165491_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
BBF46725.1|1165487_1166798_-|integrase	integrase	integrase	A0A0P0ZGT7	Escherichia_phage	100.0	2.4e-254
BBF46726.1|1166850_1167135_-	phage excisionase	NA	G9L654	Escherichia_phage	100.0	9.1e-50
BBF46727.1|1167180_1167432_-	hypothetical protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
BBF46728.1|1167419_1167653_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	98.7	3.1e-35
BBF46729.1|1167796_1168186_-	hypothetical protein	NA	A0A0H4J3B1	Shigella_phage	100.0	2.1e-52
BBF46730.1|1168221_1168434_-	hypothetical protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
BBF46731.1|1168393_1169020_-	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
BBF46732.1|1169016_1169448_-	regulatory protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
BBF46733.1|1169503_1170133_-	antirepressor	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
BBF46734.1|1170382_1170667_-	phage antirepressor	NA	G9L6G2	Escherichia_phage	100.0	4.1e-50
BBF46735.1|1171022_1171952_-	hypothetical protein	NA	A0A0H4IU61	Shigella_phage	100.0	5.1e-182
BBF46736.1|1171948_1172464_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	100.0	2.4e-101
BBF46737.1|1172465_1172654_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
BBF46738.1|1172650_1172827_-	hypothetical protein	NA	A0A0F6TJP6	Escherichia_coli_O157_typing_phage	84.5	3.9e-19
BBF46739.1|1172826_1173189_-	putative phage protein	NA	A0A1B0V865	Salmonella_phage	97.4	8.9e-58
BBF46740.1|1173185_1173395_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	92.8	2.0e-33
BBF46741.1|1173396_1174290_-	hypothetical protein	NA	A0A0N7BYR8	Escherichia_phage	93.0	1.4e-165
1173400:1173423	attR	CTCTCCTTTGATGCGAATGCCAGC	NA	NA	NA	NA
BBF46742.1|1174286_1174526_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	97.5	6.7e-38
BBF46743.1|1174518_1174722_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
BBF46744.1|1174718_1175597_-	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	100.0	1.0e-179
BBF46745.1|1175704_1176148_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	100.0	1.7e-79
BBF46746.1|1176224_1177046_-	hypothetical protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
BBF46747.1|1177109_1177457_-	hypothetical protein	NA	A0A2R2X2A9	Escherichia_phage	100.0	5.9e-59
BBF46748.1|1177532_1178120_-	hypothetical protein	NA	A0A2R2Z318	Escherichia_phage	100.0	4.0e-108
BBF46749.1|1178119_1178809_-	exonuclease	NA	A0A2R2Z325	Escherichia_phage	100.0	2.7e-135
BBF46750.1|1178805_1179756_-	phage DNA recombination protein Bet	NA	A0A0P0ZFY9	Escherichia_phage	99.7	3.2e-179
BBF46751.1|1179773_1180055_-	hypothetical protein	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
BBF46752.1|1180075_1180357_-	AbrB family transcriptional regulator	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
BBF46753.1|1180368_1180581_-	phage cell division inhibitor protein	NA	A0A2R2Z321	Escherichia_phage	98.6	2.2e-32
BBF46754.1|1180651_1181326_-	hypothetical protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
BBF46755.1|1181582_1182230_-	hypothetical protein	NA	A0A0H4IQ68	Shigella_phage	99.5	1.9e-119
BBF46756.1|1182985_1183366_-	hypothetical protein	NA	NA	NA	NA	NA
BBF46757.1|1183365_1183836_-	hypothetical protein	NA	D0UIM3	Aggregatibacter_phage	41.6	5.4e-23
BBF46758.1|1184016_1184970_-	type II site-specific deoxyribonuclease	NA	A0A0P0ZG22	Escherichia_phage	97.8	3.6e-183
BBF46759.1|1184966_1186436_-	modification methyltransferase	NA	A0A2R2Z316	Escherichia_phage	97.1	2.7e-278
BBF46760.1|1186531_1187251_-	phage repressor protein CI	NA	A0A2R2X2B0	Escherichia_phage	68.6	3.1e-86
BBF46761.1|1187356_1187596_+	hypothetical protein	NA	NA	NA	NA	NA
BBF46762.1|1187636_1187900_+	hypothetical protein	NA	A0A0N7BYT1	Escherichia_phage	98.8	2.9e-42
BBF46763.1|1188121_1188508_+	hypothetical protein	NA	A0A286S263	Klebsiella_phage	44.8	2.6e-23
BBF46764.1|1188501_1190022_+	helicase	NA	A0A0N7KZV6	Escherichia_phage	98.8	8.6e-304
BBF46765.1|1190011_1190983_+	DNA primase	NA	A0A0H4IPK0	Shigella_phage	99.7	9.4e-195
BBF46766.1|1190982_1191432_+	hypothetical protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
BBF46767.1|1191439_1192003_+	recombination endonuclease	NA	A0A0P0ZG59	Escherichia_phage	98.4	1.3e-103
BBF46768.1|1191999_1192194_+	hypothetical protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
BBF46769.1|1192186_1192621_+	antiterminator	NA	G9L695	Escherichia_phage	100.0	2.8e-82
BBF46770.1|1193842_1195780_+	hypothetical protein	NA	A0A1I9LJQ8	Stx_converting_phage	99.7	0.0e+00
BBF46771.1|1195917_1196097_+	hypothetical protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
BBF46772.1|1196137_1196383_+	hypothetical protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
BBF46773.1|1196460_1196676_+|lysis	phage lysis protein	lysis	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
BBF46774.1|1196680_1197214_+	phage endolysin	NA	A0A2R2Z343	Escherichia_phage	99.4	5.1e-102
BBF46775.1|1197488_1198058_+	phage antirepressor	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
BBF46776.1|1198057_1198207_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
BBF46777.1|1198214_1198679_+	endopeptidase	NA	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
BBF46778.1|1198710_1199004_-	Bor protein precursor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
BBF46779.1|1199153_1199357_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
BBF46780.1|1199412_1200219_+|terminase	phage terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
BBF46781.1|1200199_1201906_+|terminase	phage terminase large subunit	terminase	G9L6K0	Escherichia_phage	100.0	0.0e+00
BBF46782.1|1201905_1204050_+|portal	phage portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
BBF46783.1|1204206_1205214_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
BBF46784.1|1205237_1206452_+|capsid	phage major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
BBF46785.1|1206507_1206897_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
BBF46786.1|1206946_1207408_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
BBF46787.1|1207391_1207955_+	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
BBF46788.1|1207954_1208605_+	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
BBF46789.1|1208601_1210539_+|tail	phage tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	99.3	3.1e-64
BBF46790.1|1210540_1210810_+	hypothetical protein	NA	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
BBF46791.1|1210949_1211129_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	2.8e-28
BBF46792.1|1211125_1211215_+	hypothetical protein	NA	NA	NA	NA	NA
BBF46793.1|1211432_1213058_+	hypothetical protein	NA	A0A088CBK0	Shigella_phage	99.8	0.0e+00
BBF46794.1|1213054_1214323_+|tail	phage tail fiber protein	tail	A0A2L1IV54	Escherichia_phage	89.5	2.6e-213
BBF46795.1|1214337_1214616_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
BBF46796.1|1214621_1215239_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
BBF46797.1|1215329_1216064_+	outer membrane precursor protein Lom	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
BBF46798.1|1216296_1216437_+	hypothetical protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
BBF46799.1|1216493_1216895_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
BBF46800.1|1216988_1217645_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
BBF46801.1|1217647_1218094_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
BBF46802.1|1218103_1218355_+	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
BBF46803.1|1218365_1219631_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	98.8	9.9e-205
BBF46804.1|1219699_1228069_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	93.4	0.0e+00
BBF46805.1|1228134_1228251_-	hypothetical protein	NA	A0A0P0ZG52	Escherichia_phage	100.0	1.3e-15
BBF46806.1|1229009_1229183_+	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
BBF46807.1|1229265_1230594_-	pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
BBF46808.1|1230614_1231109_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 7
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	1248822	1282223	5470440	integrase,transposase	Escherichia_phage(38.46%)	33	1241060:1241074	1272284:1272298
1241060:1241074	attL	TTCTGGCGGCGGTAA	NA	NA	NA	NA
BBF46824.1|1248822_1250025_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
BBF46825.1|1250211_1252029_-	membrane protein	NA	NA	NA	NA	NA
BBF46826.1|1253262_1253448_-	hypothetical protein	NA	NA	NA	NA	NA
BBF46827.1|1254079_1255513_+	hypothetical protein	NA	NA	NA	NA	NA
BBF46828.1|1256333_1256897_+	hypothetical protein	NA	NA	NA	NA	NA
BBF46829.1|1257051_1259412_+	IS-excision enhancer IEE	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
BBF46830.1|1259573_1259843_-	hypothetical protein	NA	NA	NA	NA	NA
BBF46831.1|1260168_1261707_-|transposase	ISEc8 transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.7e-299
BBF46832.1|1261918_1262245_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF46833.1|1262244_1263132_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF46834.1|1263988_1264348_+	diacylglycerol kinase	NA	NA	NA	NA	NA
BBF46835.1|1264440_1266060_-	membrane-associated metal-dependent hydrolase	NA	NA	NA	NA	NA
BBF46836.1|1266322_1266559_-	hypothetical protein	NA	NA	NA	NA	NA
BBF46837.1|1266939_1267638_+	urease accessory protein	NA	NA	NA	NA	NA
BBF46838.1|1267728_1268031_+	urease subunit gamma	NA	NA	NA	NA	NA
BBF46839.1|1268039_1268360_+	urease subunit beta	NA	NA	NA	NA	NA
BBF46840.1|1268352_1270056_+	urease subunit alpha	NA	NA	NA	NA	NA
BBF46841.1|1270065_1270530_+	urease accessory protein	NA	NA	NA	NA	NA
BBF46842.1|1270530_1271205_+	urease accessory protein	NA	NA	NA	NA	NA
BBF46843.1|1271216_1271834_+	urease accessory protein	NA	NA	NA	NA	NA
BBF46844.1|1271872_1272136_+	hypothetical protein	NA	NA	NA	NA	NA
BBF46845.1|1272089_1272431_-|transposase	IS600 transposase OrfA	transposase	NA	NA	NA	NA
1272284:1272298	attR	TTCTGGCGGCGGTAA	NA	NA	NA	NA
BBF46846.1|1272492_1272621_-	complement resistance protein precursor TraT	NA	NA	NA	NA	NA
BBF46847.1|1273045_1273309_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
BBF46848.1|1273610_1273751_+	hypothetical protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
BBF46849.1|1274596_1275295_-	membrane protein	NA	NA	NA	NA	NA
BBF46850.1|1276827_1277208_-	hypothetical protein	NA	A0A218MNE7	uncultured_virus	47.8	1.1e-26
BBF46851.1|1277363_1277690_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF46852.1|1277689_1278577_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF46853.1|1278945_1279371_+|transposase	IS682 transposase	transposase	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
BBF46854.1|1279367_1279718_+|transposase	IS682 transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
BBF46855.1|1279748_1281362_+|transposase	IS682 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
BBF46856.1|1281365_1282223_-|transposase	transposase	transposase	S5VLC8	Leptospira_phage	30.0	3.3e-26
>prophage 8
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	1301175	1326342	5470440	transposase	Escherichia_phage(50.0%)	26	NA	NA
BBF46875.1|1301175_1301304_-|transposase	transposase	transposase	NA	NA	NA	NA
BBF46876.1|1301646_1301841_-	hypothetical protein	NA	NA	NA	NA	NA
BBF46877.1|1301892_1302066_-	hypothetical protein	NA	NA	NA	NA	NA
BBF46878.1|1302154_1302427_+	hypothetical protein	NA	NA	NA	NA	NA
BBF46879.1|1302991_1303189_+	regulatory protein	NA	NA	NA	NA	NA
BBF46880.1|1303918_1305043_+	glucosyl-transferase	NA	NA	NA	NA	NA
BBF46881.1|1305461_1305755_-|transposase	IS1 transposase InsB	transposase	U5P0U6	Shigella_phage	92.8	8.3e-46
BBF46882.1|1306396_1306855_-	membrane protein	NA	NA	NA	NA	NA
BBF46883.1|1307312_1307822_+	hypothetical protein	NA	NA	NA	NA	NA
BBF46884.1|1307910_1308534_+	DNA-binding protein	NA	NA	NA	NA	NA
BBF46885.1|1308629_1308863_+	hypothetical protein	NA	NA	NA	NA	NA
BBF46886.1|1308915_1309107_-	hypothetical protein	NA	NA	NA	NA	NA
BBF46887.1|1309781_1310828_+	HecB-like protein	NA	NA	NA	NA	NA
BBF46888.1|1311068_1313750_+	UvrD/REP helicase-like protein	NA	NA	NA	NA	NA
BBF46889.1|1314250_1314466_+	phosphoadenosine phosphosulfate reductase	NA	A0A218M763	Flavobacterium_phage	53.4	1.7e-08
BBF46890.1|1314505_1315483_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.7	3.0e-47
BBF46891.1|1315467_1316106_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.9e-55
BBF46892.1|1316169_1317057_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF46893.1|1317056_1317383_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF46894.1|1317464_1318646_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
BBF46895.1|1318646_1319594_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
BBF46896.1|1319593_1321336_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
BBF46897.1|1321332_1322670_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
BBF46898.1|1322675_1324871_+	ferric siderophore receptor	NA	NA	NA	NA	NA
BBF46899.1|1325128_1326016_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.4e-168
BBF46900.1|1326015_1326342_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
>prophage 9
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	1418173	1482890	5470440	integrase,terminase,transposase,holin,protease,head,tail,portal,tRNA	Stx2-converting_phage(40.38%)	71	1413267:1413281	1419748:1419762
1413267:1413281	attL	GATCGCGATGTACGC	NA	NA	NA	NA
BBF47003.1|1418173_1419292_-|integrase	integrase	integrase	Q77Z04	Phage_21	43.9	2.9e-83
BBF47004.1|1419260_1419530_-	phage excisionase	NA	NA	NA	NA	NA
BBF47005.1|1419591_1422057_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	8.8e-56
1419748:1419762	attR	GCGTACATCGCGATC	NA	NA	NA	NA
BBF47006.1|1422149_1422341_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47007.1|1422337_1422526_-	cell division inhibition protein	NA	NA	NA	NA	NA
BBF47008.1|1423009_1423228_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47009.1|1423268_1423658_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47010.1|1423953_1424232_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47011.1|1424233_1424425_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47012.1|1424445_1424817_-	phage repressor protein CI	NA	NA	NA	NA	NA
BBF47013.1|1424915_1425218_+	phage antirepressor protein Cro	NA	K7PHA1	Enterobacteria_phage	34.8	1.5e-05
BBF47014.1|1425214_1425640_+	hypothetical protein	NA	NA	NA	NA	NA
BBF47015.1|1425662_1426625_+	phage replication protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
BBF47016.1|1426665_1427082_+	phage exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.6e-63
BBF47017.1|1427121_1428009_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF47018.1|1428008_1428335_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF47019.1|1428882_1430010_+	hypothetical protein	NA	U5P0K4	Shigella_phage	47.8	6.8e-88
BBF47020.1|1430010_1430376_+	phage endonuclease RUS	NA	V5URS4	Shigella_phage	64.3	1.6e-38
BBF47021.1|1430384_1430915_+	phage antiterminator	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
BBF47022.1|1431156_1431354_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
BBF47023.1|1431504_1432563_+	DNA methylase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
BBF47024.1|1433150_1433240_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	96.3	1.6e-08
BBF47025.1|1433359_1435210_+	hypothetical protein	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
BBF47026.1|1435657_1435864_+|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
BBF47027.1|1435868_1436213_+	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
BBF47028.1|1436263_1436797_+	phage endolysin	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
BBF47029.1|1437067_1437637_+	phage antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
BBF47030.1|1437636_1437783_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
BBF47031.1|1437790_1438258_+	phage endopeptidase	NA	Q6H9V3	Enterobacteria_phage	100.0	6.9e-79
BBF47032.1|1438620_1438848_-	hypothetical protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
BBF47033.1|1438889_1439255_+	DNase	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
BBF47034.1|1439544_1440108_+|terminase	phage terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
BBF47035.1|1440104_1441766_+|terminase	phage terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
BBF47036.1|1441829_1443767_+|head,protease	phage prohead protease	head,protease	B6ETE8	Enterobacteria_phage	99.7	0.0e+00
BBF47037.1|1443811_1444033_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
BBF47038.1|1443978_1445343_+|portal	phage portal protein	portal	B6DZX6	Stx2-converting_phage	98.0	1.9e-254
BBF47039.1|1445339_1446725_+|portal	phage portal protein	portal	H6WZL3	Escherichia_phage	84.2	2.1e-83
BBF47040.1|1446721_1447048_+	phage DNA packaging protein	NA	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
BBF47041.1|1447057_1447408_+|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BBF47042.1|1447404_1447851_+|tail	phage minor tail protein	tail	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
BBF47043.1|1447847_1448192_+|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
BBF47044.1|1448258_1448975_+|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
BBF47045.1|1448980_1449355_+|tail	phage tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	97.6	5.6e-63
BBF47046.1|1449450_1449660_+|tail	phage minor tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
BBF47047.1|1449711_1452954_+|tail	phage tail length tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.3	0.0e+00
BBF47048.1|1452946_1453288_+|tail	phage minor tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
BBF47049.1|1453287_1453986_+|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	1.7e-129
BBF47050.1|1454002_1454323_-	regulatory protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
BBF47051.1|1454430_1454634_+	transcriptional regulator	NA	A0A0P0ZC65	Stx2-converting_phage	74.6	2.8e-16
BBF47052.1|1454623_1455310_+	antirepressor	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	3.1e-120
BBF47053.1|1455681_1456419_+|tail	phage tail assembly protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
BBF47054.1|1456415_1456997_+|tail	phage tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.4	7.3e-94
BBF47055.1|1457233_1460713_+	phage host specificity protein	NA	A0A0P0ZDT4	Stx2-converting_phage	97.6	0.0e+00
BBF47056.1|1460779_1461379_+	outer membrane precursor Lom	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
BBF47057.1|1461539_1462766_+|tail	phage tail fiber protein	tail	Q687E6	Enterobacteria_phage	99.0	2.1e-58
BBF47058.1|1462767_1463037_+	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
BBF47059.1|1463143_1463233_+	hypothetical protein	NA	NA	NA	NA	NA
BBF47060.1|1463252_1465601_+	T3SS secreted effector EspX	NA	NA	NA	NA	NA
BBF47061.1|1466191_1469593_+	T3SS secreted effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.0e-219
BBF47062.1|1469761_1470340_+|transposase	transposase	transposase	NA	NA	NA	NA
BBF47063.1|1470481_1470715_+	hypothetical protein	NA	NA	NA	NA	NA
BBF47064.1|1470903_1472265_-	T3SS secreted effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
BBF47065.1|1472628_1473492_-	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
BBF47066.1|1473475_1474612_-	spermidine/putrescine ABC transporter ATPase	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
BBF47067.1|1474861_1476091_+	peptidase T	NA	NA	NA	NA	NA
BBF47068.1|1476236_1477358_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
BBF47069.1|1477433_1478894_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
BBF47070.1|1478893_1479565_-	two-component regulatory system response regulator PhoP	NA	NA	NA	NA	NA
BBF47071.1|1479732_1481103_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
BBF47072.1|1481106_1481748_-	lysogenization regulator	NA	NA	NA	NA	NA
BBF47073.1|1481783_1482890_-|tRNA	tRNA(Gln,Lys,Glu) U34 2-thiouridylase	tRNA	NA	NA	NA	NA
>prophage 10
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	1568782	1655813	5470440	terminase,protease,transposase,tail,lysis,portal,tRNA	Enterobacteria_phage(40.68%)	100	NA	NA
BBF47159.1|1568782_1568968_-|transposase	IS4 transposase	transposase	NA	NA	NA	NA
BBF47160.1|1569091_1571767_-	acetaldehyde dehydrogenase	NA	NA	NA	NA	NA
BBF47161.1|1572243_1572891_+	inner membrane protein	NA	NA	NA	NA	NA
BBF47162.1|1572917_1573073_+	hypothetical protein	NA	NA	NA	NA	NA
BBF47163.1|1573048_1573210_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47164.1|1573583_1575260_+	oligopeptide ABC transporter periplasmic binding protein	NA	NA	NA	NA	NA
BBF47165.1|1575345_1576266_+	oligopeptide ABC transporter permease	NA	NA	NA	NA	NA
BBF47166.1|1576280_1577189_+	oligopeptide ABC transporter permease	NA	NA	NA	NA	NA
BBF47167.1|1577200_1578214_+	oligopeptide ABC transporter ATPase	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
BBF47168.1|1578210_1579215_+	oligopeptide ABC transporter ATPase	NA	G9BWD6	Planktothrix_phage	35.6	8.0e-24
BBF47169.1|1579267_1579597_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47170.1|1579631_1581092_-	cardiolipin synthase 1	NA	NA	NA	NA	NA
BBF47171.1|1581462_1582716_-	voltage-gated potassium channel	NA	NA	NA	NA	NA
BBF47172.1|1583014_1583311_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47173.1|1584106_1584655_+	site-specific recombinases	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
BBF47174.1|1586165_1586354_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47175.1|1586460_1586997_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	71.9	4.1e-59
BBF47176.1|1587056_1587311_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	73.2	2.4e-25
BBF47177.1|1587307_1587604_+	hypothetical protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
BBF47178.1|1587600_1588062_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	6.9e-39
BBF47179.1|1588039_1588396_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
BBF47180.1|1588491_1588863_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
BBF47181.1|1588859_1589213_+	putative phage protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
BBF47182.1|1589418_1589718_-	plasmid stabilization protein	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
BBF47183.1|1589723_1589981_-	transcriptional regulator	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
BBF47184.1|1590396_1591446_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
BBF47185.1|1591458_1591833_+	phage endonuclease RUS	NA	V5URS4	Shigella_phage	62.7	2.4e-34
BBF47186.1|1591829_1592651_+	phage antitermination protein Q	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
BBF47187.1|1592877_1593075_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
BBF47188.1|1593225_1594284_+	DNA methylase	NA	S5MDR0	Escherichia_phage	98.0	1.7e-205
BBF47189.1|1594878_1596825_+	hypothetical protein	NA	Q9EYC8	Enterobacteria_phage	99.1	0.0e+00
BBF47190.1|1596962_1597142_+	hypothetical protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
BBF47191.1|1597182_1597428_+	hypothetical protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
BBF47192.1|1597505_1597721_+|lysis	phage lysis protein	lysis	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
BBF47193.1|1597724_1597970_+	hypothetical protein	NA	NA	NA	NA	NA
BBF47194.1|1597995_1598322_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF47195.1|1598321_1599209_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF47196.1|1599406_1599595_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	72.6	4.2e-19
BBF47197.1|1599631_1600165_+	phage endolysin	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
BBF47198.1|1600288_1600462_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	95.6	3.6e-17
BBF47199.1|1600463_1600931_+	endopeptidase	NA	Q7AYI6	Enterobacteria_phage	96.1	3.9e-74
BBF47200.1|1601344_1601821_+|terminase	phage terminase small subunit	terminase	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
BBF47201.1|1601817_1603941_+|terminase	phage terminase large subunit	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
BBF47202.1|1603937_1604150_+	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
BBF47203.1|1604149_1605652_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
BBF47204.1|1605596_1607621_+|protease	phage protease/scaffold protein	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
BBF47205.1|1607708_1608035_+	membrane protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
BBF47206.1|1608027_1608309_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
BBF47207.1|1608311_1608935_+|tail	phage minor tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
BBF47208.1|1608947_1609346_+|tail	phage minor tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
BBF47209.1|1609353_1610106_+|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
BBF47210.1|1610119_1610542_+|tail	phage minor tail protein	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
BBF47211.1|1610568_1610877_+|tail	phage minor tail protein	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
BBF47212.1|1610920_1613566_+|tail	phage tail length tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.5	0.0e+00
BBF47213.1|1613562_1613892_+|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BBF47214.1|1613891_1614239_+|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	2.0e-51
BBF47215.1|1614196_1614589_+|tail	phage minor tail protein	tail	Q687F1	Enterobacteria_phage	97.7	9.9e-71
BBF47216.1|1614599_1615343_+|tail	phage tail assembly protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
BBF47217.1|1615339_1615921_+|tail	phage tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.4	7.3e-94
BBF47218.1|1616157_1619637_+	phage host specificity protein	NA	A0A0P0ZDT4	Stx2-converting_phage	97.3	0.0e+00
BBF47219.1|1619704_1620304_+	outer membrane precursor Lom	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
BBF47220.1|1620368_1621682_+|tail	phage tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
BBF47221.1|1621683_1621953_+	hypothetical protein	NA	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
BBF47222.1|1622407_1622800_+|transposase	IS1 transposase InsB	transposase	U5P0U6	Shigella_phage	85.3	8.4e-54
BBF47223.1|1623088_1623679_+	T3SS secreted effector OspG	NA	NA	NA	NA	NA
BBF47224.1|1624056_1624227_+|tail	phage tail component	tail	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
BBF47225.1|1624715_1625222_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47226.1|1625267_1625768_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47227.1|1625853_1626033_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47228.1|1626413_1627220_-	tryptophan synthase alpha chain	NA	NA	NA	NA	NA
BBF47229.1|1627219_1628413_-	tryptophan synthase beta chain	NA	NA	NA	NA	NA
BBF47230.1|1628424_1629783_-	indole-3-glycerolphosphate synthetase and N-(5-phosphoribosyl)anthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
BBF47231.1|1629786_1631382_-	anthranilate synthase component II	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
BBF47232.1|1631381_1632944_-	component I of anthranilate synthase	NA	NA	NA	NA	NA
BBF47233.1|1633217_1634099_+|tRNA	S-adenosylmethionine tRNA ribosyltransferase	tRNA	NA	NA	NA	NA
BBF47234.1|1634095_1634716_+	RNA binding protein	NA	NA	NA	NA	NA
BBF47235.1|1634816_1635689_+	ribosomal large subunit pseudouridine synthase B	NA	NA	NA	NA	NA
BBF47236.1|1635728_1636319_-	cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase	NA	NA	NA	NA	NA
BBF47237.1|1636315_1637074_-	EmrKY-TolC system oxoacyl-(acyl carrier protein) reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
BBF47238.1|1637293_1638343_+	peptidase	NA	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
BBF47239.1|1638378_1638630_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47240.1|1639009_1641607_+	DNA topoisomerase I	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
BBF47241.1|1641816_1642791_+	N-acetylserine-responsive cysteine regulon transcriptional activator	NA	NA	NA	NA	NA
BBF47242.1|1643121_1643250_+	hypothetical protein	NA	NA	NA	NA	NA
BBF47243.1|1643252_1643420_+	hypothetical protein	NA	NA	NA	NA	NA
BBF47244.1|1643533_1643629_+	hypothetical protein	NA	NA	NA	NA	NA
BBF47245.1|1643792_1646468_+	aconitate hydratase 1	NA	NA	NA	NA	NA
BBF47246.1|1646531_1647122_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
BBF47247.1|1647291_1648056_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
BBF47248.1|1648204_1648513_+	inner membrane-anchored protein	NA	NA	NA	NA	NA
BBF47249.1|1648519_1649689_+	hypothetical protein	NA	NA	NA	NA	NA
BBF47250.1|1649820_1650618_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
BBF47251.1|1650617_1650944_+	stress response translation initiation inhibitor	NA	NA	NA	NA	NA
BBF47252.1|1651069_1651288_-	osmotically and stress inducible lipoprotein	NA	NA	NA	NA	NA
BBF47253.1|1651556_1652306_-	global regulator of transcription	NA	NA	NA	NA	NA
BBF47254.1|1652395_1652569_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47255.1|1652716_1653397_-	modulator of Rnase II stability	NA	NA	NA	NA	NA
BBF47256.1|1653406_1654534_-	modulator of Rnase II stability	NA	NA	NA	NA	NA
BBF47257.1|1654599_1655487_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF47258.1|1655486_1655813_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
>prophage 11
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	1716197	1776496	5470440	integrase,terminase,holin,transposase,protease,head,tail,portal,tRNA	Escherichia_phage(41.18%)	75	1715831:1715846	1746985:1747000
1715831:1715846	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
BBF47318.1|1716197_1717430_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
BBF47319.1|1717684_1718668_+	Zn(II) transporter	NA	NA	NA	NA	NA
BBF47320.1|1718942_1719116_+	hypothetical protein	NA	NA	NA	NA	NA
BBF47321.1|1719145_1720519_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
BBF47322.1|1720647_1721583_-|tRNA	tRNA s(2)C32 thioltransferase	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
BBF47323.1|1721634_1722870_-|integrase	integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
BBF47324.1|1722871_1723087_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
BBF47325.1|1723186_1723375_-	hypothetical protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
BBF47326.1|1723617_1724427_-	recombination and repair protein	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
BBF47327.1|1724419_1727020_-	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
BBF47328.1|1727121_1727397_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
BBF47329.1|1727471_1727642_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
BBF47330.1|1727641_1727863_-	phage cell division inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
BBF47331.1|1728181_1728793_+	phage superinfection exclusion protein	NA	NA	NA	NA	NA
BBF47332.1|1728789_1728945_-	hypothetical protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
BBF47333.1|1729377_1729797_-	regulator for DicB	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
BBF47334.1|1729876_1730131_+	phage antirepressor Cro	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
BBF47335.1|1730127_1730550_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
BBF47336.1|1730627_1731416_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
BBF47337.1|1731422_1732169_+	phage DNA replication protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
BBF47338.1|1732191_1732953_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
BBF47339.1|1732968_1733391_+	phage exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
BBF47340.1|1733496_1733709_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
BBF47341.1|1733960_1734224_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
BBF47342.1|1734234_1734396_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
BBF47343.1|1735151_1736303_+	DNA methylase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
BBF47344.1|1736270_1737260_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47345.1|1737259_1738651_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47346.1|1739150_1739750_+	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
BBF47347.1|1739749_1740040_+	hypothetical protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
BBF47348.1|1740036_1740591_+	phage antiterminator	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
BBF47349.1|1741152_1741584_+	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
BBF47350.1|1741396_1741915_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47351.1|1742154_1743720_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	95.7	3.7e-294
BBF47352.1|1743736_1744006_+	hypothetical protein	NA	H6WZJ9	Escherichia_phage	100.0	1.6e-43
BBF47353.1|1744155_1744371_+|holin	phage holin protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
BBF47354.1|1744375_1744720_+	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
BBF47355.1|1744770_1745304_+	phage endolysin	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
BBF47356.1|1745577_1746117_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	99.4	3.0e-86
BBF47357.1|1746119_1747007_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
1746985:1747000	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
BBF47358.1|1747006_1747333_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF47359.1|1747409_1747586_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	98.3	3.3e-26
BBF47360.1|1747582_1747678_+	hypothetical protein	NA	NA	NA	NA	NA
BBF47361.1|1747823_1748282_+	endopeptidase	NA	Q7AYI6	Enterobacteria_phage	93.4	2.6e-70
BBF47362.1|1748620_1748947_+	membrane protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
BBF47363.1|1749078_1749279_-	hypothetical protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
BBF47364.1|1749320_1749686_+	DNase	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
BBF47365.1|1749974_1750538_+|terminase	phage terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
BBF47366.1|1750534_1752196_+|terminase	phage terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
BBF47367.1|1752259_1754197_+|head,protease	phage prohead protease	head,protease	H6WZL0	Escherichia_phage	99.7	0.0e+00
BBF47368.1|1754241_1754463_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
BBF47369.1|1754408_1755773_+|portal	phage portal protein	portal	A0A0P0ZCX8	Stx2-converting_phage	97.4	2.5e-254
BBF47370.1|1755769_1756831_+|portal	phage portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	84.8	1.6e-99
BBF47371.1|1756827_1757154_+	phage DNA packaging protein	NA	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
BBF47372.1|1757163_1757514_+|head,tail	phage head-tail adaptor	head,tail	H6WZL5	Escherichia_phage	100.0	2.0e-59
BBF47373.1|1757510_1757957_+|tail	phage minor tail protein	tail	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
BBF47374.1|1757953_1758298_+|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
BBF47375.1|1758366_1759083_+|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	1.4e-126
BBF47376.1|1759088_1759463_+|tail	phage tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
BBF47377.1|1759558_1759768_+|tail	phage minor tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
BBF47378.1|1759819_1763062_+|tail	phage tail length tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	98.9	0.0e+00
BBF47379.1|1763054_1763396_+|tail	phage minor tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
BBF47380.1|1763395_1764094_+|tail	phage minor tail protein	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
BBF47381.1|1764104_1764848_+|tail	phage tail assembly protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
BBF47382.1|1764844_1765426_+|tail	phage tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	89.6	3.3e-86
BBF47383.1|1765616_1766144_-	copper/zinc-superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
BBF47384.1|1766277_1769775_+	phage host specificity protein	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
BBF47385.1|1769845_1770445_+	outer membrane precursor Lom	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
BBF47386.1|1770509_1771823_+|tail	phage tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	7.9e-80
BBF47387.1|1771824_1772094_+	hypothetical protein	NA	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
BBF47388.1|1772206_1772782_+	T3SS secreted effector NleG	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
BBF47389.1|1772854_1773484_+	T3SS secreted effector NleG	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
BBF47390.1|1773565_1774207_+	T3SS secreted effector NleG	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
BBF47391.1|1774787_1775222_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
BBF47392.1|1775362_1776496_-	outer membrane pore protein	NA	Q1MVN1	Enterobacteria_phage	58.3	1.2e-116
>prophage 12
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	1974606	1992665	5470440		Escherichia_phage(44.44%)	23	NA	NA
BBF47568.1|1974606_1974810_+	selenoprotein	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
BBF47569.1|1974845_1976306_-	NAD-dependent D-mannonate oxidoreductase	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
BBF47570.1|1976394_1977678_-	transport protein	NA	NA	NA	NA	NA
BBF47571.1|1977737_1978052_+	DNA damage-inducible protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
BBF47572.1|1978584_1979298_+	T3SS secreted effector NleG	NA	B6ETE1	Enterobacteria_phage	99.1	1.3e-121
BBF47573.1|1979522_1980398_-	T3SS secreted effector OspB	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
BBF47574.1|1980538_1980808_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	100.0	6.4e-45
BBF47575.1|1980809_1982615_-	hypothetical protein	NA	H6WZJ9	Escherichia_phage	96.8	0.0e+00
BBF47576.1|1982929_1983097_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	70.6	5.4e-10
BBF47577.1|1983093_1983240_-	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	95.8	6.8e-17
BBF47578.1|1984141_1984831_-	phage late gene regulator Q	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
BBF47579.1|1984827_1985193_-	phage endonuclease RUS	NA	V5URS4	Shigella_phage	67.5	1.6e-38
BBF47580.1|1985193_1986249_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
BBF47581.1|1986250_1986529_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.8e-11
BBF47582.1|1986598_1986856_-	putative phage protein	NA	NA	NA	NA	NA
BBF47583.1|1987076_1987289_-	phage maintenance protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
BBF47584.1|1987567_1988326_-	porcine attaching-effacing associated protein Paa/adherence factor AdfO	NA	NA	NA	NA	NA
BBF47585.1|1989024_1989189_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47586.1|1989185_1989920_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
BBF47587.1|1989953_1990376_-	phage replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
BBF47588.1|1990407_1991448_-	phage replication protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
BBF47589.1|1991419_1991971_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47590.1|1992257_1992665_+	regulator for DicB	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
>prophage 13
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	1997952	2063101	5470440	integrase,terminase,transposase,protease,holin,head,tail,portal	Stx2-converting_phage(35.19%)	77	2031368:2031384	2070617:2070633
BBF47598.1|1997952_1999083_+|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
BBF47599.1|1999128_1999767_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
BBF47600.1|2000123_2000867_+	inner membrane protein	NA	NA	NA	NA	NA
BBF47601.1|2000896_2001436_+	intracellular septation protein A	NA	NA	NA	NA	NA
BBF47602.1|2001540_2001939_+	acyl-CoA esterase	NA	NA	NA	NA	NA
BBF47603.1|2001978_2002734_-	periplasmic protein TonB	NA	NA	NA	NA	NA
BBF47604.1|2002788_2003142_+	phage recombinase	NA	NA	NA	NA	NA
BBF47605.1|2003490_2004141_-	T3SS secreted effector NleG	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
BBF47606.1|2005647_2006238_-	T3SS secreted effector EspM	NA	NA	NA	NA	NA
BBF47607.1|2006421_2007069_+	T3SS secreted effector NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
BBF47608.1|2007823_2008093_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47609.1|2008544_2008892_+	hypothetical protein	NA	A0A218MNI5	uncultured_virus	51.5	2.1e-11
BBF47610.1|2009084_2009411_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF47611.1|2009410_2010298_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF47612.1|2010419_2010779_-	T3SS secreted effector NleF	NA	NA	NA	NA	NA
BBF47613.1|2010844_2011756_-	T3SS secreted effector NleH	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
BBF47614.1|2012229_2012622_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	88.9	8.2e-57
BBF47615.1|2013099_2013369_-	hypothetical protein	NA	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
BBF47616.1|2013370_2014675_-|tail	phage tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	95.4	1.2e-72
BBF47617.1|2014826_2015426_-	outer membrane precursor Lom	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
BBF47618.1|2015493_2018967_-	phage host specificity protein	NA	A0A0P0ZBW1	Stx2-converting_phage	90.1	0.0e+00
BBF47619.1|2019309_2019891_-|tail	phage tail assembly protein	tail	H6WZM5	Escherichia_phage	97.4	7.5e-91
BBF47620.1|2019887_2020631_-|tail	phage tail assembly protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.1e-147
BBF47621.1|2020636_2021335_-|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
BBF47622.1|2021334_2021676_-|tail	phage minor tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
BBF47623.1|2021668_2023111_-|tail	phage tail length tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	5.1e-229
BBF47624.1|2023129_2023495_+|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF47625.1|2023494_2024682_+|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF47626.1|2024861_2026739_-|tail	phage tail length tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.5	5.9e-278
BBF47627.1|2026790_2027000_-|tail	phage minor tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
BBF47628.1|2027095_2027470_-|tail	phage tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	5.0e-64
BBF47629.1|2027475_2028192_-|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	95.8	1.3e-124
BBF47630.1|2028258_2028603_-|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
BBF47631.1|2028599_2029046_-|tail	phage minor tail protein	tail	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
BBF47632.1|2029042_2029393_-|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BBF47633.1|2029402_2029729_-	phage DNA packaging protein	NA	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
BBF47634.1|2029731_2032311_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.8	0.0e+00
2031368:2031384	attL	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
BBF47635.1|2032256_2032478_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
BBF47636.1|2032522_2034460_-|head,protease	phage prohead protease	head,protease	H6WZL0	Escherichia_phage	99.7	0.0e+00
BBF47637.1|2034523_2036185_-|terminase	phage terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
BBF47638.1|2036181_2036745_-|terminase	phage terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
BBF47639.1|2037034_2037400_-	DNase	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
BBF47640.1|2037441_2037669_+	hypothetical protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
BBF47641.1|2038037_2038262_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47642.1|2038258_2038753_-	endopeptidase	NA	Q9ZXB6	Enterobacteria_phage	93.8	4.0e-77
BBF47643.1|2039050_2039584_-	phage endolysin	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
BBF47644.1|2039634_2039979_-	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
BBF47645.1|2039983_2040190_-|holin	phage holine protein	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
BBF47646.1|2040635_2042486_-	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
BBF47647.1|2042933_2043065_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
BBF47648.1|2043324_2043651_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF47649.1|2043650_2044538_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF47650.1|2044804_2045494_-	phage antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.1	5.5e-56
BBF47651.1|2045624_2046512_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	99.3	4.0e-168
BBF47652.1|2046511_2046838_-|transposase	IS629 transposase OrfA	transposase	Q6H9S4	Enterobacteria_phage	97.2	4.1e-54
BBF47653.1|2046889_2047138_-	phage exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	84.8	2.3e-28
BBF47654.1|2047176_2048142_-	replication protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
BBF47655.1|2048122_2048644_-	phage regulatory protein CII	NA	NA	NA	NA	NA
BBF47656.1|2048627_2048855_-	phage antirepressor protein Cro	NA	NA	NA	NA	NA
BBF47657.1|2048932_2049340_+	phage repressor CI	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
BBF47658.1|2049532_2049685_+	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
BBF47659.1|2049696_2050062_+	hypothetical protein	NA	NA	NA	NA	NA
BBF47660.1|2050030_2050231_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47661.1|2050733_2050922_+	cell division inhibition protein	NA	NA	NA	NA	NA
BBF47662.1|2050918_2051110_+	hypothetical protein	NA	NA	NA	NA	NA
BBF47663.1|2051203_2053675_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
BBF47664.1|2053762_2053999_+	phage excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
BBF47665.1|2054033_2055314_+|integrase	integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
BBF47666.1|2055333_2055444_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47667.1|2055501_2056521_-	Zn-dependent NAD(P)-binding oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
BBF47668.1|2056532_2057747_-	bifunctional D-altronate/D-mannonate dehydratase	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
BBF47669.1|2057952_2058279_-	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
BBF47670.1|2058413_2058755_+	periplasmic protein	NA	NA	NA	NA	NA
BBF47671.1|2058789_2059350_+	spermidine N(1)-acetyltransferase	NA	NA	NA	NA	NA
BBF47672.1|2059352_2060099_-	lipoprotein	NA	NA	NA	NA	NA
BBF47673.1|2060170_2060476_+	hypothetical protein	NA	NA	NA	NA	NA
BBF47674.1|2060674_2063101_+	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
2070617:2070633	attR	TGCTGCTCCAGCGCCTC	NA	NA	NA	NA
>prophage 14
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	2195230	2236952	5470440	integrase,terminase,transposase,holin,capsid,plate,tail,portal,tRNA	Enterobacteria_phage(81.58%)	49	2197633:2197657	2229593:2229617
BBF47798.1|2195230_2195980_-	vitamin B12 ABC transporter ATPase	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
BBF47799.1|2195979_2196531_-	glutathione peroxidase	NA	NA	NA	NA	NA
BBF47800.1|2196593_2197574_-	vitamin B12 ABC transporter permease	NA	NA	NA	NA	NA
2197633:2197657	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
BBF47801.1|2197763_2198159_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47802.1|2198169_2198871_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	47.0	4.1e-59
BBF47803.1|2199158_2199437_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
BBF47804.1|2199448_2199691_+	hypothetical protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
BBF47805.1|2199755_2200637_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	92.6	1.9e-114
BBF47806.1|2200822_2202133_+	replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	6.4e-247
BBF47807.1|2202209_2203169_+	plasmid partition protein	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
BBF47808.1|2203173_2203485_+	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
BBF47809.1|2203849_2204119_+	hypothetical protein	NA	NA	NA	NA	NA
BBF47810.1|2204681_2205206_+	hypothetical protein	NA	NA	NA	NA	NA
BBF47811.1|2205220_2206267_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
BBF47812.1|2206266_2208018_-|terminase	phage terminase large subunit	terminase	A0A0A7NV54	Enterobacteria_phage	95.0	0.0e+00
BBF47813.1|2208172_2209009_+	phage scaffolding protein	NA	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
BBF47814.1|2209032_2210085_+|capsid	phage major capsid protein	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
BBF47815.1|2210130_2210931_+|terminase	phage terminase small subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
BBF47816.1|2211033_2211528_+|capsid	phage capsid completion protein	capsid	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
BBF47817.1|2211527_2211728_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
BBF47818.1|2211730_2212054_+|holin	phage holin protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
BBF47819.1|2212050_2212443_+	phage endolysin	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
BBF47820.1|2212439_2212847_+	hypothetical protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
BBF47821.1|2212984_2213452_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
BBF47822.1|2213435_2214080_+|tail	phage tail completion protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
BBF47823.1|2214076_2214658_+|plate	phage baseplate assembly protein	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
BBF47824.1|2214654_2215005_+|plate	phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
BBF47825.1|2215008_2215905_+|plate	phage baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
BBF47826.1|2215897_2216428_+|tail	phage tail protein	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
BBF47827.1|2216430_2218563_+|tail	phage side tail fiber protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
BBF47828.1|2218562_2219141_+|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
BBF47829.1|2219184_2219757_-	hypothetical protein	NA	NA	NA	NA	NA
BBF47830.1|2219913_2220402_-|tail	phage tail assembly protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.0e-85
BBF47831.1|2220414_2223222_-|tail	phage tail protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
BBF47832.1|2223372_2223747_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
BBF47833.1|2223802_2224189_-|tail	phage tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.7	5.6e-66
BBF47834.1|2224185_2224314_-|tail	phage tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	8.6e-16
BBF47835.1|2224313_2225498_-|tail	phage tail sheath protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
BBF47836.1|2225655_2226765_+	phage late gene regulator	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
BBF47837.1|2226990_2228493_+	hypothetical protein	NA	NA	NA	NA	NA
BBF47838.1|2228736_2228997_+	phage regulatory protein	NA	NA	NA	NA	NA
BBF47839.1|2229187_2229328_+	hypothetical protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
BBF47840.1|2229634_2229934_-	integration host factor DNA-binding protein alpha subunit	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2229593:2229617	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
BBF47841.1|2229938_2232326_-|tRNA	phenylalanine tRNA synthetase beta subunit	tRNA	NA	NA	NA	NA
BBF47842.1|2232340_2233324_-|tRNA	phenylalanine tRNA synthetase alpha subunit	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
BBF47843.1|2233774_2234131_-	50S ribosomal subunit protein L20	NA	NA	NA	NA	NA
BBF47844.1|2234183_2234381_-	50S ribosomal subunit protein L35	NA	NA	NA	NA	NA
BBF47845.1|2234477_2234912_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.8	6.1e-13
BBF47846.1|2235023_2236952_-|tRNA	threonyl-tRNA synthetase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 15
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	2456407	2544474	5470440	integrase,terminase,transposase,protease,holin,head,tail,portal	Enterobacteria_phage(33.33%)	107	2518712:2518736	2548824:2548848
BBF48064.1|2456407_2457556_-|transposase	IS609 transposase	transposase	A0A1W6JP07	Morganella_phage	97.4	1.3e-206
BBF48065.1|2457623_2457911_+|transposase	IS609 transposase	transposase	A0A1S5RHE3	Helicobacter_phage	66.7	3.1e-29
BBF48066.1|2459007_2459805_-	transcriptional regulator	NA	NA	NA	NA	NA
BBF48067.1|2459814_2460366_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48068.1|2460534_2460867_-	multidrug resistance protein	NA	NA	NA	NA	NA
BBF48069.1|2461200_2461515_-	flagellar basal-body component	NA	NA	NA	NA	NA
BBF48070.1|2461728_2463387_+	flagellar basal-body MS-ring and collar protein	NA	NA	NA	NA	NA
BBF48071.1|2463379_2464375_+	flagellar motor switching and energizing component	NA	NA	NA	NA	NA
BBF48072.1|2464367_2465054_+	negative regulator of FliI ATPase activity	NA	NA	NA	NA	NA
BBF48073.1|2465053_2466427_+	flagellum-specific ATP synthase	NA	NA	NA	NA	NA
BBF48074.1|2466445_2466889_+	flagellar protein	NA	NA	NA	NA	NA
BBF48075.1|2466885_2468013_+	flagellar hook-length control protein	NA	NA	NA	NA	NA
BBF48076.1|2468117_2468582_+	flagellar biosynthesis protein	NA	NA	NA	NA	NA
BBF48077.1|2468586_2469591_+	flagellar motor switching and energizing component	NA	NA	NA	NA	NA
BBF48078.1|2469587_2470001_+	flagellar motor switching and energizing component	NA	NA	NA	NA	NA
BBF48079.1|2470003_2470369_+	flagellar biosynthesis protein	NA	NA	NA	NA	NA
BBF48080.1|2470368_2471106_+	flagellar biosynthesis protein	NA	NA	NA	NA	NA
BBF48081.1|2471115_2471385_+	flagellar biosynthesis protein	NA	NA	NA	NA	NA
BBF48082.1|2471392_2472178_+	flagellar export pore protein	NA	NA	NA	NA	NA
BBF48083.1|2472467_2473091_+	transcriptional regulator	NA	NA	NA	NA	NA
BBF48084.1|2473134_2473323_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48085.1|2473485_2473713_+	hypothetical protein	NA	NA	NA	NA	NA
BBF48086.1|2474010_2474826_+	mannosyl-3-phosphoglycerate phosphatase	NA	NA	NA	NA	NA
BBF48087.1|2474822_2476517_-	membrane-anchored diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
BBF48088.1|2476687_2476870_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48089.1|2476948_2477866_-	inner membrane protein	NA	NA	NA	NA	NA
BBF48090.1|2478038_2478959_+	amino acid exporter for phenylalanine	NA	NA	NA	NA	NA
BBF48091.1|2478947_2479418_-	DNA mismatch endonuclease of very short patch repair	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
BBF48092.1|2479398_2480817_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
BBF48093.1|2480883_2481579_-	HD superfamily phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
BBF48094.1|2481618_2481921_-	inner membrane protein	NA	NA	NA	NA	NA
BBF48095.1|2482550_2483714_+	outer membrane pore protein	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
BBF48096.1|2484304_2485156_+	heat shock protein Hsp31	NA	NA	NA	NA	NA
BBF48097.1|2485263_2486622_-	two-component system sensor histidine kinase YedV	NA	NA	NA	NA	NA
BBF48098.1|2486621_2487404_-	response regulator	NA	W8CYM9	Bacillus_phage	35.2	4.8e-32
BBF48099.1|2487425_2487839_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
BBF48100.1|2487947_2488952_+	reductase	NA	NA	NA	NA	NA
BBF48101.1|2488952_2489588_+	inner membrane heme subunit for periplasmic YedYZ reductase	NA	NA	NA	NA	NA
BBF48102.1|2489823_2490495_+	zinc and cadmium binding protein	NA	NA	NA	NA	NA
BBF48103.1|2490837_2491368_+	cytochrome	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
BBF48104.1|2492602_2493589_-	T3SS secreted effector NleC	NA	NA	NA	NA	NA
BBF48105.1|2494021_2494291_-	hypothetical protein	NA	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
BBF48106.1|2494292_2495606_-|tail	phage tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
BBF48107.1|2495670_2496270_-	outer membrane precursor Lom	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
BBF48108.1|2496337_2499814_-	phage host specificity protein	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
BBF48109.1|2500060_2500642_-|tail	phage tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.4	7.3e-94
BBF48110.1|2500638_2501382_-|tail	phage tail assembly protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
BBF48111.1|2501387_2502086_-|tail	phage minor tail protein	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
BBF48112.1|2502085_2502415_-|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BBF48113.1|2502411_2505024_-|tail	phage tail length tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
BBF48114.1|2505004_2505418_-|tail	phage minor tail protein	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
BBF48115.1|2505444_2505867_-|tail	phage minor tail protein	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
BBF48116.1|2505880_2506633_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
BBF48117.1|2506640_2507036_-|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
BBF48118.1|2507032_2507566_-|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
BBF48119.1|2507581_2507935_-|head,tail	phage head-tail adaptor protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
BBF48120.1|2507927_2508311_-	phage DNA packaging protein	NA	NA	NA	NA	NA
BBF48121.1|2508362_2509391_-|head	phage head protein	head	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
BBF48122.1|2509448_2509796_-|head	phage head-DNA stabilization protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
BBF48123.1|2509832_2511338_-|head,protease	phage prohead protease	head,protease	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
BBF48124.1|2511327_2512920_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
BBF48125.1|2512916_2513123_-|head,tail	phage head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
BBF48126.1|2513106_2515035_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
BBF48127.1|2515006_2515618_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	47.3	8.9e-34
BBF48128.1|2516245_2516560_-	PchABC family transcriptional regulator	NA	NA	NA	NA	NA
BBF48129.1|2517024_2517492_-	phage endopeptidase	NA	Q7AYI6	Enterobacteria_phage	89.0	5.5e-68
BBF48130.1|2517789_2518323_-	phage endolysin	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
BBF48131.1|2518365_2518788_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	8.5e-52
2518712:2518736	attL	TGAACCGCCCCGGGTTTCCTGGAGA	NA	NA	NA	NA
BBF48132.1|2518753_2519641_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	99.7	3.6e-169
BBF48133.1|2519640_2519967_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF48134.1|2520045_2520195_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48135.1|2520198_2520414_-|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
BBF48136.1|2520490_2520763_-	hypothetical protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
BBF48137.1|2520803_2520983_-	hypothetical protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
BBF48138.1|2521120_2523058_-	hypothetical protein	NA	Q6H9W1	Enterobacteria_phage	96.4	0.0e+00
BBF48139.1|2523372_2523540_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	70.6	5.4e-10
BBF48140.1|2523536_2523968_-	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
BBF48141.1|2524055_2524481_+|transposase	ISEc23 transposase	transposase	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
BBF48142.1|2524477_2524828_+|transposase	ISEc23 transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
BBF48143.1|2524858_2526472_+|transposase	ISEc23 transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
BBF48144.1|2526957_2527545_-	phage regulatory protein	NA	NA	NA	NA	NA
BBF48145.1|2527805_2528003_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
BBF48146.1|2528226_2528781_-	phage antiterminator	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
BBF48147.1|2528789_2529149_-	phage endonuclease RUS	NA	V5URS4	Shigella_phage	63.5	5.0e-37
BBF48148.1|2529161_2530211_-	hypothetical protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
BBF48149.1|2530212_2530485_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
BBF48150.1|2530606_2530951_-	hypothetical protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
BBF48151.1|2531070_2531283_-	regulatory protein MokC for HokC	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
BBF48152.1|2531516_2532074_-	putative phage protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
BBF48153.1|2532075_2532294_-	hypothetical protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
BBF48154.1|2532421_2532733_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
BBF48155.1|2532725_2532953_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
BBF48156.1|2532949_2533231_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
BBF48157.1|2533263_2533980_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
BBF48158.1|2534001_2534748_-	phage DNA replication protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
BBF48159.1|2534754_2535825_-	phage replication protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
BBF48160.1|2535896_2536322_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48161.1|2536305_2536587_-	phage antirepressor protein Cro	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
BBF48162.1|2536686_2537106_+	phage repressor protein CI	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
BBF48163.1|2537290_2537524_+	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	2.7e-07
BBF48164.1|2537535_2538174_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
BBF48165.1|2538174_2538384_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48166.1|2538954_2539143_+	cell division inhibition protein	NA	NA	NA	NA	NA
BBF48167.1|2539139_2539331_+	hypothetical protein	NA	NA	NA	NA	NA
BBF48168.1|2539423_2541811_+	exonuclease	NA	A0A192Y7M7	Salmonella_phage	63.8	5.9e-81
BBF48169.1|2542046_2542844_+	anti-repressor for DgsA	NA	NA	NA	NA	NA
BBF48170.1|2543199_2544474_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
2548824:2548848	attR	TGAACCGCCCCGGGTTTCCTGGAGA	NA	NA	NA	NA
>prophage 16
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	2605517	2612537	5470440	transposase	Shigella_phage(50.0%)	8	NA	NA
BBF48237.1|2605517_2606636_-	GDP-D-mannose dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	65.7	5.6e-135
BBF48238.1|2606686_2607760_-	glycosyl transferase	NA	NA	NA	NA	NA
BBF48239.1|2608345_2609239_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	40.3	4.3e-45
BBF48240.1|2609344_2610250_-|transposase	IS2 transposase	transposase	Q9ZXG3	Shigella_phage	99.0	4.1e-176
BBF48241.1|2610207_2610573_-|transposase	IS2 transposase	transposase	Q76S41	Shigella_phage	99.2	1.1e-58
BBF48242.1|2610661_2611582_-|transposase	IS30 transposase	transposase	NA	NA	NA	NA
BBF48243.1|2611538_2611907_-|transposase	IS911 transposase	transposase	Q716C1	Shigella_phage	97.7	6.1e-38
BBF48244.1|2611976_2612537_-	GDP-D-mannose dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	75.0	5.6e-75
>prophage 17
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	2691556	2700995	5470440		Enterobacteria_phage(87.5%)	11	NA	NA
BBF48311.1|2691556_2692693_+	VMA domain YehL ATPase stimulator	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
BBF48312.1|2692689_2694489_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
BBF48313.1|2694451_2694688_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.2	2.1e-36
BBF48314.1|2694812_2695274_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	7.1e-76
BBF48315.1|2695313_2695784_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
BBF48316.1|2695830_2696550_-	two-component regulatory system response regulator YehT	NA	NA	NA	NA	NA
BBF48317.1|2696546_2698232_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
BBF48318.1|2698453_2699185_+	transcriptional activator of csgD and csgBA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
BBF48319.1|2699244_2699352_+	membrane protein	NA	NA	NA	NA	NA
BBF48320.1|2699332_2700064_-	ABC transporter permease	NA	NA	NA	NA	NA
BBF48321.1|2700068_2700995_-	transporter subunit: ATP-binding component of ABC superfamily protein	NA	G9BWD6	Planktothrix_phage	34.6	1.3e-23
>prophage 18
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	2769998	2833786	5470440	integrase,terminase,transposase,protease,holin,head	Enterobacteria_phage(18.52%)	65	2807940:2807975	2839808:2839843
BBF48383.1|2769998_2771240_+|integrase	integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.6e-98
BBF48384.1|2771736_2771943_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
BBF48385.1|2773003_2773309_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48386.1|2773505_2773706_+	hypothetical protein	NA	NA	NA	NA	NA
BBF48387.1|2773702_2774161_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	2.6e-06
BBF48388.1|2774133_2774367_+	hypothetical protein	NA	NA	NA	NA	NA
BBF48389.1|2774359_2774593_+	hypothetical protein	NA	NA	NA	NA	NA
BBF48390.1|2774598_2774898_+	hypothetical protein	NA	NA	NA	NA	NA
BBF48391.1|2774894_2776295_+	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
BBF48392.1|2776311_2776500_+	hypothetical protein	NA	NA	NA	NA	NA
BBF48393.1|2776496_2776742_+	hypothetical protein	NA	NA	NA	NA	NA
BBF48394.1|2776872_2777067_+	hypothetical protein	NA	NA	NA	NA	NA
BBF48395.1|2777070_2777232_+	hypothetical protein	NA	NA	NA	NA	NA
BBF48396.1|2777359_2777848_+|terminase	phage terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
BBF48397.1|2777859_2778021_+	hypothetical protein	NA	NA	NA	NA	NA
BBF48398.1|2778007_2778934_+|head,protease	phage head protease	head,protease	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
BBF48399.1|2779669_2781991_-	autotransporter outer membrane protein	NA	NA	NA	NA	NA
BBF48400.1|2782310_2782958_+	two-component regulatory system response regulator NarP	NA	NA	NA	NA	NA
BBF48401.1|2782992_2784045_-	heme lyase subunit CcmH	NA	NA	NA	NA	NA
BBF48402.1|2784041_2784599_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
BBF48403.1|2784595_2786539_-	heme lyase subunit CcmF	NA	NA	NA	NA	NA
BBF48404.1|2786535_2787015_-	cytochrome c-type biogenesis protein CcmE	NA	NA	NA	NA	NA
BBF48405.1|2787011_2787221_-	cytochrome c biogenesis protein	NA	NA	NA	NA	NA
BBF48406.1|2787217_2787955_-	heme export ABC transporter permease	NA	NA	NA	NA	NA
BBF48407.1|2787996_2788659_-	heme export ABC transporter permease	NA	NA	NA	NA	NA
BBF48408.1|2788655_2789273_-	heme export ABC transporter ATPase	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
BBF48409.1|2789291_2789894_-	quinol dehydrogenase	NA	NA	NA	NA	NA
BBF48410.1|2789903_2790353_-	cytochrome c-type protein NapB	NA	NA	NA	NA	NA
BBF48411.1|2790349_2791213_-	ferredoxin-type protein	NA	NA	NA	NA	NA
BBF48412.1|2791199_2791895_-	ferredoxin-type protein	NA	NA	NA	NA	NA
BBF48413.1|2791901_2794388_-	periplasmic nitrate reductase NapA	NA	NA	NA	NA	NA
BBF48414.1|2794384_2794648_-	nitrate reductase	NA	NA	NA	NA	NA
BBF48415.1|2794637_2795132_-	ferredoxin-type protein	NA	NA	NA	NA	NA
BBF48416.1|2795240_2795405_+	hypothetical protein	NA	NA	NA	NA	NA
BBF48417.1|2795540_2796029_+	ecotin	NA	NA	NA	NA	NA
BBF48418.1|2796177_2797824_-	malate dehydrogenase	NA	NA	NA	NA	NA
BBF48419.1|2798041_2799685_-	microcin J25 efflux ABC transporter permease/ATPase	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
BBF48420.1|2799760_2800411_-	oxidative demethylase of N1-methyladenine or N3-methylcytosine DNA lesions	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
BBF48421.1|2800410_2801475_-	bifunctional transcriptional activator/DNA repair enzyme Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
BBF48422.1|2801548_2802604_-	thiamine-synthetic flavin transferase lipoprotein	NA	NA	NA	NA	NA
BBF48423.1|2802715_2803807_-	outer membrane porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
BBF48424.1|2804545_2807218_+	phosphotransfer intermediate protein in two-component regulatory system with RcsBC	NA	NA	NA	NA	NA
BBF48425.1|2807234_2807885_+	two-component regulatory system response regulator RcsB	NA	NA	NA	NA	NA
2807940:2807975	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
BBF48426.1|2808084_2810934_-	hybrid sensory kinase in two-component regulatory system with RcsB and YojN	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
BBF48427.1|2811208_2811985_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48428.1|2811989_2813639_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48429.1|2813639_2818244_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
BBF48430.1|2818835_2820158_+	T3SS secreted effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
BBF48431.1|2820851_2821385_-	T3SS secreted effector NleG	NA	B6DZC0	Enterobacteria_phage	42.0	6.4e-28
BBF48432.1|2821527_2821854_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF48433.1|2821853_2822741_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF48434.1|2822780_2823305_-	hypothetical protein	NA	A0A0N7CEE8	Salmonella_phage	89.7	1.2e-84
BBF48435.1|2823454_2823892_-	phage murein endopeptidase	NA	A0A0P0ZBQ9	Stx2-converting_phage	97.9	5.0e-71
BBF48436.1|2823888_2824386_-	phage lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
BBF48437.1|2824385_2824601_-|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
BBF48438.1|2825663_2826221_-	membrane protein	NA	NA	NA	NA	NA
BBF48439.1|2826473_2827097_-	phage antitermination protein Q	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
BBF48440.1|2827093_2827759_-	serine/threonine-specific protein phosphatase 1	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
BBF48441.1|2827755_2828358_-	recombination endonuclease	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
BBF48442.1|2828332_2828899_-	hypothetical protein	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
BBF48443.1|2828891_2829008_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48444.1|2829392_2830361_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.3e-151
BBF48445.1|2830399_2831227_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
BBF48446.1|2832069_2832414_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
BBF48447.1|2832715_2833786_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
2839808:2839843	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 19
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	2927543	3061775	5470440	integrase,terminase,transposase,protease,capsid,head,tail,lysis,portal,tRNA	Escherichia_phage(60.34%)	159	2959096:2959119	3061971:3061994
BBF48534.1|2927543_2928356_-|tRNA	tRNA pseudouridine(38-40) synthase	tRNA	NA	NA	NA	NA
BBF48535.1|2928355_2929369_-	semialdehyde dehydrogenase	NA	NA	NA	NA	NA
BBF48536.1|2929434_2930571_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
BBF48537.1|2930669_2931665_+	flagella assembly protein	NA	NA	NA	NA	NA
BBF48538.1|2931661_2932840_-	arabinose efflux transporter	NA	NA	NA	NA	NA
BBF48539.1|2933123_2934344_-	3-oxoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
BBF48540.1|2934502_2936509_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
BBF48541.1|2936629_2936908_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48542.1|2936941_2937490_-	elongation factor	NA	NA	NA	NA	NA
BBF48543.1|2937489_2938299_-	TauE/TSUP family inner membrane protein	NA	NA	NA	NA	NA
BBF48544.1|2938298_2939123_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
BBF48545.1|2939126_2940212_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
BBF48546.1|2940246_2941179_-	adenine-specific methylase	NA	NA	NA	NA	NA
BBF48547.1|2941344_2941896_+	DNA endonuclease	NA	NA	NA	NA	NA
BBF48548.1|2941968_2942820_-	outer membrane protein	NA	NA	NA	NA	NA
BBF48549.1|2942821_2943361_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF48550.1|2943357_2943846_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF48551.1|2943842_2944352_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF48552.1|2944367_2945120_-	periplasmic pilin chaperone	NA	NA	NA	NA	NA
BBF48553.1|2945139_2947785_-	outer membrane usher protein	NA	NA	NA	NA	NA
BBF48554.1|2947866_2948430_-	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
BBF48555.1|2949113_2949599_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
BBF48556.1|2949801_2951946_-	fatty acid oxidation complex subunit alpha	NA	NA	NA	NA	NA
BBF48557.1|2951945_2953256_-	beta-ketoacyl-CoA thiolase	NA	NA	NA	NA	NA
BBF48558.1|2953435_2953720_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48559.1|2954091_2955432_+	long-chain fatty acid outer membrane transporter	NA	NA	NA	NA	NA
BBF48560.1|2955798_2956857_+	hypothetical protein	NA	NA	NA	NA	NA
BBF48561.1|2957038_2957794_-	phospholipid-binding lipoprotein	NA	NA	NA	NA	NA
BBF48562.1|2958087_2959020_+	inner membrane protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
2959096:2959119	attL	GTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
BBF48563.1|2959241_2967596_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	96.8	0.0e+00
BBF48564.1|2967665_2968931_-	hypothetical protein	NA	Q08J71	Stx2-converting_phage	100.0	1.7e-204
BBF48565.1|2968941_2969193_-	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
BBF48566.1|2969203_2969650_-	hypothetical protein	NA	Q08J73	Stx2-converting_phage	100.0	1.1e-76
BBF48567.1|2969652_2970306_-	hypothetical protein	NA	Q08J74	Stx2-converting_phage	100.0	9.3e-114
BBF48568.1|2970399_2970801_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	100.0	7.0e-72
BBF48569.1|2970857_2970998_-	hypothetical protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
BBF48570.1|2971230_2971968_-	outer membrane precursor protein Lom	NA	A0A2L1IV31	Escherichia_phage	81.2	1.1e-110
BBF48571.1|2972047_2972665_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	3.7e-120
BBF48572.1|2972670_2972949_-	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
BBF48573.1|2972963_2974232_-|tail	phage tail fiber protein	tail	A0A2R2Z364	Escherichia_phage	99.5	7.1e-219
BBF48574.1|2974228_2975854_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	99.3	0.0e+00
BBF48575.1|2976148_2976337_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
BBF48576.1|2976476_2976725_-	hypothetical protein	NA	A0A1I9LJT0	Stx_converting_phage	100.0	2.3e-41
BBF48577.1|2976779_2977667_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF48578.1|2977666_2977993_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF48579.1|2978060_2979998_-|tail	phage tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
BBF48580.1|2979994_2980645_-	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
BBF48581.1|2980644_2981208_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
BBF48582.1|2981191_2981653_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	99.3	3.0e-74
BBF48583.1|2981702_2982092_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
BBF48584.1|2982147_2983362_-|capsid	phage major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
BBF48585.1|2983385_2984393_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
BBF48586.1|2984550_2986695_-|portal	phage portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
BBF48587.1|2986694_2988401_-|terminase	phage terminase large subunit	terminase	G9L6K0	Escherichia_phage	100.0	0.0e+00
BBF48588.1|2988381_2989188_-|terminase	phage terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
BBF48589.1|2989596_2989890_+	Bor protein precursor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
BBF48590.1|2989921_2990386_-	endopeptidase	NA	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
BBF48591.1|2990393_2990543_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
BBF48592.1|2990542_2991112_-	phage antirepressor	NA	A0A2R2Z339	Escherichia_phage	98.9	3.4e-104
BBF48593.1|2991382_2991916_-	phage endolysin	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
BBF48594.1|2991920_2992136_-|lysis	phage lysis protein	lysis	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
BBF48595.1|2992212_2992458_-	hypothetical protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
BBF48596.1|2992814_2994752_-	hypothetical protein	NA	A0A0P0ZGE0	Escherichia_phage	99.2	0.0e+00
BBF48597.1|2995987_2997082_-	restriction enzyme BgcI subunit beta	NA	NA	NA	NA	NA
BBF48598.1|2997141_2999103_-	type I restriction-modification enzyme M subunit	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	36.7	6.3e-81
BBF48599.1|2999593_2999749_-	regulatory protein MokC for HokC	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.6e-16
BBF48600.1|2999948_3000374_-	antiterminator	NA	Q777W5	Enterobacteria_phage	73.2	1.2e-53
BBF48601.1|3000366_3000567_-	hypothetical protein	NA	G9L694	Escherichia_phage	92.4	1.2e-27
BBF48602.1|3000563_3001127_-	recombination endonuclease	NA	A0A0P0ZG59	Escherichia_phage	98.4	1.3e-103
BBF48603.1|3001134_3001389_-	hypothetical protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	3.1e-33
BBF48604.1|3001477_3002215_-	DNA modification protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
BBF48605.1|3002483_3002948_+	hypothetical protein	NA	NA	NA	NA	NA
BBF48606.1|3002986_3003232_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48607.1|3003267_3003450_-	hypothetical protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
BBF48608.1|3003596_3005636_-	hypothetical protein	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
BBF48609.1|3005735_3006296_-	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
BBF48610.1|3006800_3007364_+|tail	phage tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.5	1.3e-42
BBF48611.1|3007355_3007511_-|tail	phage tail fiber	tail	A0A0U2SAV1	Escherichia_phage	73.5	8.8e-15
BBF48612.1|3007590_3008265_-|tail	phage tail fiber	tail	C9DGQ8	Escherichia_phage	43.8	4.3e-37
BBF48613.1|3008264_3008825_-|tail	phage tail protein	tail	C9DGQ7	Escherichia_phage	48.1	2.3e-44
BBF48614.1|3008815_3009898_-	hypothetical protein	NA	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
BBF48615.1|3009897_3010335_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
BBF48616.1|3010327_3010942_-	hypothetical protein	NA	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
BBF48617.1|3010931_3012056_-|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	48.5	6.5e-91
BBF48618.1|3012039_3013389_-	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
BBF48619.1|3013375_3015451_-	phage tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	6.2e-71
BBF48620.1|3015577_3016054_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
BBF48621.1|3016068_3016434_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
BBF48622.1|3016442_3017945_-|tail	phage tail sheath protein	tail	C9DGP7	Escherichia_phage	51.5	1.5e-138
BBF48623.1|3017941_3018187_-	hypothetical protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
BBF48624.1|3018187_3018748_-	hypothetical protein	NA	A0A0C4UQU7	Shigella_phage	48.3	1.6e-42
BBF48625.1|3018744_3019164_-	hypothetical protein	NA	A0A0C4UR02	Shigella_phage	53.6	1.8e-33
BBF48626.1|3019160_3019544_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48627.1|3019587_3020535_-|head	phage major head subunit	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
BBF48628.1|3020534_3021659_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	7.5e-79
BBF48629.1|3021835_3022309_-	phage morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	6.0e-38
BBF48630.1|3022430_3023762_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.0	1.6e-152
BBF48631.1|3023745_3025335_-	hypothetical protein	NA	A0A0C4UQR8	Shigella_phage	57.7	8.5e-169
BBF48632.1|3025334_3026999_-|portal	phage portal protein	portal	A0A0C4UR29	Shigella_phage	73.0	2.0e-229
BBF48633.1|3026998_3027580_-	hypothetical protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
BBF48634.1|3027582_3027873_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.4e-24
BBF48635.1|3027865_3028177_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48636.1|3028157_3028451_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48637.1|3028597_3029098_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48638.1|3029060_3029561_-	phage lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
BBF48639.1|3029632_3030058_-	transcription regulator	NA	NA	NA	NA	NA
BBF48640.1|3030127_3030637_-	hypothetical protein	NA	A0A0C4UQU3	Shigella_phage	42.4	5.1e-27
BBF48641.1|3030633_3030930_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48642.1|3030919_3031117_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
BBF48643.1|3031109_3031442_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48644.1|3031457_3031826_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48645.1|3031822_3032134_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48646.1|3032130_3032679_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48647.1|3032685_3033201_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	54.2	6.5e-46
BBF48648.1|3033200_3033734_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.8	2.8e-68
BBF48649.1|3033737_3034280_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
BBF48650.1|3034377_3034908_-	host-nuclease inhibitor protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
BBF48651.1|3034919_3035213_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48652.1|3035217_3035490_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48653.1|3035486_3035768_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
BBF48654.1|3035769_3036024_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48655.1|3036036_3036258_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48656.1|3036260_3037193_-	DNA transposition protein	NA	A0A0C4UQR3	Shigella_phage	48.7	3.1e-70
BBF48657.1|3037264_3039355_-	DNA transposition protein	NA	A0A2D1GNK9	Pseudomonas_phage	47.4	6.8e-166
BBF48658.1|3039795_3040326_+	regulatory protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
BBF48659.1|3040563_3040815_-	hypothetical protein	NA	A0A2R2Z328	Escherichia_phage	100.0	2.4e-41
BBF48660.1|3040814_3041786_-	DNA primase	NA	A0A0H4IPK0	Shigella_phage	99.7	9.4e-195
BBF48661.1|3041775_3043296_-	helicase	NA	A0A0N7KZV6	Escherichia_phage	98.8	8.6e-304
BBF48662.1|3043289_3043676_-	hypothetical protein	NA	A0A286S263	Klebsiella_phage	44.8	2.6e-23
BBF48663.1|3043897_3044161_-	hypothetical protein	NA	A0A0N7BYT1	Escherichia_phage	98.8	2.9e-42
BBF48664.1|3044209_3044413_-	phage repressor Cro	NA	A0A2R2Z333	Escherichia_phage	98.5	9.8e-30
BBF48665.1|3044508_3045222_+	phage repressor protein CI	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
BBF48666.1|3045316_3046786_+	modification methyltransferase	NA	A0A2L1IV91	Escherichia_phage	99.4	4.3e-284
BBF48667.1|3046782_3047736_+	type II site-specific deoxyribonuclease	NA	A0A0P0ZG22	Escherichia_phage	99.7	3.5e-186
BBF48668.1|3048490_3049135_+	hypothetical protein	NA	A0A0H4IQ68	Shigella_phage	79.5	7.5e-92
BBF48669.1|3049404_3050043_+	antirepressor	NA	A0A0P0ZG08	Escherichia_phage	87.3	7.0e-106
BBF48670.1|3050113_3050326_+	phage cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
BBF48671.1|3050337_3050619_+	AbrB family transcriptional regulator	NA	A0A0P0ZGC3	Escherichia_phage	98.9	8.7e-45
BBF48672.1|3050639_3050921_+	hypothetical protein	NA	A0A0P0ZFG3	Escherichia_phage	98.9	1.4e-47
BBF48673.1|3050938_3051889_+	phage DNA recombination protein Bet	NA	A0A0P0ZFY9	Escherichia_phage	99.7	5.4e-179
BBF48674.1|3051885_3052575_+	exonuclease	NA	A0A0P0ZFI7	Escherichia_phage	99.1	5.0e-134
BBF48675.1|3052574_3053162_+	hypothetical protein	NA	A0A2R2Z318	Escherichia_phage	99.0	5.8e-107
BBF48676.1|3053236_3053584_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
BBF48677.1|3053647_3054469_+	hypothetical protein	NA	A0A2R2Z323	Escherichia_phage	99.3	7.2e-148
BBF48678.1|3054545_3055022_+	hypothetical protein	NA	A0A2L1IV82	Escherichia_phage	96.8	3.4e-81
BBF48679.1|3055129_3056008_+	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	99.3	5.5e-178
BBF48680.1|3056004_3056208_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	98.5	3.0e-31
BBF48681.1|3056200_3056440_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	97.5	6.7e-38
BBF48682.1|3056436_3057201_+	hypothetical protein	NA	G9L6G6	Escherichia_phage	57.4	4.6e-56
BBF48683.1|3057197_3057746_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	73.6	7.0e-14
BBF48684.1|3057897_3058086_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
BBF48685.1|3058087_3058297_+	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
BBF48686.1|3058293_3059172_+	hypothetical protein	NA	A0A077SK54	Escherichia_phage	63.6	3.7e-97
BBF48687.1|3059164_3059320_+	hypothetical protein	NA	G3CFH1	Escherichia_phage	98.0	9.1e-20
BBF48688.1|3059355_3059763_+	hypothetical protein	NA	A0A0P0ZH73	Escherichia_phage	81.5	2.0e-50
BBF48689.1|3059906_3060140_+	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
BBF48690.1|3060127_3060379_+	hypothetical protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
BBF48691.1|3060439_3060622_+	phage excisionase	NA	G3CFG7	Escherichia_phage	100.0	4.1e-27
BBF48692.1|3060605_3061775_-|integrase	integrase	integrase	G3CFG6	Escherichia_phage	100.0	7.5e-231
3061971:3061994	attR	GTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
>prophage 20
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	3276795	3362537	5470440	integrase,terminase,holin,protease,capsid,plate,tail,portal,tRNA	Enterobacteria_phage(70.97%)	98	3260797:3260812	3365466:3365481
3260797:3260812	attL	TCGCCAGCGCCAGGTT	NA	NA	NA	NA
BBF48884.1|3276795_3277299_-|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
BBF48885.1|3277356_3277992_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
BBF48886.1|3278200_3279049_+	transcriptional regulator	NA	NA	NA	NA	NA
BBF48887.1|3279104_3279365_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
BBF48888.1|3280058_3280439_-	holo-[acyl-carrier-protein] synthase 1	NA	NA	NA	NA	NA
BBF48889.1|3280438_3281170_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
BBF48890.1|3281181_3281910_-	DNA repair protein RecO	NA	NA	NA	NA	NA
BBF48891.1|3281921_3282827_-	GTP-binding protein Era	NA	NA	NA	NA	NA
BBF48892.1|3282823_3283504_-	RNase III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
BBF48893.1|3283776_3284751_-	leader peptidase	NA	NA	NA	NA	NA
BBF48894.1|3284766_3286566_-	back-translocating elongation factor EF4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
BBF48895.1|3286763_3287243_-	SoxR iron-sulfur cluster reduction factor component	NA	NA	NA	NA	NA
BBF48896.1|3287239_3288196_-	anti-sigma E factor	NA	NA	NA	NA	NA
BBF48897.1|3288195_3288846_-	anti-sigma factor	NA	NA	NA	NA	NA
BBF48898.1|3288878_3289454_-	RNA polymerase sigma E factor	NA	NA	NA	NA	NA
BBF48899.1|3289861_3291484_+	L-aspartate oxidase	NA	NA	NA	NA	NA
BBF48900.1|3291468_3292206_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
BBF48901.1|3292337_3293672_+	ATP-dependent RNA helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
BBF48902.1|3293881_3294763_-	transcriptional regulator	NA	NA	NA	NA	NA
BBF48903.1|3294866_3295454_+	cysteine and O-acetylserine exporter	NA	NA	NA	NA	NA
BBF48904.1|3295509_3295893_-	autonomous glycyl radical cofactor	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
BBF48905.1|3296196_3296886_+	uracil-DNA-glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
BBF48906.1|3296933_3297971_-	methyltransferase	NA	NA	NA	NA	NA
BBF48907.1|3298177_3298597_+	thioredoxin 2	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
BBF48908.1|3298665_3299364_+	hypothetical protein	NA	NA	NA	NA	NA
BBF48909.1|3299395_3302056_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
BBF48910.1|3302169_3303525_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
BBF48911.1|3303621_3303894_+	lipoprotein	NA	NA	NA	NA	NA
BBF48912.1|3303890_3305189_-	alpha-ketoglutarate transporter	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
BBF48913.1|3311041_3313615_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
BBF48914.1|3313744_3314476_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48915.1|3314472_3315453_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
BBF48916.1|3315587_3316325_+	BamABCDE complex OM biogenesis lipoprotein	NA	NA	NA	NA	NA
BBF48917.1|3316595_3316937_+	translation inhibitor protein RaiA	NA	NA	NA	NA	NA
BBF48918.1|3317087_3317888_-	methyltransferase	NA	Q775B4	Bordetella_phage	53.7	5.2e-66
BBF48919.1|3318228_3318525_-	hypothetical protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
BBF48920.1|3318660_3318801_-	hypothetical protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
BBF48921.1|3318992_3319253_-	phage regulatory protein	NA	NA	NA	NA	NA
BBF48922.1|3319295_3320405_-	phage late gene regulator	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
BBF48923.1|3320562_3321747_+|tail	phage tail sheath protein	tail	A0A0A7NV69	Enterobacteria_phage	99.5	1.6e-225
BBF48924.1|3321746_3322259_+|tail	phage tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
BBF48925.1|3322314_3322689_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
BBF48926.1|3322839_3325647_+|tail	phage tail protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.5	0.0e+00
BBF48927.1|3325659_3326148_+|tail	phage tail assembly protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
BBF48928.1|3326176_3326776_-	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
BBF48929.1|3326880_3327717_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	91.4	3.7e-147
BBF48930.1|3327720_3327885_+|tail	phage tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	95.2	3.4e-17
BBF48931.1|3328003_3328249_+|tail	phage tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	100.0	7.6e-37
BBF48932.1|3328277_3328811_-|tail	phage tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	100.0	1.4e-96
BBF48933.1|3328813_3330667_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	77.1	8.1e-171
BBF48934.1|3330669_3331200_-|tail	phage tail protein	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	6.2e-92
BBF48935.1|3331192_3332089_-|plate	phage baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	1.3e-153
BBF48936.1|3332092_3332443_-|plate	phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
BBF48937.1|3332439_3333021_-|plate	phage baseplate assembly protein	plate	A0A0A7NRZ3	Enterobacteria_phage	99.5	1.7e-103
BBF48938.1|3333017_3333662_-|tail	phage tail completion protein	tail	A0A0A7NV60	Enterobacteria_phage	98.6	2.7e-113
BBF48939.1|3333645_3334113_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	7.6e-86
BBF48940.1|3334250_3334658_-	hypothetical protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.8	1.6e-63
BBF48941.1|3334654_3335047_-	phage endolysin	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
BBF48942.1|3335043_3335367_-|holin	phage holin protein	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	6.1e-50
BBF48943.1|3335369_3335570_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
BBF48944.1|3335569_3336064_-|capsid	phage capsid completion protein	capsid	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
BBF48945.1|3336166_3336967_-|terminase	phage terminase small subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	88.0	3.2e-124
BBF48946.1|3337012_3338065_-|capsid	phage major capsid protein	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.3e-194
BBF48947.1|3338088_3338925_-	phage scaffolding protein	NA	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
BBF48948.1|3339079_3340831_+|terminase	phage terminase large subunit	terminase	A0A0A7NV54	Enterobacteria_phage	99.0	0.0e+00
BBF48949.1|3340830_3341877_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
BBF48950.1|3342366_3342558_-	hypothetical protein	NA	A0A1J0MGJ9	Serratia_phage	63.5	4.1e-14
BBF48951.1|3342599_3343322_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	38.9	2.8e-34
BBF48952.1|3343318_3343528_-	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
BBF48953.1|3343529_3344021_-	hypothetical protein	NA	G9L661	Escherichia_phage	92.6	7.5e-84
BBF48954.1|3344023_3344338_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	93.3	8.6e-49
BBF48955.1|3344334_3344667_-	carboxylate-amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	97.2	1.4e-54
BBF48956.1|3344730_3345042_-	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	2.5e-48
BBF48957.1|3345046_3346006_-	plasmid partition protein	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	6.4e-180
BBF48958.1|3346082_3348908_-	replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	87.9	0.0e+00
BBF48959.1|3348904_3349294_-	inositol monophosphatase 1	NA	NA	NA	NA	NA
BBF48960.1|3349290_3349911_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	40.4	1.2e-09
BBF48961.1|3349964_3350795_-|protease	serine protease	protease	A0A0A7NPW9	Enterobacteria_phage	99.3	5.6e-132
BBF48962.1|3350791_3350995_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	98.5	8.3e-29
BBF48963.1|3351006_3351306_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	2.1e-41
BBF48964.1|3351302_3351548_-	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
BBF48965.1|3351544_3351748_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	85.1	8.6e-26
BBF48966.1|3351834_3351948_-	membrane protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
BBF48967.1|3351944_3352187_-	hypothetical protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
BBF48968.1|3352198_3352477_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	2.4e-34
BBF48969.1|3352487_3352829_-	hypothetical protein	NA	A0A0A7NV42	Enterobacteria_phage	91.4	2.5e-54
BBF48970.1|3352847_3353174_-	hypothetical protein	NA	NA	NA	NA	NA
BBF48971.1|3353269_3353572_+	repressor protein	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
BBF48972.1|3353638_3354628_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	53.5	3.4e-99
BBF48973.1|3354941_3356102_+	chorismate mutase and prephenate dehydratase	NA	NA	NA	NA	NA
BBF48974.1|3356144_3357266_-	chorismate mutase-T and prephenate dehydrogenase	NA	NA	NA	NA	NA
BBF48975.1|3357276_3358347_-	3-deoxy-D-arabino-heptulosonate-7-phosphate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
BBF48976.1|3358559_3358922_+	lipoprotein	NA	NA	NA	NA	NA
BBF48977.1|3359071_3359590_+	periplasmic inhibitor of YfiN activity	NA	NA	NA	NA	NA
BBF48978.1|3359579_3360806_+	membrane-anchored diguanylate cyclase	NA	NA	NA	NA	NA
BBF48979.1|3360821_3361304_+	OM lipoprotein positive effector of YfiN activity	NA	NA	NA	NA	NA
BBF48980.1|3361380_3361728_-	50S ribosomal subunit protein L19	NA	NA	NA	NA	NA
BBF48981.1|3361769_3362537_-|tRNA	tRNA m(1)G37 methyltransferase	tRNA	NA	NA	NA	NA
3365466:3365481	attR	AACCTGGCGCTGGCGA	NA	NA	NA	NA
>prophage 21
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	3372093	3417261	5470440	integrase,terminase,transposase,protease,tail,portal	Enterobacteria_phage(75.41%)	62	3399212:3399227	3423938:3423953
BBF48993.1|3372093_3372576_+	tmRNA-binding trans-translation protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
BBF48994.1|3372751_3372877_+	hypothetical protein	NA	NA	NA	NA	NA
BBF48995.1|3373424_3373673_+	DNA-damage-inducible protein DinI	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
BBF48996.1|3374040_3374310_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	100.0	6.4e-45
BBF48997.1|3374311_3375634_-|tail	phage tail fiber protein	tail	Q687E6	Enterobacteria_phage	99.1	3.7e-77
BBF48998.1|3375698_3376298_-	outer membrane precursor Lom	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
BBF48999.1|3376365_3379842_-	phage host specificity protein	NA	Q687E8	Enterobacteria_phage	96.6	0.0e+00
BBF49000.1|3380078_3380660_-|tail	phage tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.4	7.3e-94
BBF49001.1|3380656_3381400_-|tail	phage tail assembly protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
BBF49002.1|3381410_3381803_-|tail	phage minor tail protein	tail	Q687F1	Enterobacteria_phage	97.7	9.9e-71
BBF49003.1|3381760_3382108_-|tail	phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	2.0e-51
BBF49004.1|3382107_3382437_-|tail	phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
BBF49005.1|3382433_3385079_-|tail	phage tail length tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.5	0.0e+00
BBF49006.1|3385122_3385431_-|tail	phage minor tail protein	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
BBF49007.1|3385457_3385880_-|tail	phage minor tail protein	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
BBF49008.1|3385893_3386646_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
BBF49009.1|3386653_3386809_-|tail	phage minor tail protein	tail	Q687F7	Enterobacteria_phage	100.0	1.1e-22
BBF49010.1|3386998_3387325_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF49011.1|3387324_3388212_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF49012.1|3388214_3388361_-|tail	phage minor tail protein	tail	Q687G0	Enterobacteria_phage	100.0	3.5e-21
BBF49013.1|3388373_3388997_-|tail	phage minor tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
BBF49014.1|3388999_3389281_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
BBF49015.1|3389273_3389600_-	membrane protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
BBF49016.1|3389687_3391712_-|protease	phage protease/scaffold protein	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
BBF49017.1|3391656_3393159_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
BBF49018.1|3393158_3393371_-	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
BBF49019.1|3393367_3395491_-|terminase	phage terminase large subunit	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
BBF49020.1|3395487_3395964_-|terminase	phage terminase small subunit	terminase	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
BBF49021.1|3396376_3396844_-	phage endopeptidase	NA	Q7AYI6	Enterobacteria_phage	100.0	7.7e-78
BBF49022.1|3397627_3397897_-	Shiga toxin 1 subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
BBF49023.1|3397906_3398854_-	Shiga toxin 1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
3399212:3399227	attL	TTTTTAAGATTTTGTT	NA	NA	NA	NA
BBF49024.1|3399360_3399552_-	antiterminator	NA	Q777W5	Enterobacteria_phage	100.0	2.7e-29
BBF49025.1|3399509_3399842_-	antiterminator	NA	Q8VNP1	Enterobacteria_phage	98.9	4.3e-51
BBF49026.1|3399786_3399981_-	hypothetical protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
BBF49027.1|3399977_3400583_-	recombination endonuclease	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
BBF49028.1|3400582_3401062_-	hypothetical protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.4	1.9e-84
BBF49029.1|3401144_3401306_-	hypothetical protein	NA	Q8VNP4	Enterobacteria_phage	100.0	5.6e-20
BBF49030.1|3401380_3402085_-	phage antirepressor protein	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
BBF49031.1|3402538_3403066_-	DNA methylase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
BBF49032.1|3403062_3403509_-	recombination protein	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
BBF49033.1|3403465_3403702_-	hypothetical protein	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
BBF49034.1|3403712_3403928_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
BBF49035.1|3404060_3404339_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
BBF49036.1|3404408_3404678_-	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
BBF49037.1|3404677_3406114_-	replication protein	NA	Q8VNP7	Enterobacteria_phage	100.0	6.1e-275
BBF49038.1|3406103_3407003_-	replication protein	NA	Q8VNP8	Enterobacteria_phage	100.0	1.6e-164
BBF49039.1|3406995_3407142_-	hypothetical protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
BBF49040.1|3407176_3407455_-	phage regulatory protein CII	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
BBF49041.1|3407547_3407874_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF49042.1|3407873_3408422_+|transposase	IS629 transposase OrfB	transposase	Q687G6	Enterobacteria_phage	100.0	7.6e-101
BBF49043.1|3408555_3408954_+	recombination protein	NA	Q8VNQ0	Enterobacteria_phage	99.2	1.8e-72
BBF49044.1|3408954_3409467_+	single-stranded DNA-binding protein	NA	Q8VNQ1	Enterobacteria_phage	100.0	1.8e-75
BBF49045.1|3409480_3409774_+	ABC transporter ATP-binding protein	NA	Q687G7	Enterobacteria_phage	100.0	8.5e-51
BBF49046.1|3409784_3409952_+	hypothetical protein	NA	Q687G8	Enterobacteria_phage	100.0	3.0e-24
BBF49047.1|3409948_3410548_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	100.0	1.8e-111
BBF49048.1|3410549_3410897_+	hypothetical protein	NA	Q687G9	Enterobacteria_phage	100.0	9.4e-65
BBF49049.1|3410899_3411787_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF49050.1|3411786_3412113_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF49051.1|3412632_3413139_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	2.3e-91
BBF49052.1|3413177_3413594_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
BBF49053.1|3413666_3415415_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
BBF49054.1|3415416_3417261_-	histidine kinase-like protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	5.9e-307
3423938:3423953	attR	TTTTTAAGATTTTGTT	NA	NA	NA	NA
>prophage 22
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	3488662	3495802	5470440		Escherichia_phage(83.33%)	6	NA	NA
BBF49128.1|3488662_3491224_+	methyl-directed mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
BBF49129.1|3491329_3491986_+	serine/threonine-specific protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	47.4	5.6e-50
BBF49130.1|3492036_3492804_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
BBF49131.1|3492999_3493908_+	dehydrogenase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
BBF49132.1|3493904_3495167_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
BBF49133.1|3495163_3495802_+	class II aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 23
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	3731600	3775915	5470440	tRNA,protease,integrase,transposase	Escherichia_phage(40.0%)	45	3765118:3765133	3783159:3783174
BBF49355.1|3731600_3732359_+|protease	metalloprotease	protease	NA	NA	NA	NA
BBF49356.1|3732414_3733158_-	4-hydroxy-2-ketovalerate aldolase	NA	NA	NA	NA	NA
BBF49357.1|3733144_3734254_-	transferase	NA	NA	NA	NA	NA
BBF49358.1|3734257_3735115_-	PTS fructose transporter subunit IID	NA	NA	NA	NA	NA
BBF49359.1|3735114_3735864_-	enzyme IIC component of PTS	NA	NA	NA	NA	NA
BBF49360.1|3735889_3736375_-	enzyme IIB component of PTS	NA	NA	NA	NA	NA
BBF49361.1|3736385_3736814_-	enzyme IIB component of PTS	NA	NA	NA	NA	NA
BBF49362.1|3736932_3739773_-	transcriptional regulator	NA	NA	NA	NA	NA
BBF49363.1|3739989_3740910_-	agmatinase	NA	NA	NA	NA	NA
BBF49364.1|3741045_3741777_-	lipoprotein	NA	NA	NA	NA	NA
BBF49365.1|3741922_3743899_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
BBF49366.1|3744386_3744638_-	inner membrane protein	NA	NA	NA	NA	NA
BBF49367.1|3744693_3745848_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
BBF49368.1|3746283_3747678_+	D-galactose transporter	NA	NA	NA	NA	NA
BBF49369.1|3747796_3748252_+	hypothetical protein	NA	NA	NA	NA	NA
BBF49370.1|3748346_3749054_+	DNA-specific endonuclease I	NA	NA	NA	NA	NA
BBF49371.1|3749133_3749865_+	16S rRNA m(3)U1498 methyltransferase	NA	NA	NA	NA	NA
BBF49372.1|3749877_3750828_+	glutathione synthetase	NA	NA	NA	NA	NA
BBF49373.1|3750864_3751500_+	hypothetical protein	NA	NA	NA	NA	NA
BBF49374.1|3751499_3751916_+	holliday junction resolvase	NA	NA	NA	NA	NA
BBF49375.1|3752091_3753072_-	twitching motility protein PilT	NA	NA	NA	NA	NA
BBF49376.1|3753089_3753794_+	hypothetical protein	NA	NA	NA	NA	NA
BBF49377.1|3753811_3754378_+	hypothetical protein	NA	NA	NA	NA	NA
BBF49378.1|3754374_3754665_+	hypothetical protein	NA	NA	NA	NA	NA
BBF49379.1|3754672_3755266_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
BBF49380.1|3755258_3756395_+	oxidoreductase	NA	NA	NA	NA	NA
BBF49381.1|3756707_3757694_+	C4-dicarboxylate-binding periplasmic protein	NA	NA	NA	NA	NA
BBF49382.1|3757738_3758242_+	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
BBF49383.1|3758241_3759543_+	C4-dicarboxylate transport system large permease component	NA	NA	NA	NA	NA
BBF49384.1|3759598_3760606_-	hypothetical protein	NA	NA	NA	NA	NA
BBF49385.1|3760722_3761769_-	periplasmic L-asparaginase 2	NA	NA	NA	NA	NA
BBF49386.1|3761944_3762664_-	hypothetical protein	NA	NA	NA	NA	NA
BBF49387.1|3762847_3763174_-	hypothetical protein	NA	NA	NA	NA	NA
BBF49388.1|3763173_3763893_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
BBF49389.1|3764053_3765106_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
3765118:3765133	attL	ATAAAGAGGATGATTT	NA	NA	NA	NA
BBF49390.1|3765133_3765409_+	oxidative damage protective factor for iron-sulfur proteins	NA	NA	NA	NA	NA
BBF49391.1|3765473_3766553_+	membrane-bound lytic murein transglycosylase C	NA	NA	NA	NA	NA
BBF49392.1|3766754_3768011_+	nucleoside transporter	NA	NA	NA	NA	NA
BBF49393.1|3768060_3770196_-	ornithine decarboxylase isozyme	NA	NA	NA	NA	NA
BBF49394.1|3770593_3771301_+	inner membrane protein	NA	NA	NA	NA	NA
BBF49395.1|3771679_3772939_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	8.4e-79
BBF49396.1|3773055_3773307_-|transposase	ISEc8 transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	2.8e-42
BBF49397.1|3773382_3773709_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF49398.1|3773708_3774596_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF49399.1|3774955_3775915_+|transposase	ISEc13 transposase	transposase	NA	NA	NA	NA
3783159:3783174	attR	AAATCATCCTCTTTAT	NA	NA	NA	NA
>prophage 24
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	3781039	3824234	5470440	transposase	Shigella_phage(42.86%)	51	NA	NA
BBF49403.1|3781039_3781270_+|transposase	IS630 transposase	transposase	NA	NA	NA	NA
BBF49404.1|3781333_3781894_+|transposase	IS630 transposase	transposase	NA	NA	NA	NA
BBF49405.1|3782521_3783295_-	hypothetical protein	NA	NA	NA	NA	NA
BBF49406.1|3783467_3784613_-	T3SS secreted effector EspG	NA	NA	NA	NA	NA
BBF49407.1|3785099_3785966_-|transposase	IS3 transposase OrfB	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.9e-51
BBF49408.1|3785962_3786262_-|transposase	IS3 transposase OrfA	transposase	NA	NA	NA	NA
BBF49409.1|3786776_3787565_-	T3SS secreted effector EspF	NA	NA	NA	NA	NA
BBF49410.1|3787760_3788039_-	T3SS component EscG	NA	NA	NA	NA	NA
BBF49411.1|3788044_3788266_-	T3SS structure protein EscF	NA	NA	NA	NA	NA
BBF49412.1|3788300_3788708_-	T3SS chaperone CesD2	NA	NA	NA	NA	NA
BBF49413.1|3788714_3789677_-	T3SS translocator EspB	NA	NA	NA	NA	NA
BBF49414.1|3789697_3790840_-	T3SS translocator EspD	NA	NA	NA	NA	NA
BBF49415.1|3790852_3791431_-	T3SS translocator EspA	NA	NA	NA	NA	NA
BBF49416.1|3791489_3792545_-	T3SS secretion switching protein SepL	NA	NA	NA	NA	NA
BBF49417.1|3792726_3793908_+	T3SS structure protein EscD	NA	NA	NA	NA	NA
BBF49418.1|3794196_3797004_-	intimin	NA	NA	NA	NA	NA
BBF49419.1|3797061_3797532_-	T3SS chaperone CesT	NA	NA	NA	NA	NA
BBF49420.1|3797666_3799322_-	T3SS translocated intimin receptor Tir	NA	NA	NA	NA	NA
BBF49421.1|3799644_3800130_-	T3SS secreted effector Map	NA	NA	NA	NA	NA
BBF49422.1|3800520_3800883_+	T3SS chaperone CesF	NA	NA	NA	NA	NA
BBF49423.1|3801061_3801571_-	T3SS secreted effector EspH	NA	NA	NA	NA	NA
BBF49424.1|3801601_3802519_-	T3SS structure protein SepQ	NA	NA	NA	NA	NA
BBF49425.1|3802890_3803211_-	T3SS component	NA	NA	NA	NA	NA
BBF49426.1|3803270_3804611_-	T3SS structure protein EscN	NA	NA	NA	NA	NA
BBF49427.1|3804594_3806622_-	T3SS structure protein EscV	NA	NA	NA	NA	NA
BBF49428.1|3806618_3806972_-	regulator Mpc	NA	NA	NA	NA	NA
BBF49429.1|3807156_3807453_+	T3SS secreted effector EspZ	NA	NA	NA	NA	NA
BBF49430.1|3807484_3807913_+	T3SS component	NA	NA	NA	NA	NA
BBF49431.1|3807915_3808488_+	T3SS structure protein EscJ	NA	NA	NA	NA	NA
BBF49432.1|3808493_3808949_+	T3SS secretion switching protein SepD	NA	NA	NA	NA	NA
BBF49433.1|3808948_3810487_+	T3SS structure protein EscC	NA	D0U184	Enterobacteria_phage	29.3	1.0e-09
BBF49434.1|3810500_3810956_+	T3SS chaperone CesD	NA	NA	NA	NA	NA
BBF49435.1|3811339_3811753_-	positive regulator GrlA	NA	NA	NA	NA	NA
BBF49436.1|3811808_3812180_-	negative regulator GrlR	NA	NA	NA	NA	NA
BBF49437.1|3812375_3812834_+	hypothetical protein	NA	NA	NA	NA	NA
BBF49438.1|3812830_3813868_-	T3SS structure protein EscU	NA	NA	NA	NA	NA
BBF49439.1|3813860_3814637_-	T3SS structure protein EscT	NA	NA	NA	NA	NA
BBF49440.1|3814636_3814906_-	T3SS structure protein EscS	NA	NA	NA	NA	NA
BBF49441.1|3814905_3815559_-	T3SS structure protein EscR	NA	NA	NA	NA	NA
BBF49442.1|3815563_3816217_-	T3SS component	NA	NA	NA	NA	NA
BBF49443.1|3816203_3816803_-	T3SS component	NA	NA	NA	NA	NA
BBF49444.1|3816799_3817114_-	T3SS component	NA	NA	NA	NA	NA
BBF49445.1|3817126_3817345_-	T3SS component	NA	NA	NA	NA	NA
BBF49446.1|3817359_3817731_-	transcription regulator Ler	NA	NA	NA	NA	NA
BBF49447.1|3818586_3819426_-|transposase	IS2 transposase	transposase	Q9ZXG3	Shigella_phage	92.5	1.7e-152
BBF49448.1|3819772_3820099_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF49449.1|3820098_3820986_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF49450.1|3822037_3822139_-	regulatory protein	NA	NA	NA	NA	NA
BBF49451.1|3822329_3822533_-	hypothetical protein	NA	NA	NA	NA	NA
BBF49452.1|3823056_3823368_+|transposase	IS602 transposase	transposase	Q716C1	Shigella_phage	40.8	2.4e-11
BBF49453.1|3823487_3824234_+|transposase	IS602 transposase	transposase	Q716C2	Shigella_phage	59.0	4.3e-83
>prophage 25
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	4064242	4120928	5470440	transposase,protease	Escherichia_phage(15.79%)	59	NA	NA
BBF49681.1|4064242_4065130_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF49682.1|4065129_4065456_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF49683.1|4065461_4066526_-	EptAB family phosphoethanolamine transferase	NA	NA	NA	NA	NA
BBF49684.1|4067085_4067418_-	preprotein translocase membrane subunit SecG	NA	NA	NA	NA	NA
BBF49685.1|4067645_4068983_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
BBF49686.1|4068975_4069824_-	7,8-dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
BBF49687.1|4069913_4071857_-|protease	ATP-dependent zinc-metallo protease	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.4e-118
BBF49688.1|4071947_4072577_-	23S rRNA U2552 2'-O-ribose methyltransferase	NA	NA	NA	NA	NA
BBF49689.1|4072702_4072996_+	RNA binding protein associated with pre-50S ribosomal subunits	NA	NA	NA	NA	NA
BBF49690.1|4073151_4073628_-	transcript cleavage factor	NA	NA	NA	NA	NA
BBF49691.1|4073875_4075309_+	D-alanyl-D-alanine carboxypeptidase, penicillin-binding protein 4	NA	NA	NA	NA	NA
BBF49692.1|4075348_4076521_-	GTPase involved in cell partitioning and DNA repair	NA	NA	NA	NA	NA
BBF49693.1|4076536_4077502_-	inner membrane transporter	NA	NA	NA	NA	NA
BBF49694.1|4077628_4077886_-	50S ribosomal subunit protein L27	NA	NA	NA	NA	NA
BBF49695.1|4077906_4078218_-	50S ribosomal subunit protein L21	NA	NA	NA	NA	NA
BBF49696.1|4078476_4079448_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
BBF49697.1|4079674_4079953_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
BBF49698.1|4080000_4081260_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
BBF49699.1|4081314_4081584_-	acid stress protein	NA	NA	NA	NA	NA
BBF49700.1|4081728_4082022_-	phospholipid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
BBF49701.1|4082021_4082657_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
BBF49702.1|4082675_4083236_-	ABC-type organic solvent transporter	NA	NA	NA	NA	NA
BBF49703.1|4083232_4084015_-	ABC transporter permease	NA	NA	NA	NA	NA
BBF49704.1|4084022_4084832_-	organic solvent ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
BBF49705.1|4085041_4086019_+	calcium/sodium:proton antiporter	NA	NA	NA	NA	NA
BBF49706.1|4086032_4087019_+	D-arabinose 5-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
BBF49707.1|4087039_4087606_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
BBF49708.1|4087602_4088178_+	periplasmic membrane-anchored LPS-binding protein	NA	NA	NA	NA	NA
BBF49709.1|4088146_4088704_+	lipopolysaccharide export system protein LptA	NA	NA	NA	NA	NA
BBF49710.1|4088710_4089436_+	lipopolysaccharide export ABC transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
BBF49711.1|4089483_4090917_+	RNA polymerase sigma 54 factor RpoN	NA	NA	NA	NA	NA
BBF49712.1|4090939_4091227_+	ribosome hibernation promoting factor HPF	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
BBF49713.1|4091344_4091836_+	sugar-specific enzyme IIA component of PTS	NA	NA	NA	NA	NA
BBF49714.1|4091881_4092736_+	nucleotide-binding protein	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
BBF49715.1|4092732_4093005_+	phosphohistidinoprotein-hexose phosphotransferase component of N-regulated PTS system	NA	NA	NA	NA	NA
BBF49716.1|4093218_4093851_+	Mg(2+)-starvation-stimulated protein	NA	NA	NA	NA	NA
BBF49717.1|4093847_4094576_-	biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
BBF49718.1|4094572_4095226_-	isoprenoid biosynthesis protein with amidotransferase-like domain	NA	NA	NA	NA	NA
BBF49719.1|4095455_4097792_-	aerobic respiration control sensor histidine protein kinase	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
BBF49720.1|4097887_4098817_-	Fe-S oxidoreductase	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
BBF49721.1|4099398_4103952_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
BBF49722.1|4103964_4105383_+	glutamate synthase small subunit	NA	NA	NA	NA	NA
BBF49723.1|4105566_4105938_+	hypothetical protein	NA	NA	NA	NA	NA
BBF49724.1|4106065_4106614_+	hypothetical protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	2.3e-73
BBF49725.1|4106673_4107138_-	hypothetical protein	NA	NA	NA	NA	NA
BBF49726.1|4107134_4108010_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
BBF49727.1|4108006_4108696_-	N-acetylmannosamine-6-P epimerase	NA	NA	NA	NA	NA
BBF49728.1|4108743_4110234_-	sialic acid transporter	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
BBF49729.1|4110343_4111237_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
BBF49730.1|4111358_4112150_-	sialic acid-inducible nan operon repressor	NA	NA	NA	NA	NA
BBF49731.1|4112529_4113897_+	transporter	NA	NA	NA	NA	NA
BBF49732.1|4113939_4114437_-|protease	ClpXP protease specificity enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
BBF49733.1|4114442_4115081_-	stringent starvation protein A	NA	NA	NA	NA	NA
BBF49734.1|4115475_4115868_-	30S ribosomal subunit protein S9	NA	NA	NA	NA	NA
BBF49735.1|4115883_4116312_-	50S ribosomal subunit protein L13	NA	NA	NA	NA	NA
BBF49736.1|4116530_4117658_-	cell division protein ZapE	NA	NA	NA	NA	NA
BBF49737.1|4117851_4118250_+	inner membrane-anchored protein	NA	NA	NA	NA	NA
BBF49738.1|4118403_4119771_+|protease	serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
BBF49739.1|4119860_4120928_+|protease	serine endoprotease	protease	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 26
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	4582301	4589872	5470440	transposase	Shigella_phage(50.0%)	9	NA	NA
BBF50181.1|4582301_4582694_+	antiterminator	NA	A0A088CD47	Shigella_phage	93.6	9.6e-66
BBF50182.1|4582852_4583218_+|transposase	IS2 transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
BBF50183.1|4583175_4583820_+|transposase	IS2 transposase	transposase	Q9ZXG3	Shigella_phage	99.5	5.7e-124
BBF50184.1|4584377_4584584_+	hypothetical protein	NA	NA	NA	NA	NA
BBF50185.1|4585175_4585322_+	hypothetical protein	NA	NA	NA	NA	NA
BBF50186.1|4585578_4586403_+	DNA-damage-inducible protein DinD	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
BBF50187.1|4586694_4587312_+	inner membrane protein	NA	NA	NA	NA	NA
BBF50188.1|4587308_4588991_-	DNA ligase	NA	F8SJM3	Pseudomonas_phage	22.3	4.3e-22
BBF50189.1|4589248_4589872_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
>prophage 27
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	5056748	5101661	5470440	integrase,terminase,transposase,holin,protease,head,tail,portal,tRNA	Enterobacteria_phage(35.29%)	55	5079007:5079020	5104410:5104423
BBF50594.1|5056748_5057282_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
BBF50595.1|5057478_5057652_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
BBF50596.1|5057699_5057981_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
BBF50597.1|5058017_5058590_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
BBF50598.1|5058589_5059324_-	putative phage protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
BBF50599.1|5059326_5059518_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
BBF50600.1|5059570_5059987_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	69.9	1.4e-30
BBF50601.1|5060133_5060607_-	methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
BBF50602.1|5060603_5060954_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
BBF50603.1|5060944_5061481_-	hypothetical protein	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
BBF50604.1|5061608_5062433_-	hypothetical protein	NA	Q8SBF9	Shigella_phage	99.6	1.0e-149
BBF50605.1|5062498_5062861_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
BBF50606.1|5063564_5064212_-	phage repressor protein CI	NA	K7PKK1	Enterobacteria_phage	99.5	3.1e-117
BBF50607.1|5064354_5064615_+	phage antirepressor Cro	NA	K7PJQ8	Enterobacteria_phage	97.7	7.8e-40
BBF50608.1|5064607_5065159_+	transcriptional regulator	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
BBF50609.1|5065261_5065993_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	2.8e-135
BBF50610.1|5066070_5066658_+	hypothetical protein	NA	A5LH76	Enterobacteria_phage	98.5	3.9e-111
BBF50611.1|5066671_5067424_+	phage antitermination protein Q	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
BBF50612.1|5068703_5070554_+	hypothetical protein	NA	B6DZ89	Enterobacteria_phage	96.9	0.0e+00
BBF50613.1|5071002_5071209_+|holin	phage holine protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
BBF50614.1|5071208_5071706_+	phage lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
BBF50615.1|5071702_5072170_+	phage murein endopeptidase	NA	Q7AYI6	Enterobacteria_phage	80.1	4.0e-58
BBF50616.1|5072635_5072950_+	PchABC family transcriptional regulator	NA	NA	NA	NA	NA
BBF50617.1|5072997_5073162_-	hypothetical protein	NA	A0A0P0ZCA1	Stx2-converting_phage	96.8	6.5e-08
BBF50618.1|5073203_5073659_+	DNase	NA	H6WZK7	Escherichia_phage	82.7	1.0e-63
BBF50619.1|5073850_5074414_+|terminase	phage terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
BBF50620.1|5074410_5076072_+|terminase	phage terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
BBF50621.1|5076135_5078073_+|head,protease	phage prohead protease	head,protease	H6WZL0	Escherichia_phage	98.4	0.0e+00
BBF50622.1|5078117_5078339_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
BBF50623.1|5078284_5079649_+|portal	phage portal protein	portal	B6DZX6	Stx2-converting_phage	96.9	2.5e-254
5079007:5079020	attL	CAACTGGGACAGCG	NA	NA	NA	NA
BBF50624.1|5079645_5080623_+|portal	phage portal protein	portal	B6DZX7	Stx2-converting_phage	79.2	9.2e-57
BBF50625.1|5080702_5081029_+	phage DNA packaging protein	NA	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
BBF50626.1|5081038_5081389_+|head,tail	phage head-tail adaptor	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
BBF50627.1|5081385_5081832_+|tail	phage minor tail protein	tail	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
BBF50628.1|5081828_5082173_+|tail	phage minor tail protein	tail	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
BBF50629.1|5082239_5082956_+|tail	phage major tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
BBF50630.1|5082961_5083336_+|tail	phage tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
BBF50631.1|5083431_5083641_+|tail	phage minor tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
BBF50632.1|5083692_5086935_+|tail	phage tail length tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
BBF50633.1|5086927_5087269_+|tail	phage minor tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
BBF50634.1|5087268_5087967_+|tail	phage minor tail protein	tail	H6WZM3	Escherichia_phage	98.3	3.1e-131
BBF50635.1|5087977_5088721_+|tail	phage tail assembly protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
BBF50636.1|5088717_5089299_+|tail	phage tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	89.6	8.6e-87
BBF50637.1|5089534_5093011_+	phage host specificity protein	NA	Q6H9T2	Enterobacteria_phage	96.1	0.0e+00
BBF50638.1|5093079_5093703_+	outer membrane protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
BBF50639.1|5093767_5095081_+|tail	phage tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
BBF50640.1|5095082_5095352_+	hypothetical protein	NA	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
BBF50641.1|5095527_5095935_+	T3SS secreted effector NleG	NA	B6DZB9	Enterobacteria_phage	96.2	5.7e-69
BBF50642.1|5096064_5097123_-	T3SS secreted effector EspW	NA	NA	NA	NA	NA
BBF50643.1|5097201_5097852_-	T3SS secreted effector NleG	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
BBF50644.1|5098034_5098625_+	T3SS secreted effector EspM	NA	NA	NA	NA	NA
BBF50645.1|5099126_5099375_-	DNA-damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
BBF50646.1|5099436_5099766_-|integrase	integrase	integrase	S5MDN5	Escherichia_phage	99.1	1.7e-55
BBF50647.1|5099770_5100535_-|integrase	integrase	integrase	S5MDN5	Escherichia_phage	99.6	3.1e-145
BBF50648.1|5100623_5101661_+|tRNA	tRNA-dihydrouridine synthase A	tRNA	NA	NA	NA	NA
5104410:5104423	attR	CGCTGTCCCAGTTG	NA	NA	NA	NA
>prophage 28
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	5184476	5280156	5470440	tRNA,transposase,integrase,protease	Escherichia_phage(15.38%)	92	5258032:5258061	5283523:5283552
BBF50728.1|5184476_5185166_-|tRNA	lysine tRNA synthetase	tRNA	A0A1V0SAC0	Catovirus	39.5	1.2e-39
BBF50729.1|5185250_5185577_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF50730.1|5185576_5186464_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF50731.1|5186466_5186661_-|transposase	transposase	transposase	F6MIM4	Haemophilus_phage	69.8	3.9e-12
BBF50732.1|5186832_5196504_-	adherence factor Efa1	NA	NA	NA	NA	NA
BBF50733.1|5197154_5197943_-	endonuclease	NA	NA	NA	NA	NA
BBF50734.1|5198377_5199052_-	T3SS secreted effector NleE	NA	NA	NA	NA	NA
BBF50735.1|5199100_5200090_-	T3SS secreted effector NleB	NA	Q8HAB2	Salmonella_phage	58.5	1.1e-97
BBF50736.1|5200698_5201157_-	T3SS secreted effector EspL	NA	NA	NA	NA	NA
BBF50737.1|5201262_5202348_-	T3SS secreted effector EspL	NA	NA	NA	NA	NA
BBF50738.1|5203175_5204048_-|transposase	IS609 transposase	transposase	A0A1W6JP07	Morganella_phage	97.4	1.1e-146
BBF50739.1|5204178_5204730_+|transposase	IS609 transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.7	6.6e-36
BBF50740.1|5205169_5205964_+	hypothetical protein	NA	NA	NA	NA	NA
BBF50741.1|5206034_5206484_-	50S ribosomal subunit protein L9	NA	NA	NA	NA	NA
BBF50742.1|5206525_5206753_-	30S ribosomal subunit protein S18	NA	NA	NA	NA	NA
BBF50743.1|5206757_5207072_-	primosomal protein N	NA	NA	NA	NA	NA
BBF50744.1|5207078_5207474_-	30S ribosomal subunit protein S6	NA	NA	NA	NA	NA
BBF50745.1|5207800_5208076_+	hypothetical protein	NA	NA	NA	NA	NA
BBF50746.1|5208204_5208891_-	L-ribulose 5-phosphate 4-epimerase	NA	NA	NA	NA	NA
BBF50747.1|5208890_5209745_-	L-xylulose 5-phosphate 3-epimerase	NA	NA	NA	NA	NA
BBF50748.1|5209754_5210405_-	3-keto-L-gulonate 6-phosphate decarboxylase	NA	NA	NA	NA	NA
BBF50749.1|5210418_5210883_-	L-ascorbate-specific enzyme IIA component of PTS	NA	NA	NA	NA	NA
BBF50750.1|5210892_5211198_-	L-ascorbate-specific enzyme IIB component of PTS	NA	NA	NA	NA	NA
BBF50751.1|5211213_5212611_-	L-ascorbate-specific enzyme IIC permease component of PTS	NA	NA	NA	NA	NA
BBF50752.1|5212965_5214030_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
BBF50753.1|5214137_5214893_+	transcriptional repressor	NA	NA	NA	NA	NA
BBF50754.1|5214889_5215639_-	acyl CoA esterase	NA	NA	NA	NA	NA
BBF50755.1|5215820_5216150_+	biofilm peroxide resistance protein	NA	NA	NA	NA	NA
BBF50756.1|5216298_5216574_+	hypothetical protein	NA	NA	NA	NA	NA
BBF50757.1|5216690_5218316_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
BBF50758.1|5218399_5219563_-	ATP-Grasp family ATPase	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
BBF50759.1|5219565_5220204_-	hypothetical protein	NA	NA	NA	NA	NA
BBF50760.1|5220213_5220612_-	inner membrane protein	NA	NA	NA	NA	NA
BBF50761.1|5220629_5221289_-	hypothetical protein	NA	NA	NA	NA	NA
BBF50762.1|5221339_5222038_-	hypothetical protein	NA	NA	NA	NA	NA
BBF50763.1|5222056_5222458_-	hypothetical protein	NA	NA	NA	NA	NA
BBF50764.1|5222584_5223316_-	23S rRNA mG2251 2'-O-ribose methyltransferase	NA	NA	NA	NA	NA
BBF50765.1|5223495_5225856_-	exoribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.2e-67
BBF50766.1|5225894_5226320_-	nitric oxide-sensitive repressor for NO regulon	NA	NA	NA	NA	NA
BBF50767.1|5226524_5227823_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
BBF50768.1|5227926_5228124_-	transcriptional regulator	NA	NA	NA	NA	NA
BBF50769.1|5228205_5229210_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
BBF50770.1|5229212_5230472_-|protease	modulator for HflB protease specific for phage lambda cII repressor	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
BBF50771.1|5230557_5231838_-	GTP-binding protein HflX	NA	NA	NA	NA	NA
BBF50772.1|5231914_5232223_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
BBF50773.1|5232308_5233259_-|tRNA	delta(2)-isopentenylpyrophosphate tRNA-adenosine transferase	tRNA	NA	NA	NA	NA
BBF50774.1|5233251_5235099_-	methyl-directed mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
BBF50775.1|5235108_5236446_-	N-acetylmuramoyl-l-alanine amidase II	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
BBF50776.1|5236464_5236926_-|tRNA	tRNA(ANN) t(6)A37 threonylcarbamoyladenosine modification protein	tRNA	NA	NA	NA	NA
BBF50777.1|5236897_5238430_-	carbohydrate kinase	NA	NA	NA	NA	NA
BBF50778.1|5238443_5239583_+	epoxyqueuosine reductase	NA	NA	NA	NA	NA
BBF50779.1|5240477_5241023_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
BBF50780.1|5241117_5242170_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
BBF50781.1|5242266_5243235_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
BBF50782.1|5243256_5246580_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
BBF50783.1|5246608_5246911_-	inner membrane protein	NA	NA	NA	NA	NA
BBF50784.1|5246919_5247234_-	hypothetical protein	NA	NA	NA	NA	NA
BBF50785.1|5247285_5248743_-	transporter	NA	NA	NA	NA	NA
BBF50786.1|5249006_5249984_-	elongation factor	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
BBF50787.1|5250308_5252117_+	anaerobic fumarate reductase catalytic and NAD/flavoprotein subunit	NA	NA	NA	NA	NA
BBF50788.1|5252109_5252844_+	fumarate reductase Fe-S subunit	NA	NA	NA	NA	NA
BBF50789.1|5252854_5253250_+	fumarate reductase membrane anchor subunit	NA	NA	NA	NA	NA
BBF50790.1|5253260_5253620_+	fumarate reductase membrane anchor subunit	NA	NA	NA	NA	NA
BBF50791.1|5253682_5254816_+	beta-lactamase	NA	NA	NA	NA	NA
BBF50792.1|5254904_5255438_+	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
BBF50793.1|5255434_5255752_-	multidrug efflux system protein	NA	NA	NA	NA	NA
BBF50794.1|5255933_5256080_-	entericidin B membrane lipoprotein	NA	NA	NA	NA	NA
BBF50795.1|5256190_5256316_-	entericidin A	NA	NA	NA	NA	NA
BBF50796.1|5256367_5256934_-	polyproline-specific translation elongation factor EF-P	NA	NA	NA	NA	NA
BBF50797.1|5256975_5258004_+	EF-P-Lys34 lysylation protein	NA	NA	NA	NA	NA
5258032:5258061	attL	GCCTGATGCGCTACGCTTATCAGGCCTACA	NA	NA	NA	NA
BBF50798.1|5258393_5259263_+	hypothetical protein	NA	NA	NA	NA	NA
BBF50799.1|5259466_5259820_-	hypothetical protein	NA	NA	NA	NA	NA
BBF50800.1|5259957_5261604_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
BBF50801.1|5261647_5261941_-	co-chaperonin GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
BBF50802.1|5262216_5263473_+	transporter	NA	NA	NA	NA	NA
BBF50803.1|5263488_5263965_-	exclusion suppressor FxsA	NA	NA	NA	NA	NA
BBF50804.1|5264301_5265738_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
BBF50805.1|5265855_5267157_+	C4-dicarboxylate antiporter	NA	NA	NA	NA	NA
BBF50806.1|5267272_5267611_+	divalent-cation tolerance protein	NA	NA	NA	NA	NA
BBF50807.1|5267586_5269284_+	thiol:disulfide interchange protein and activator of DsbC	NA	NA	NA	NA	NA
BBF50808.1|5269320_5269896_+	transcriptional regulator	NA	NA	NA	NA	NA
BBF50809.1|5270275_5271541_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
BBF50810.1|5271657_5272443_-	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	99.0	2.3e-114
BBF50811.1|5272531_5272861_+|transposase	ISSfl3 transposase	transposase	NA	NA	NA	NA
BBF50812.1|5272987_5273206_+|transposase	ISSfl3 transposase	transposase	NA	NA	NA	NA
BBF50813.1|5273202_5273550_+|transposase	ISSfl3 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
BBF50814.1|5273569_5275018_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	55.3	3.9e-136
BBF50815.1|5275871_5276405_-	PagC-like membrane protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.2e-15
BBF50816.1|5277721_5278519_+|transposase	transposase	transposase	NA	NA	NA	NA
BBF50817.1|5278558_5279446_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF50818.1|5279445_5279772_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF50819.1|5279865_5280156_+|transposase	IS609 transposase	transposase	A0A1W6JP07	Morganella_phage	99.0	7.2e-42
5283523:5283552	attR	GCCTGATGCGCTACGCTTATCAGGCCTACA	NA	NA	NA	NA
>prophage 29
AP018796	Escherichia coli E2855 DNA, complete genome	5470440	5344377	5404804	5470440	integrase,protease,transposase	Escherichia_phage(58.33%)	55	5337135:5337155	5380485:5380505
5337135:5337155	attL	GGGAGAGGGTTAGGGTGAGGG	NA	NA	NA	NA
BBF50876.1|5344377_5345088_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	42.7	1.8e-41
BBF50877.1|5345091_5345754_+	hypothetical protein	NA	NA	NA	NA	NA
BBF50878.1|5346267_5347185_-	hypothetical protein	NA	NA	NA	NA	NA
BBF50879.1|5347177_5347951_-	hypothetical protein	NA	NA	NA	NA	NA
BBF50880.1|5348530_5349880_-	hypothetical protein	NA	NA	NA	NA	NA
BBF50881.1|5349998_5352083_-|protease	ATP-dependent Lon protease	protease	NA	NA	NA	NA
BBF50882.1|5352093_5354691_-	alkaline phosphatase	NA	NA	NA	NA	NA
BBF50883.1|5354867_5358542_-	hypothetical protein	NA	NA	NA	NA	NA
BBF50884.1|5358587_5362229_-	ATPase-like protein	NA	NA	NA	NA	NA
BBF50885.1|5362240_5362843_-	hypothetical protein	NA	NA	NA	NA	NA
BBF50886.1|5362839_5363445_-	membrane protein	NA	NA	NA	NA	NA
BBF50887.1|5363738_5364425_+	hypothetical protein	NA	NA	NA	NA	NA
BBF50888.1|5364552_5364735_+	hypothetical protein	NA	NA	NA	NA	NA
BBF50889.1|5364845_5365718_-	restriction endonuclease	NA	NA	NA	NA	NA
BBF50890.1|5365929_5366910_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	9.4e-102
BBF50891.1|5366974_5368081_-	N-acetylneuraminic acid mutarotase	NA	NA	NA	NA	NA
BBF50892.1|5368100_5368817_-	N-acetylneuraminic acid outer membrane channel protein	NA	NA	NA	NA	NA
BBF50893.1|5370272_5370875_+	type 1 fimbriae regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	51.8	1.5e-54
BBF50894.1|5371352_5371949_+	type 1 fimbriae regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
BBF50895.1|5372429_5372978_+	major type 1 subunit fimbrin	NA	NA	NA	NA	NA
BBF50896.1|5373135_5373582_+	fimbrial protein involved in type 1 pilus biosynthesis	NA	NA	NA	NA	NA
BBF50897.1|5373618_5374344_+	periplasmic chaperone	NA	NA	NA	NA	NA
BBF50898.1|5374410_5377164_+	outer membrane usher protein FimD	NA	A0A0N7C1Y0	Escherichia_phage	100.0	2.5e-43
BBF50899.1|5376970_5377858_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF50900.1|5377857_5378184_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF50901.1|5378370_5378901_+	minor component of type 1 fimbriae	NA	NA	NA	NA	NA
BBF50902.1|5378913_5379417_+	minor component of type 1 fimbriae	NA	NA	NA	NA	NA
BBF50903.1|5379436_5380339_+	minor component of type 1 fimbriae	NA	NA	NA	NA	NA
BBF50904.1|5380360_5380684_+	hypothetical protein	NA	NA	NA	NA	NA
5380485:5380505	attR	CCCTCACCCTAACCCTCTCCC	NA	NA	NA	NA
BBF50905.1|5380588_5381932_-	fructuronate transporter	NA	NA	NA	NA	NA
BBF50906.1|5382271_5383456_+	mannonate hydrolase	NA	NA	NA	NA	NA
BBF50907.1|5383536_5384997_+	NAD-dependent D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	7.3e-50
BBF50908.1|5385018_5385213_-	hypothetical protein	NA	NA	NA	NA	NA
BBF50909.1|5385259_5385985_+	fructuronate-inducible hexuronate regulon transcriptional repressor	NA	NA	NA	NA	NA
BBF50910.1|5386125_5386956_-	hypothetical protein	NA	NA	NA	NA	NA
BBF50911.1|5387628_5388021_+	DNA replication protein IraD	NA	NA	NA	NA	NA
BBF50912.1|5388013_5388925_-	hypochlorite-responsive transcription factor	NA	NA	NA	NA	NA
BBF50913.1|5388989_5390162_-	isoaspartyl dipeptidase	NA	NA	NA	NA	NA
BBF50914.1|5390174_5390636_-	SpmB family inner membrane protein	NA	NA	NA	NA	NA
BBF50915.1|5390632_5391316_-	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
BBF50916.1|5391565_5392120_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
BBF50917.1|5392132_5392516_-	transport protein	NA	NA	NA	NA	NA
BBF50918.1|5392479_5393310_-	transport protein	NA	NA	NA	NA	NA
BBF50919.1|5393377_5394349_-	hypothetical protein	NA	NA	NA	NA	NA
BBF50920.1|5394302_5394560_-	hypothetical protein	NA	NA	NA	NA	NA
BBF50921.1|5394556_5395324_-	activator of (R)-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
BBF50922.1|5395333_5396485_-	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
BBF50923.1|5396600_5397881_-	zinc-type alcohol dehydrogenase-like protein	NA	NA	NA	NA	NA
BBF50924.1|5397921_5399154_-	multidrug efflux system protein	NA	NA	NA	NA	NA
BBF50925.1|5399620_5400577_+	hypothetical protein	NA	Q2A0A7	Sodalis_phage	51.2	1.7e-60
BBF50926.1|5400821_5402234_-	transcriptional regulator/aminotransferase	NA	NA	NA	NA	NA
BBF50927.1|5402410_5402575_+	hypothetical protein	NA	NA	NA	NA	NA
BBF50928.1|5402926_5403565_+	penicillin G acylase precursor	NA	NA	NA	NA	NA
BBF50929.1|5403590_5403917_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	99.1	3.7e-55
BBF50930.1|5403916_5404804_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
>prophage 1
AP018797	Escherichia coli E2855 plasmid pE2855-1 DNA, complete genome	125200	2307	32308	125200	transposase	Escherichia_phage(33.33%)	35	NA	NA
BBF50995.1|2307_3495_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF50996.1|3494_3860_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF50997.1|3878_4169_+	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.4	4.8e-14
BBF50998.1|4178_4724_+	hypothetical protein	NA	NA	NA	NA	NA
BBF50999.1|4966_5212_+	hypothetical protein	NA	NA	NA	NA	NA
BBF51000.1|5134_5320_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51001.1|5375_5978_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51002.1|6331_6637_+	hypothetical protein	NA	NA	NA	NA	NA
BBF51003.1|6605_9194_-|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	75.4	0.0e+00
BBF51004.1|9326_10031_-|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
BBF51005.1|10100_10433_+	DNA-invertase	NA	Q1MVP4	Enterobacteria_phage	100.0	3.0e-52
BBF51006.1|10615_11476_+	TEM-1 beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
BBF51007.1|12060_12765_+|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
BBF51008.1|12826_13534_+	plasmid replication protein A	NA	NA	NA	NA	NA
BBF51009.1|13520_14438_+	plasmid replication protein C	NA	NA	NA	NA	NA
BBF51010.1|14678_15494_+	sulfonamide-resistant dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
BBF51011.1|15554_16358_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
BBF51012.1|16357_17194_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
BBF51013.1|17254_17959_-|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
BBF51014.1|18109_18925_+	aminoglycoside 3'-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
BBF51015.1|19114_19819_-|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
BBF51016.1|19865_21134_-|transposase	transposase	transposase	NA	NA	NA	NA
BBF51017.1|21208_21916_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51018.1|21912_22149_-	mercury resistance protein MerE	NA	NA	NA	NA	NA
BBF51019.1|22145_22508_-	mercuric resistance operon coregulator MerD	NA	NA	NA	NA	NA
BBF51020.1|22525_24220_-	mercuric reductase MerA	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
BBF51021.1|24271_24694_-	mercury transport protein MerC	NA	NA	NA	NA	NA
BBF51022.1|24729_25005_-	mercuric transport protein periplasmic component precursor MerP	NA	NA	NA	NA	NA
BBF51023.1|25018_25369_-	mercuric ion transport protein MerT	NA	NA	NA	NA	NA
BBF51024.1|25440_25875_+	mercuric resistance operon regulatory protein MerR	NA	NA	NA	NA	NA
BBF51025.1|26877_27120_+|transposase	transposase	transposase	NA	NA	NA	NA
BBF51026.1|27151_27829_-	tetracycline repressor protein TetR	NA	NA	NA	NA	NA
BBF51027.1|27907_29107_+	tetracycline resistance structural protein TetA	NA	NA	NA	NA	NA
BBF51028.1|29138_30023_-	transporter permease protein	NA	NA	NA	NA	NA
BBF51029.1|30511_32308_+|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
>prophage 1
AP018798	Escherichia coli E2855 plasmid pE2855-2 DNA, complete genome	94446	206	94048	94446	transposase,lysis,tail	Escherichia_phage(67.29%)	116	NA	NA
BBF51130.1|206_428_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	94.5	1.0e-32
BBF51131.1|447_843_+	hypothetical protein	NA	NA	NA	NA	NA
BBF51132.1|839_1871_+	recombinase	NA	A0A077SLE7	Escherichia_phage	98.8	5.4e-193
BBF51133.1|1921_2233_+	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	92.2	3.1e-43
BBF51134.1|2473_3532_-	hypothetical protein	NA	A0A077SLI1	Escherichia_phage	76.6	6.5e-141
BBF51135.1|3528_3750_-	ash family protein	NA	Q38557	Escherichia_phage	82.2	1.3e-30
BBF51136.1|4343_4985_+	hypothetical protein	NA	Q71TG2	Escherichia_phage	98.6	6.3e-115
BBF51137.1|5060_7985_-	hypothetical protein	NA	Q71TG1	Escherichia_phage	93.5	0.0e+00
BBF51138.1|7987_9973_-	adenine-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	60.2	3.8e-203
BBF51139.1|10117_10366_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
BBF51140.1|10649_12389_+	hypothetical protein	NA	A0A1B0V850	Salmonella_phage	99.3	0.0e+00
BBF51141.1|12381_13401_+	hypothetical protein	NA	Q1MVN5	Enterobacteria_phage	100.0	3.9e-183
BBF51142.1|13692_14250_-|lysis	phage lysis protein	lysis	Q71TF3	Escherichia_phage	99.5	1.6e-106
BBF51143.1|14419_14908_+	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	98.8	2.5e-87
BBF51144.1|15141_16254_-	outer membrane porin protein	NA	Q1MVN1	Enterobacteria_phage	96.0	4.6e-198
BBF51145.1|16995_17307_-	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.8e-46
BBF51146.1|17296_20284_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.3	0.0e+00
BBF51147.1|20296_20662_-	hypothetical protein	NA	A0A077SK35	Escherichia_phage	100.0	7.9e-46
BBF51148.1|20658_22578_-	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	95.8	0.0e+00
BBF51149.1|22579_23182_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
BBF51150.1|23168_23612_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
BBF51151.1|23608_23938_-	hypothetical protein	NA	Q37876	Escherichia_phage	100.0	1.3e-52
BBF51152.1|23966_24203_+|tail	phage tail fiber assembly protein	tail	A0A222YXY8	Escherichia_phage	80.8	4.9e-25
BBF51153.1|24692_25265_+	hypothetical protein	NA	NA	NA	NA	NA
BBF51154.1|25308_25887_-|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
BBF51155.1|25886_28736_-|tail	phage tail fiber protein	tail	Q71TP5	Escherichia_phage	93.9	0.0e+00
BBF51156.1|28747_29182_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
BBF51157.1|29260_30097_-	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	98.9	1.7e-152
BBF51158.1|30096_31530_-	hypothetical protein	NA	A0A1B0VAD6	Salmonella_phage	100.0	3.7e-272
BBF51159.1|31526_31883_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
BBF51160.1|31882_35215_-	DNA transfer protein	NA	A0A077SK38	Escherichia_phage	89.9	0.0e+00
BBF51161.1|35296_36178_-	hypothetical protein	NA	A0A1B0VBL3	Salmonella_phage	99.7	3.7e-174
BBF51162.1|36192_36804_-	hypothetical protein	NA	A0A1B0VFV3	Salmonella_phage	98.5	2.1e-107
BBF51163.1|36814_37381_-	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	97.9	1.6e-98
BBF51164.1|37497_37917_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51165.1|37968_38616_-	hypothetical protein	NA	Q71TC4	Escherichia_phage	90.5	6.3e-14
BBF51166.1|39043_39265_+	ash family protein	NA	A0A077SLM6	Escherichia_phage	98.6	1.1e-37
BBF51167.1|39261_40305_+	hypothetical protein	NA	Q71TN2	Escherichia_phage	93.1	2.7e-176
BBF51168.1|40468_41269_+	hypothetical protein	NA	A0A077SL47	Escherichia_phage	100.0	1.4e-148
BBF51169.1|41334_42144_+	hypothetical protein	NA	Q71TB9	Escherichia_phage	97.8	1.2e-142
BBF51170.1|42312_43017_+	hypothetical protein	NA	Q71TB8	Escherichia_phage	99.6	7.9e-135
BBF51171.1|43016_43481_+	hypothetical protein	NA	Q71TB7	Escherichia_phage	97.4	1.5e-86
BBF51172.1|43647_43944_-	hypothetical protein	NA	Q71TM6	Escherichia_phage	91.8	8.9e-48
BBF51173.1|44028_44538_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	99.4	1.1e-90
BBF51174.1|44549_44900_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	96.3	9.2e-52
BBF51175.1|44842_45013_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.9	1.3e-19
BBF51176.1|45165_45981_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
BBF51177.1|45990_47580_-	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	99.2	6.2e-305
BBF51178.1|47640_49347_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
BBF51179.1|49571_50573_-	plasmid partition protein B	NA	Q38420	Escherichia_phage	99.7	3.7e-178
BBF51180.1|50589_51786_-	plasmid partition protein A	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
BBF51181.1|51954_52326_-	hypothetical protein	NA	A0A077SK46	Escherichia_phage	97.6	1.6e-65
BBF51182.1|52428_52764_-	hypothetical protein	NA	A0A077SK46	Escherichia_phage	99.1	1.1e-62
BBF51183.1|53056_53941_-	replication protein RepFIB	NA	A0A1B0VDL5	Salmonella_phage	99.7	1.4e-160
BBF51184.1|54274_54667_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
BBF51185.1|54844_55267_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
BBF51186.1|55656_56064_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF51187.1|56029_56845_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF51188.1|56844_57210_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF51189.1|57244_57925_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	96.2	4.0e-91
BBF51190.1|58387_58672_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
BBF51191.1|58664_59570_+	recombination-associated protein rdgC	NA	A0A077SK17	Escherichia_phage	99.3	5.9e-159
BBF51192.1|59566_62854_+	DNA adenine methyltransferase	NA	A0A077SL51	Escherichia_phage	98.6	0.0e+00
BBF51193.1|64009_64138_+	hypothetical protein	NA	NA	NA	NA	NA
BBF51194.1|64646_64772_+	hypothetical protein	NA	NA	NA	NA	NA
BBF51195.1|64811_65699_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF51196.1|65698_66025_-|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF51197.1|66030_66210_-	hypothetical protein	NA	Q71T91	Escherichia_phage	100.0	1.3e-17
BBF51198.1|66211_66997_-	hypothetical protein	NA	A0A077SLJ8	Escherichia_phage	98.9	3.0e-143
BBF51199.1|66983_67712_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
BBF51200.1|67715_68933_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
BBF51201.1|68942_69203_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	1.6e-45
BBF51202.1|69466_69712_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
BBF51203.1|69714_70293_+	hypothetical protein	NA	Q71T85	Escherichia_phage	99.5	4.4e-107
BBF51204.1|70359_70515_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	96.1	2.7e-19
BBF51205.1|71016_71643_+	hypothetical protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
BBF51206.1|71639_72317_+	serine/threonine-specific protein phosphatase 1	NA	A0A077SLQ6	Escherichia_phage	99.6	7.6e-135
BBF51207.1|72313_73015_+	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
BBF51208.1|73096_73315_+	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
BBF51209.1|73316_74579_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	100.0	5.4e-235
BBF51210.1|74651_75158_+	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	99.4	6.3e-94
BBF51211.1|75352_76081_+	morphogenetic protein	NA	Q71T76	Escherichia_phage	99.1	4.9e-140
BBF51212.1|76164_76368_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	6.8e-31
BBF51213.1|76360_76600_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	92.4	2.0e-34
BBF51214.1|76596_77298_+	hypothetical protein	NA	A0A0U2QW67	Escherichia_phage	54.3	7.0e-51
BBF51215.1|77294_77585_+	hypothetical protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
BBF51216.1|77581_78316_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	54.0	6.5e-39
BBF51217.1|78312_78612_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	99.0	1.3e-57
BBF51218.1|78613_79099_+	hypothetical protein	NA	A5VWB3	Enterobacteria_phage	88.9	3.1e-45
BBF51219.1|79100_79310_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	92.8	2.0e-33
BBF51220.1|79306_79669_+	putative phage protein	NA	A0A1B0V865	Salmonella_phage	98.3	4.0e-58
BBF51221.1|79668_79845_+	hypothetical protein	NA	A0A0F6TJP6	Escherichia_coli_O157_typing_phage	84.5	3.9e-19
BBF51222.1|79841_80030_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
BBF51223.1|80031_80547_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	100.0	2.4e-101
BBF51224.1|80543_81113_+	putative phage protein	NA	G9L6B4	Escherichia_phage	95.7	1.4e-102
BBF51225.1|81103_81361_+	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	97.6	2.0e-40
BBF51226.1|81360_81642_+	RNA-binding protein	NA	A0A077SLL0	Escherichia_phage	100.0	3.4e-49
BBF51227.1|81665_81959_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	99.0	4.2e-50
BBF51228.1|81965_82340_+	hypothetical protein	NA	A0A077SL57	Escherichia_phage	100.0	1.2e-68
BBF51229.1|82321_82996_+	hypothetical protein	NA	A0A077SK55	Escherichia_phage	97.6	1.1e-114
BBF51230.1|82992_83355_+	hypothetical protein	NA	A0A1B0VBR1	Salmonella_phage	99.2	2.2e-56
BBF51231.1|83430_83568_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51232.1|84430_84787_-	hypothetical protein	NA	A0A1B0VCG1	Salmonella_phage	99.2	3.1e-63
BBF51233.1|84787_85372_-	hypothetical protein	NA	Q1MVE8	Enterobacteria_phage	99.0	1.5e-110
BBF51234.1|85546_85936_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	99.2	6.4e-70
BBF51235.1|86008_86230_+	hypothetical protein	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
BBF51236.1|86229_86610_+	death on curing protein	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
BBF51237.1|86614_86794_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
BBF51238.1|86821_87865_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	99.7	1.1e-206
BBF51239.1|87953_88406_+	hypothetical protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
BBF51240.1|88491_89685_+	hypothetical protein	NA	A0A077SL59	Escherichia_phage	96.0	1.7e-174
BBF51241.1|89684_91169_+	phage DNA packaging protein	NA	Q71T61	Escherichia_phage	99.8	2.1e-291
BBF51242.1|91165_91729_+	hypothetical protein	NA	Q38557	Escherichia_phage	80.3	4.1e-25
BBF51243.1|91725_92844_+	phage antirepressor protein	NA	A0A077SLR9	Escherichia_phage	89.0	8.3e-179
BBF51244.1|92876_93728_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	1.0e-157
BBF51245.1|93838_94048_-	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
>prophage 1
AP018799	Escherichia coli E2855 plasmid pE2855-3 DNA, complete genome	92697	1797	33939	92697	integrase,protease,transposase	Escherichia_phage(40.0%)	35	NA	NA
BBF51247.1|1797_2451_+|protease	CAAX amino terminal protease family protein	protease	NA	NA	NA	NA
BBF51248.1|2543_2801_+	stable plasmid inheritance protein PemI	NA	NA	NA	NA	NA
BBF51249.1|2802_3135_+	toxin of the ChpB-ChpS toxin-antitoxin system	NA	NA	NA	NA	NA
BBF51250.1|3219_6186_-|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
BBF51251.1|6188_6749_-	DNA-invertase	NA	A0A1B0V7I5	Salmonella_phage	87.9	1.3e-50
BBF51252.1|6971_7676_-|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
BBF51253.1|7794_8196_+	DNA-invertase	NA	Q1MVP4	Enterobacteria_phage	100.0	4.9e-65
BBF51254.1|8378_9239_+	TEM-1 beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
BBF51255.1|9515_10826_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51256.1|11164_11842_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51257.1|11838_12399_-	multidrug resistance protein MdtH	NA	NA	NA	NA	NA
BBF51258.1|12395_14039_-	phosphoethanolamine transferase MCR-5	NA	NA	NA	NA	NA
BBF51259.1|14057_14600_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51260.1|14740_15445_+|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
BBF51261.1|16186_16951_-|transposase	IS6100 transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
BBF51262.1|17177_17483_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51263.1|17493_18699_-	putative chromate transport protein	NA	NA	NA	NA	NA
BBF51264.1|18854_19058_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51265.1|19185_20025_-	sulfonamide-resistant dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
BBF51266.1|20018_20366_-	multidrug efflux protein	NA	NA	NA	NA	NA
BBF51267.1|20571_21360_-	aminoglycoside adenylyltransferase	NA	NA	NA	NA	NA
BBF51268.1|21490_22039_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	34.1	4.4e-16
BBF51269.1|22121_23135_+|integrase	integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
BBF51270.1|23382_24087_-|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
BBF51271.1|24123_24546_-	erythromycin resistance repressor protein	NA	NA	NA	NA	NA
BBF51272.1|24545_25784_-	erythromycin resistance regulator protein	NA	NA	NA	NA	NA
BBF51273.1|25780_26686_-	macrolide 2'-phosphotransferase I	NA	NA	NA	NA	NA
BBF51274.1|26807_27512_-|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
BBF51275.1|27548_28676_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51276.1|28726_28954_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51277.1|29650_30193_-	Tunicamycin resistance protein	NA	NA	NA	NA	NA
BBF51278.1|30205_31066_-	aminoglycoside N3'-acetyltransferase	NA	NA	NA	NA	NA
BBF51279.1|31208_32177_+|transposase	IS10 transposase	transposase	A4KWT9	Enterobacteria_phage	100.0	2.5e-187
BBF51280.1|32280_33201_+|transposase	IS10 transposase	transposase	A4KWT9	Enterobacteria_phage	100.0	2.7e-175
BBF51281.1|33234_33939_-|transposase	IS26 transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 1
AP018800	Escherichia coli E2855 plasmid pE2855-4 DNA, complete genome	81004	3563	59718	81004	protease,transposase	Escherichia_phage(28.57%)	62	NA	NA
BBF51357.1|3563_5684_+	hemolysin B	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
BBF51358.1|5687_7127_+	hemolysin D	NA	NA	NA	NA	NA
BBF51359.1|7253_7871_-|transposase	ISEc48 transposase	transposase	Q9ZXG3	Shigella_phage	67.5	8.0e-75
BBF51360.1|7945_9484_-|transposase	ISEc8 transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	3.8e-299
BBF51361.1|9533_9767_-|transposase	ISEc8 transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	3.8e-38
BBF51362.1|9878_10259_-	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BBF51363.1|10408_10969_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
BBF51364.1|11071_11932_-	hypothetical protein	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
BBF51365.1|11990_12737_-	conjugal transfer protein TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	7.1e-09
BBF51366.1|12756_18027_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
BBF51367.1|18026_20180_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
BBF51368.1|20432_21164_-	complement resistance protein precursor TraT	NA	NA	NA	NA	NA
BBF51369.1|21177_21687_-	surface exclusion protein TraS	NA	NA	NA	NA	NA
BBF51370.1|21683_23204_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
BBF51371.1|23403_23730_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF51372.1|23729_24617_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF51373.1|24619_25822_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
BBF51374.1|25818_26502_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
BBF51375.1|26507_27098_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
BBF51376.1|27087_28515_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
BBF51377.1|28514_29243_-	conjugal transfer protein TraK	NA	NA	NA	NA	NA
BBF51378.1|29229_29796_-	conjugal transfer protein TraE	NA	NA	NA	NA	NA
BBF51379.1|29817_30129_-	conjugal transfer protein TraL	NA	NA	NA	NA	NA
BBF51380.1|30143_30503_-	conjugal transfer protein TraA	NA	NA	NA	NA	NA
BBF51381.1|30535_30931_-	conjugal transfer protein Y TraY	NA	NA	NA	NA	NA
BBF51382.1|31029_31719_-	conjugal transfer protein TraJ	NA	NA	NA	NA	NA
BBF51383.1|31905_32289_-	conjugal transfer protein TraM	NA	NA	NA	NA	NA
BBF51384.1|32702_32951_+	hypothetical protein	NA	NA	NA	NA	NA
BBF51385.1|32972_33212_+	hypothetical protein	NA	NA	NA	NA	NA
BBF51386.1|33508_34330_-	hypothetical protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
BBF51387.1|34450_34738_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51388.1|35663_35876_-	modulator of Hok protein	NA	NA	NA	NA	NA
BBF51389.1|36097_36817_-	plasmid SOS inhibition protein PsiA	NA	NA	NA	NA	NA
BBF51390.1|36813_37248_-	plasmid SOS inhibition protein PsiB	NA	NA	NA	NA	NA
BBF51391.1|37302_39261_-	partitioning protein ParB	NA	G8DH78	Emiliania_huxleyi_virus	29.9	6.6e-22
BBF51392.1|39319_39553_-	hypothetical protein	NA	A0A096XUX0	Cronobacter_phage	51.1	3.9e-06
BBF51393.1|39608_40136_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	54.1	4.6e-47
BBF51394.1|40778_41039_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51395.1|41154_41601_-	hypothetical protein	NA	A0A2I7RQ20	Vibrio_phage	43.6	5.5e-17
BBF51396.1|41647_43009_-	hydrolase	NA	NA	NA	NA	NA
BBF51397.1|43060_43291_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51398.1|44328_44520_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51399.1|44516_44939_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51400.1|44985_45411_-	antirestriction protein	NA	NA	NA	NA	NA
BBF51401.1|45660_46026_+|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF51402.1|46025_46199_+|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF51403.1|46280_46646_+|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF51404.1|46645_46819_+|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF51405.1|46900_47266_+|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF51406.1|47265_48453_+|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF51407.1|48559_48931_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	33.9	1.4e-10
BBF51408.1|49315_50242_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51409.1|50490_51450_+	plasmid partition protein	NA	A0A222YXF2	Escherichia_phage	40.6	6.0e-61
BBF51410.1|51449_51845_+	plasmid stable inheritance protein StbB	NA	NA	NA	NA	NA
BBF51411.1|51909_52134_-|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	91.4	2.7e-28
BBF51412.1|52222_52366_-|transposase	IS629 transposase OrfA	transposase	NA	NA	NA	NA
BBF51413.1|52365_52605_-|transposase	IS629 transposase OrfA	transposase	A0A0N7C1Z2	Escherichia_phage	95.8	7.2e-32
BBF51414.1|52804_53194_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51415.1|53237_54122_-	catalase-peroxidase HPI	NA	NA	NA	NA	NA
BBF51416.1|54219_54546_+|transposase	IS629 transposase OrfA	transposase	Q6H9S4	Enterobacteria_phage	97.2	4.1e-54
BBF51417.1|54545_55433_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C035	Escherichia_phage	100.0	1.6e-169
BBF51418.1|55752_59718_+|protease	serine protease EspP	protease	Q9LA58	Enterobacterial_phage	39.9	1.1e-230
>prophage 2
AP018800	Escherichia coli E2855 plasmid pE2855-4 DNA, complete genome	81004	66124	71412	81004	transposase	Stx2-converting_phage(57.14%)	7	NA	NA
BBF51426.1|66124_66586_-	endonuclease	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
BBF51427.1|67160_67679_-	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	99.4	5.0e-94
BBF51428.1|67781_68108_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF51429.1|68107_68995_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF51430.1|69098_69479_+	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
BBF51431.1|69590_69824_+|transposase	ISEc8 transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	3.8e-38
BBF51432.1|69873_71412_+|transposase	ISEc8 transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	3.8e-299
>prophage 1
AP018801	Escherichia coli E2855 plasmid pE2855-5 DNA, complete genome	71289	5204	20487	71289	transposase	Escherichia_phage(50.0%)	20	NA	NA
BBF51447.1|5204_6392_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF51448.1|6391_6757_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF51449.1|6791_7556_-	reverse gyrase	NA	NA	NA	NA	NA
BBF51450.1|7668_8562_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51451.1|9301_9652_-|transposase	IS100 transposase	transposase	A0A2L1IVB6	Escherichia_phage	100.0	2.3e-58
BBF51452.1|9653_10214_+	resolvase ResA	NA	I3WFA4	Macacine_betaherpesvirus	80.6	5.0e-07
BBF51453.1|10526_11714_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF51454.1|11713_12079_-|transposase	IS91 transposase	transposase	NA	NA	NA	NA
BBF51455.1|12416_12692_-	hypothetical protein	NA	NA	NA	NA	NA
BBF51456.1|12685_13330_-	partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
BBF51457.1|13558_14530_+	plasmid partition protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
BBF51458.1|14534_14822_+	plasmid stable inheritance protein StbB	NA	NA	NA	NA	NA
BBF51459.1|14873_15200_+|transposase	IS629 transposase OrfA	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
BBF51460.1|15199_16087_+|transposase	IS629 transposase OrfB	transposase	A0A0N7C1X7	Escherichia_phage	100.0	1.6e-169
BBF51461.1|16244_17516_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.5	5.4e-142
BBF51462.1|17515_17953_-	ImpA protein	NA	A0A1W6JNS2	Morganella_phage	47.6	9.2e-25
BBF51463.1|17949_18198_-	DNA-damage-inducible protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
BBF51464.1|18318_18417_+	hypothetical protein	NA	NA	NA	NA	NA
BBF51465.1|18591_19518_+	hypothetical protein	NA	NA	NA	NA	NA
BBF51466.1|19902_20487_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	29.3	4.1e-12
