The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034483	Rahnella aquatilis strain KM05 chromosome, complete genome	4965689	673992	732918	4965689	tail,head,plate,capsid,integrase,terminase,tRNA,portal	Salmonella_phage(42.11%)	60	670227:670242	718103:718118
670227:670242	attL	GTGGGCGAAGAAAATC	NA	NA	NA	NA
AZP53246.1|673992_675069_-	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	63.2	5.4e-127
AZP49574.1|675288_676500_+|tail	phage tail protein	tail	A0A0M4S6M1	Salmonella_phage	62.5	1.3e-137
AZP49575.1|676514_677030_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	61.4	2.7e-52
AZP49576.1|677077_677365_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	54.1	6.7e-16
AZP53247.1|677385_677532_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZP49577.1|677512_680092_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	27.6	2.4e-72
AZP49578.1|680095_680533_+|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	67.7	2.9e-47
AZP49579.1|680625_680775_-	hypothetical protein	NA	NA	NA	NA	NA
AZP49580.1|680983_681736_+	glycosyltransferase family 25 protein	NA	A0A1V0SBR2	Catovirus	34.5	5.1e-07
AZP49581.1|681739_682258_-|tail	tail fiber assembly protein	tail	Q6K1H1	Salmonella_virus	42.2	5.4e-24
AZP49582.1|682273_683842_-	hypothetical protein	NA	Q858V4	Yersinia_virus	51.6	8.4e-52
AZP49583.1|683843_684467_-|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	49.1	8.7e-45
AZP49584.1|684360_685290_-|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	59.6	7.8e-90
AZP49585.1|685286_685643_-|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	50.0	1.1e-23
AZP49586.1|685642_686251_-|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	56.2	1.1e-57
AZP49587.1|686351_686999_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	47.5	1.3e-46
AZP49588.1|686995_687475_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	48.7	5.5e-39
AZP53248.1|687484_687727_-	hypothetical protein	NA	NA	NA	NA	NA
AZP49589.1|687799_688588_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	47.2	1.0e-58
AZP49590.1|688651_688855_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	61.2	5.9e-19
AZP49591.1|688854_689346_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	51.6	1.1e-37
AZP49592.1|689445_690147_-|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	50.2	1.9e-48
AZP49593.1|690156_691209_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	63.1	6.7e-122
AZP49594.1|691252_692092_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	44.3	2.5e-55
AZP49595.1|692237_693956_+	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	62.5	1.6e-205
AZP49596.1|693956_695042_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	62.2	1.2e-126
AZP49597.1|695532_696135_+	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	54.3	3.4e-54
AZP49598.1|696131_696704_+	hypothetical protein	NA	NA	NA	NA	NA
AZP49599.1|696712_697366_+	hypothetical protein	NA	NA	NA	NA	NA
AZP49600.1|697859_701924_-	hypothetical protein	NA	NA	NA	NA	NA
AZP49601.1|702297_704685_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	57.1	1.5e-209
AZP53249.1|704674_705622_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	53.5	3.8e-84
AZP49602.1|705611_706118_-	hypothetical protein	NA	NA	NA	NA	NA
AZP49603.1|706211_706481_-	hypothetical protein	NA	NA	NA	NA	NA
AZP49604.1|706615_706906_-	hypothetical protein	NA	NA	NA	NA	NA
AZP49605.1|707019_707211_-	hypothetical protein	NA	NA	NA	NA	NA
AZP49606.1|707216_707477_-	hypothetical protein	NA	NA	NA	NA	NA
AZP53250.1|707570_707879_+	XRE family transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	48.9	2.8e-20
AZP49607.1|708032_709010_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	47.8	5.0e-87
AZP49608.1|709253_710678_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AZP49609.1|710688_711597_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
AZP49610.1|711610_713038_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	6.1e-33
AZP49611.1|713039_713663_+	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	39.1	1.1e-07
AZP49612.1|713722_714103_+	DUF3561 family protein	NA	NA	NA	NA	NA
AZP49613.1|714270_714591_+	cell division protein FtsB	NA	NA	NA	NA	NA
AZP49614.1|714593_715313_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZP49615.1|715312_715786_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AZP53252.1|715805_716855_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AZP53251.1|716832_717600_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.7	6.3e-69
AZP49616.1|717589_718216_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	8.8e-37
718103:718118	attR	GTGGGCGAAGAAAATC	NA	NA	NA	NA
AZP53253.1|718476_719481_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.2	2.2e-05
AZP49617.1|719532_720519_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.1	7.1e-33
AZP49618.1|720617_723173_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.7	6.4e-25
AZP49619.1|723595_726256_+	hypothetical protein	NA	NA	NA	NA	NA
AZP49620.1|726410_727514_+	murein transglycosylase B	NA	NA	NA	NA	NA
AZP49621.1|727675_728170_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.7	1.7e-27
AZP49622.1|728277_729342_+	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.6	3.2e-111
AZP49623.1|729462_730152_+	recombination regulator RecX	NA	NA	NA	NA	NA
AZP49624.1|730071_730353_-	hypothetical protein	NA	NA	NA	NA	NA
AZP49625.1|730290_732918_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.8	5.5e-80
>prophage 2
CP034483	Rahnella aquatilis strain KM05 chromosome, complete genome	4965689	742734	783913	4965689	tail,plate,tRNA	Erwinia_phage(36.0%)	40	NA	NA
AZP49635.1|742734_743508_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AZP49636.1|743556_743904_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZP49637.1|743995_744175_-	late control protein B	NA	F1BUT0	Erwinia_phage	75.5	6.4e-17
AZP49638.1|744239_745340_-|tail	phage tail protein	tail	Q6K1G4	Salmonella_virus	43.9	4.4e-84
AZP49639.1|745342_745813_-|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	50.0	1.7e-37
AZP49640.1|745809_747441_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	28.6	1.2e-16
AZP49641.1|747433_747568_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	78.9	6.7e-11
AZP49642.1|747588_747876_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	60.9	4.3e-23
AZP49643.1|747935_748445_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	68.4	3.1e-64
AZP49644.1|748459_749629_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	80.5	8.4e-182
AZP49645.1|749770_750319_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	42.1	2.7e-34
AZP49646.1|750315_751692_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	60.9	5.4e-63
AZP49647.1|751703_752231_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	69.2	5.6e-69
AZP49648.1|752223_753132_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	75.8	8.4e-121
AZP49649.1|753137_753488_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	63.8	9.9e-38
AZP49650.1|753484_754126_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	60.4	6.4e-67
AZP49651.1|754207_754669_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	43.3	1.1e-23
AZP49652.1|754761_755190_-	transcriptional regulator	NA	F1BUQ1	Erwinia_phage	48.3	1.4e-06
AZP49653.1|755190_755700_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	61.1	1.5e-55
AZP49654.1|755680_755902_-	hypothetical protein	NA	NA	NA	NA	NA
AZP49655.1|755892_756096_-|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	56.7	8.6e-18
AZP49656.1|756307_756502_-	hypothetical protein	NA	NA	NA	NA	NA
AZP49657.1|756650_758543_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	50.3	7.0e-178
AZP49658.1|758636_758858_-	conjugal transfer protein TraR	NA	A0A1S6L007	Salmonella_phage	44.3	4.6e-09
AZP49659.1|758857_759133_-	hypothetical protein	NA	NA	NA	NA	NA
AZP49660.1|759265_759856_+	CI repressor	NA	Q6K1G0	Salmonella_virus	51.3	1.8e-52
AZP49661.1|760144_761221_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.3	3.9e-85
AZP49662.1|761227_762349_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AZP49663.1|762426_763581_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AZP49664.1|763892_764237_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AZP49665.1|764518_765253_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AZP49666.1|765383_766361_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AZP49667.1|766360_767098_+	polyphenol oxidase	NA	NA	NA	NA	NA
AZP49668.1|767228_769802_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.1	2.2e-126
AZP49669.1|775631_776930_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.3	2.9e-42
AZP49670.1|777119_778478_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AZP49671.1|778559_781280_-	bifunctional acyl-CoA synthetase/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZP49672.1|781311_782016_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AZP49673.1|782145_782565_-	thioredoxin TrxC	NA	A0A191VYI2	Roseobacter_phage	34.4	4.5e-13
AZP49674.1|782809_783913_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
CP034483	Rahnella aquatilis strain KM05 chromosome, complete genome	4965689	1961917	1972179	4965689		Enterobacteria_phage(37.5%)	9	NA	NA
AZP50676.1|1961917_1962559_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.9	3.2e-34
AZP50677.1|1962596_1963178_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	1.5e-30
AZP50678.1|1963221_1965072_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AZP50679.1|1965150_1966740_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.6	8.2e-39
AZP50680.1|1967202_1968090_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.9	1.2e-60
AZP50681.1|1968205_1969078_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.6	1.0e-107
AZP50682.1|1969097_1970162_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	1.7e-101
AZP50683.1|1970773_1971310_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.0	5.5e-56
AZP50684.1|1971306_1972179_+	dTDP-4-dehydrorhamnose reductase	NA	K7QJU0	Escherichia_phage	37.5	6.3e-41
>prophage 4
CP034483	Rahnella aquatilis strain KM05 chromosome, complete genome	4965689	2769497	2798259	4965689	tail,holin,head,capsid,integrase,terminase,transposase,portal	Cronobacter_phage(76.0%)	34	2770072:2770086	2805383:2805397
AZP51349.1|2769497_2769938_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	44.1	1.1e-20
2770072:2770086	attL	ACCTGAACGTTGACG	NA	NA	NA	NA
AZP51350.1|2772647_2773235_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	73.3	3.5e-80
AZP51351.1|2773227_2774412_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	73.6	1.2e-162
AZP51352.1|2774404_2774737_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	71.7	9.1e-33
AZP51353.1|2774736_2777046_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	45.0	1.4e-164
AZP51354.1|2777233_2777491_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	55.8	1.7e-18
AZP51355.1|2777487_2777667_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	60.0	3.6e-12
AZP51356.1|2777611_2777986_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	54.4	1.3e-22
AZP51357.1|2777982_2778324_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	79.2	1.2e-43
AZP51358.1|2778320_2778617_-|holin	holin	holin	C7BGD7	Burkholderia_phage	55.3	7.9e-20
AZP51359.1|2778630_2779083_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	65.1	1.6e-51
AZP51360.1|2779085_2780213_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	70.1	3.0e-144
AZP51361.1|2780908_2781415_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.8	5.3e-40
AZP51362.1|2781411_2781864_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	61.3	2.0e-46
AZP51363.1|2781957_2782149_-	hypothetical protein	NA	NA	NA	NA	NA
AZP51364.1|2782145_2782859_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	60.3	1.8e-73
AZP51365.1|2782861_2783896_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	75.4	1.1e-137
AZP53329.1|2783962_2784802_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	52.2	1.3e-43
AZP51366.1|2784942_2786730_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	71.5	6.2e-253
AZP51367.1|2786726_2787758_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	66.2	6.1e-136
AZP51368.1|2787754_2788069_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	54.9	4.3e-24
AZP51369.1|2788051_2788258_-	hypothetical protein	NA	NA	NA	NA	NA
AZP51370.1|2788360_2790517_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	64.4	2.6e-245
AZP51371.1|2790517_2790778_-	DUF2732 family protein	NA	NA	NA	NA	NA
AZP51372.1|2790851_2791283_-	hypothetical protein	NA	NA	NA	NA	NA
AZP51373.1|2791290_2791617_-	hypothetical protein	NA	NA	NA	NA	NA
AZP51374.1|2791619_2791823_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
AZP51375.1|2791832_2792342_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	54.1	3.9e-43
AZP51376.1|2792374_2792596_-	regulator	NA	NA	NA	NA	NA
AZP51377.1|2792723_2793287_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	37.0	2.0e-32
AZP51378.1|2793321_2794242_+	hypothetical protein	NA	NA	NA	NA	NA
AZP51379.1|2794281_2795331_+	hypothetical protein	NA	NA	NA	NA	NA
AZP51380.1|2795422_2796478_+|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	56.4	2.7e-107
AZP51381.1|2797139_2798259_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.0	7.3e-50
2805383:2805397	attR	CGTCAACGTTCAGGT	NA	NA	NA	NA
>prophage 5
CP034483	Rahnella aquatilis strain KM05 chromosome, complete genome	4965689	4004469	4087747	4965689	tail,holin,protease,head,plate,capsid,lysis,integrase,terminase,tRNA,portal,coat	Erwinia_phage(42.86%)	84	4050839:4050863	4085424:4085448
AZP52425.1|4004469_4004988_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AZP52426.1|4004996_4005542_+	SCPU domain-containing protein	NA	NA	NA	NA	NA
AZP52427.1|4005561_4006359_+	molecular chaperone	NA	NA	NA	NA	NA
AZP52428.1|4006377_4008825_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AZP52429.1|4008821_4009790_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AZP52430.1|4009845_4010325_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
AZP52431.1|4010434_4011088_-	DNA oxidative demethylase AlkB	NA	A0A0H3Y8P5	Apricot_vein_clearing_associated_virus	33.7	7.1e-05
AZP52432.1|4011225_4012044_+	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
AZP52433.1|4012105_4013443_-	glucarate dehydratase	NA	NA	NA	NA	NA
AZP53385.1|4013471_4014812_-	glucarate dehydratase	NA	NA	NA	NA	NA
AZP52434.1|4014811_4016185_-	MFS transporter	NA	NA	NA	NA	NA
AZP52435.1|4016411_4017572_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
AZP52436.1|4017809_4019261_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.7	3.9e-27
AZP52437.1|4019468_4020983_-	dGTPase	NA	NA	NA	NA	NA
AZP52438.1|4021166_4021871_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AZP52439.1|4021870_4022683_+	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
AZP52440.1|4023008_4023254_+	hypothetical protein	NA	NA	NA	NA	NA
AZP53386.1|4023361_4023706_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.7e-27
AZP52441.1|4023809_4025273_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
AZP52442.1|4025459_4026740_+	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AZP52443.1|4026843_4028832_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
AZP52444.1|4028828_4029731_-	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
AZP52445.1|4029732_4030545_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	1.3e-11
AZP52446.1|4030640_4032863_-	ferrichrome porin FhuA	NA	NA	NA	NA	NA
AZP52447.1|4033159_4035793_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
AZP53387.1|4035983_4038428_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	31.1	1.9e-42
AZP52448.1|4038524_4039067_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AZP52449.1|4039115_4039850_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AZP52450.1|4040080_4040536_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AZP52451.1|4040598_4041474_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AZP52452.1|4041606_4043313_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	37.4	1.0e-26
AZP52453.1|4043309_4043789_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AZP52454.1|4043794_4045180_-	two-component system sensor histidine kinase QseC	NA	NA	NA	NA	NA
AZP52455.1|4045176_4045863_-	response regulator	NA	NA	NA	NA	NA
AZP52456.1|4046021_4046816_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
AZP52457.1|4046830_4047685_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AZP52458.1|4047793_4048174_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AZP52459.1|4048317_4049088_-	ABC transporter permease	NA	NA	NA	NA	NA
AZP52460.1|4049087_4050011_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.3	1.2e-21
AZP52461.1|4050146_4050803_+	carbonate dehydratase	NA	NA	NA	NA	NA
4050839:4050863	attL	AAGGCACAAAAATGTGCCTTTTTTA	NA	NA	NA	NA
AZP52462.1|4050951_4051959_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	58.2	4.9e-114
AZP52463.1|4052034_4052334_-	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	70.7	4.3e-34
AZP52464.1|4052442_4052715_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	69.2	1.3e-32
AZP52465.1|4052751_4053087_+	hypothetical protein	NA	NA	NA	NA	NA
AZP52466.1|4053070_4053259_-	hypothetical protein	NA	NA	NA	NA	NA
AZP52467.1|4053399_4053564_+	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	62.2	3.9e-05
AZP53388.1|4053604_4053898_+	hypothetical protein	NA	NA	NA	NA	NA
AZP52468.1|4053964_4054147_+	DUF2732 family protein	NA	Q6K1F6	Salmonella_virus	51.7	2.5e-08
AZP52469.1|4054146_4054371_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	50.7	1.3e-11
AZP52470.1|4054450_4056703_+	replication endonuclease	NA	S4TTC1	Salmonella_phage	55.0	1.0e-231
AZP52471.1|4056707_4057607_-	hypothetical protein	NA	NA	NA	NA	NA
AZP52472.1|4058659_4060432_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AZP52473.1|4060896_4061349_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZP52474.1|4061561_4063124_-	diguanylate cyclase	NA	NA	NA	NA	NA
AZP52475.1|4063333_4064365_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	80.1	9.4e-161
AZP52476.1|4064366_4066133_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	77.7	1.1e-270
AZP52477.1|4066277_4067129_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	61.8	1.1e-87
AZP52478.1|4067175_4068240_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	74.0	2.2e-144
AZP52479.1|4068251_4068908_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	55.0	3.6e-57
AZP52480.1|4069003_4069474_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	50.7	9.5e-36
AZP52481.1|4069473_4069677_+|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	61.2	3.3e-17
AZP52482.1|4069682_4069892_+	hypothetical protein	NA	F1BUQ4	Erwinia_phage	51.7	1.5e-09
AZP52483.1|4069872_4070382_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	63.9	1.2e-55
AZP52484.1|4070381_4070807_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	48.2	2.8e-26
AZP53389.1|4070751_4070940_+|holin	holin	holin	F1BUQ0	Erwinia_phage	55.7	5.9e-13
AZP52485.1|4070902_4071370_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	67.1	2.9e-53
AZP52486.1|4071362_4071812_+	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	66.7	7.0e-44
AZP52487.1|4071902_4072850_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
AZP52488.1|4072934_4073576_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	58.0	2.8e-62
AZP52489.1|4073572_4073923_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	66.4	9.9e-38
AZP52490.1|4073926_4074835_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	76.5	1.4e-120
AZP52491.1|4074827_4075355_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	76.0	4.0e-75
AZP52492.1|4075364_4077881_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	43.1	1.0e-75
AZP53390.1|4077890_4078346_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	48.5	1.9e-25
AZP52493.1|4078477_4079647_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	77.6	7.3e-178
AZP52494.1|4079660_4080170_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	71.5	6.2e-65
AZP52495.1|4080236_4080518_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	58.9	1.3e-24
AZP52496.1|4080550_4080673_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	76.3	1.4e-10
AZP52497.1|4080665_4083140_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	62.3	1.5e-188
AZP52498.1|4083152_4083623_+|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	61.7	6.0e-46
AZP52499.1|4083619_4084780_+	phage late control D family protein	NA	S4TRX8	Salmonella_phage	68.0	1.6e-145
AZP53391.1|4085099_4085321_+	DNA-binding transcriptional regulator	NA	F1BUT0	Erwinia_phage	68.6	3.1e-21
AZP52500.1|4086273_4086606_+	hypothetical protein	NA	NA	NA	NA	NA
4085424:4085448	attR	AAGGCACAAAAATGTGCCTTTTTTA	NA	NA	NA	NA
AZP52501.1|4087210_4087747_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.3e-17
