The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034481	Rahnella aquatilis strain KM25 chromosome, complete genome	4878783	684937	752091	4878783	tRNA,tail,plate	Erwinia_phage(33.33%)	62	NA	NA
AZP44491.1|684937_685987_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AZP44490.1|685964_686732_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.7	8.2e-69
AZP40906.1|686721_687348_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	8.8e-37
AZP44492.1|687608_688613_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.2	2.2e-05
AZP40907.1|688664_689651_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.1	7.1e-33
AZP40908.1|689749_692305_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.7	4.9e-25
AZP40909.1|692727_695388_+	hypothetical protein	NA	NA	NA	NA	NA
AZP40910.1|695542_696646_+	murein transglycosylase B	NA	NA	NA	NA	NA
AZP40911.1|696807_697302_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.7	1.7e-27
AZP40912.1|697409_698474_+	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.6	3.2e-111
AZP40913.1|698594_699284_+	recombination regulator RecX	NA	NA	NA	NA	NA
AZP40914.1|699203_699485_-	hypothetical protein	NA	NA	NA	NA	NA
AZP40915.1|699422_702050_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.8	5.5e-80
AZP40916.1|702306_702492_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AZP40917.1|703656_704223_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AZP40918.1|704219_704648_+	DedA family protein	NA	NA	NA	NA	NA
AZP40919.1|704733_706305_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AZP40920.1|706462_706978_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AZP40921.1|707047_708337_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AZP40922.1|708353_709145_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AZP40923.1|709309_710671_+	signal recognition particle protein	NA	NA	NA	NA	NA
AZP44493.1|710849_711098_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AZP40924.1|711116_711665_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AZP40925.1|711732_712506_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AZP40926.1|712554_712902_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZP40927.1|712993_713173_-	late control protein B	NA	F1BUT0	Erwinia_phage	75.5	6.4e-17
AZP40928.1|713237_714338_-|tail	phage tail protein	tail	Q6K1G4	Salmonella_virus	43.9	4.4e-84
AZP40929.1|714340_714811_-|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	50.0	1.7e-37
AZP40930.1|714807_716439_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	28.2	7.7e-16
AZP40931.1|716431_716566_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	78.9	6.7e-11
AZP40932.1|716586_716874_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	60.9	4.3e-23
AZP40933.1|716933_717443_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	68.4	3.1e-64
AZP40934.1|717457_718627_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	80.2	1.1e-181
AZP40935.1|718818_719805_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	66.1	3.8e-119
AZP40936.1|719794_720409_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	70.9	1.7e-80
AZP40937.1|720401_721310_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	73.8	7.8e-119
AZP40938.1|721315_721666_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	63.8	9.9e-38
AZP40939.1|721662_722304_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	60.4	6.4e-67
AZP40940.1|722385_722847_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	43.3	2.4e-23
AZP40941.1|722939_723368_-	transcriptional regulator	NA	F1BUQ1	Erwinia_phage	48.3	1.4e-06
AZP40942.1|723368_723878_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	61.1	1.5e-55
AZP40943.1|723858_724080_-	hypothetical protein	NA	NA	NA	NA	NA
AZP40944.1|724070_724274_-|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	56.7	8.6e-18
AZP40945.1|724485_724680_-	hypothetical protein	NA	NA	NA	NA	NA
AZP40946.1|724828_726721_-	replication endonuclease	NA	A0A0F7LA09	Escherichia_phage	50.9	5.2e-181
AZP40947.1|726814_727036_-	conjugal transfer protein TraR	NA	A0A1S6L007	Salmonella_phage	44.3	4.6e-09
AZP40948.1|727035_727311_-	hypothetical protein	NA	NA	NA	NA	NA
AZP40949.1|727443_728034_+	CI repressor	NA	Q6K1G0	Salmonella_virus	51.3	1.8e-52
AZP40950.1|728322_729399_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.3	3.9e-85
AZP40951.1|729405_730527_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AZP40952.1|730604_731759_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AZP40953.1|732070_732415_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AZP40954.1|732696_733431_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AZP40955.1|733561_734539_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AZP40956.1|734538_735276_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AZP40957.1|735406_737980_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.1	2.2e-126
AZP40958.1|743809_745108_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.3	2.9e-42
AZP40959.1|745297_746656_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AZP40960.1|746737_749458_-	bifunctional acyl-CoA synthetase/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZP40961.1|749489_750194_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AZP40962.1|750323_750743_-	thioredoxin TrxC	NA	A0A191VYI2	Roseobacter_phage	34.4	4.5e-13
AZP40963.1|750987_752091_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
CP034481	Rahnella aquatilis strain KM25 chromosome, complete genome	4878783	1814315	1824576	4878783		Enterobacteria_phage(37.5%)	9	NA	NA
AZP41859.1|1814315_1814957_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.9	3.2e-34
AZP41860.1|1814994_1815576_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	1.5e-30
AZP41861.1|1815619_1817470_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AZP41862.1|1817548_1819138_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.6	8.2e-39
AZP41863.1|1819600_1820488_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.9	1.2e-60
AZP41864.1|1820602_1821475_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.6	1.0e-107
AZP41865.1|1821494_1822559_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.0	4.6e-102
AZP41866.1|1823170_1823707_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.0	5.5e-56
AZP41867.1|1823703_1824576_+	dTDP-4-dehydrorhamnose reductase	NA	K7QJU0	Escherichia_phage	37.5	6.3e-41
>prophage 3
CP034481	Rahnella aquatilis strain KM25 chromosome, complete genome	4878783	2943293	2951777	4878783		Tupanvirus(33.33%)	8	NA	NA
AZP42812.1|2943293_2945276_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	24.6	2.8e-20
AZP42813.1|2945275_2946256_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.4	5.4e-33
AZP42814.1|2946255_2947398_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.9	5.0e-30
AZP44578.1|2947746_2948496_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	7.1e-09
AZP42815.1|2948515_2949067_-	glutathione peroxidase	NA	A0A1S7DMQ0	Molluscum_contagiosum_virus	41.6	9.2e-14
AZP42816.1|2949140_2950148_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AZP42817.1|2950301_2950700_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
AZP42818.1|2951480_2951777_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
>prophage 4
CP034481	Rahnella aquatilis strain KM25 chromosome, complete genome	4878783	3880440	3961091	4878783	plate,integrase,lysis,protease,head,tRNA,holin,terminase,tail,portal,coat,capsid	Erwinia_phage(44.19%)	80	3926817:3926841	3958768:3958792
AZP43638.1|3880440_3880959_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AZP43639.1|3880967_3881513_+	SCPU domain-containing protein	NA	NA	NA	NA	NA
AZP43640.1|3881532_3882330_+	molecular chaperone	NA	NA	NA	NA	NA
AZP43641.1|3882348_3884796_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AZP43642.1|3884792_3885761_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AZP43643.1|3885817_3886297_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
AZP43644.1|3886406_3887060_-	DNA oxidative demethylase AlkB	NA	A0A0H3Y8P5	Apricot_vein_clearing_associated_virus	33.7	7.1e-05
AZP43645.1|3887197_3888016_+	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
AZP43646.1|3888077_3889415_-	glucarate dehydratase	NA	NA	NA	NA	NA
AZP44618.1|3889443_3890784_-	glucarate dehydratase	NA	NA	NA	NA	NA
AZP43647.1|3890783_3892157_-	MFS transporter	NA	NA	NA	NA	NA
AZP43648.1|3892383_3893544_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
AZP43649.1|3893781_3895233_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.7	3.9e-27
AZP43650.1|3895440_3896955_-	dGTPase	NA	NA	NA	NA	NA
AZP43651.1|3897138_3897843_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AZP43652.1|3897842_3898649_+	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
AZP43653.1|3898980_3899226_+	hypothetical protein	NA	NA	NA	NA	NA
AZP44619.1|3899333_3899678_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.7e-27
AZP43654.1|3899781_3901245_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
AZP43655.1|3901431_3902712_+	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AZP43656.1|3902815_3904804_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
AZP43657.1|3904800_3905703_-	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
AZP43658.1|3905704_3906517_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	1.3e-11
AZP43659.1|3906612_3908835_-	ferrichrome porin FhuA	NA	NA	NA	NA	NA
AZP43660.1|3909131_3911771_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
AZP44620.1|3911961_3914406_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	31.1	1.9e-42
AZP43661.1|3914502_3915045_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AZP43662.1|3915093_3915828_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AZP43663.1|3916058_3916514_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AZP43664.1|3916576_3917452_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AZP43665.1|3917584_3919291_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	37.4	1.0e-26
AZP43666.1|3919287_3919767_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AZP43667.1|3919772_3921158_-	two-component system sensor histidine kinase QseC	NA	NA	NA	NA	NA
AZP43668.1|3921154_3921841_-	response regulator	NA	NA	NA	NA	NA
AZP43669.1|3921999_3922794_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
AZP43670.1|3922808_3923663_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AZP43671.1|3923771_3924152_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AZP43672.1|3924295_3925066_-	ABC transporter permease	NA	NA	NA	NA	NA
AZP43673.1|3925065_3925989_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.3	1.2e-21
AZP43674.1|3926124_3926781_+	carbonate dehydratase	NA	NA	NA	NA	NA
3926817:3926841	attL	AAGGCACAAAAATGTGCCTTTTTTA	NA	NA	NA	NA
AZP43675.1|3926929_3927937_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	58.2	8.4e-114
AZP43676.1|3928012_3928312_-	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	67.7	7.7e-31
AZP43677.1|3928419_3928692_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	70.0	1.6e-30
AZP43678.1|3928702_3928867_+	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	49.0	7.9e-06
AZP44621.1|3928961_3929201_+	hypothetical protein	NA	NA	NA	NA	NA
AZP43679.1|3929267_3929450_+	DUF2732 family protein	NA	Q6K1F6	Salmonella_virus	51.7	3.2e-08
AZP43680.1|3929449_3929674_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	47.9	1.3e-11
AZP43681.1|3932051_3932435_-	hypothetical protein	NA	A0A0P0IE45	Acinetobacter_phage	38.6	1.5e-07
AZP43682.1|3932431_3932848_-	hypothetical protein	NA	NA	NA	NA	NA
AZP43683.1|3934608_3936297_+	hypothetical protein	NA	D0UIM0	Aggregatibacter_phage	55.1	1.7e-180
AZP43684.1|3936384_3937416_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	78.3	1.5e-158
AZP43685.1|3937417_3939184_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	76.9	3.2e-270
AZP43686.1|3939328_3940180_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	62.2	1.5e-87
AZP43687.1|3940226_3941291_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	73.7	1.4e-143
AZP43688.1|3941303_3941960_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	54.1	2.3e-56
AZP43689.1|3942055_3942526_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	50.7	2.1e-35
AZP43690.1|3942525_3942729_+|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	64.2	4.5e-19
AZP43691.1|3942734_3942944_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	47.8	6.8e-10
AZP43692.1|3942924_3943434_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	64.5	4.5e-55
AZP43693.1|3943433_3943859_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	46.7	4.4e-24
AZP43694.1|3943818_3943992_+|holin	holin	holin	F1BUQ0	Erwinia_phage	55.6	3.3e-10
AZP43695.1|3943954_3944422_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	65.8	3.2e-52
AZP43696.1|3944414_3944864_+	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	67.1	1.8e-44
AZP43697.1|3944883_3946041_-	hypothetical protein	NA	NA	NA	NA	NA
AZP43698.1|3946149_3946794_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	58.5	1.5e-63
AZP43699.1|3946928_3947279_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	67.2	3.4e-38
AZP43700.1|3947281_3948190_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	76.5	4.9e-121
AZP43701.1|3948182_3948710_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	77.1	4.0e-75
AZP43702.1|3948719_3951236_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	42.6	3.9e-75
AZP43703.1|3951245_3951701_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	49.2	5.6e-25
AZP43704.1|3951832_3953002_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	77.9	3.9e-179
AZP43705.1|3953015_3953525_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	71.5	6.2e-65
AZP43706.1|3953583_3953865_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	62.9	6.5e-24
AZP43707.1|3953897_3954017_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	74.4	1.7e-10
AZP43708.1|3954009_3956484_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	63.6	4.3e-204
AZP43709.1|3956496_3956967_+|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	61.7	6.0e-46
AZP43710.1|3956963_3958124_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	67.7	3.1e-144
AZP44622.1|3958443_3958665_+	DNA-binding transcriptional regulator	NA	F1BUT0	Erwinia_phage	68.6	3.1e-21
AZP43711.1|3959617_3959950_+	hypothetical protein	NA	NA	NA	NA	NA
3958768:3958792	attR	AAGGCACAAAAATGTGCCTTTTTTA	NA	NA	NA	NA
AZP43712.1|3960554_3961091_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.3e-17
