The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029610	Acinetobacter pittii strain ST220 chromosome, complete genome	4211131	931311	952645	4211131	tail,head	Acinetobacter_phage(31.25%)	32	NA	NA
AZP28395.1|931311_931602_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	43.5	9.7e-15
AZP28396.1|931660_933295_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	60.8	8.1e-175
AZP28397.1|933432_933657_-	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	44.1	1.3e-06
AZP28398.1|933657_933876_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AZP28399.1|933885_934434_-	hypothetical protein	NA	NA	NA	NA	NA
AZP28400.1|934473_936012_-	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	52.4	3.0e-62
AZP28401.1|936031_936910_-	hypothetical protein	NA	G9L6A3	Escherichia_phage	31.6	3.5e-23
AZP28402.1|936911_937805_-	hypothetical protein	NA	Q775A9	Bordetella_phage	76.3	9.9e-42
AZP28403.1|937807_938005_-	hypothetical protein	NA	NA	NA	NA	NA
AZP28404.1|938209_938953_-	alkaline phosphatase	NA	A0A1B1P9J5	Acinetobacter_phage	61.1	4.1e-81
AZP28405.1|939052_939244_+	hypothetical protein	NA	NA	NA	NA	NA
AZP28406.1|939252_939588_+	hypothetical protein	NA	NA	NA	NA	NA
AZP28407.1|939602_940511_+	replication protein	NA	NA	NA	NA	NA
AZP28408.1|940503_941109_+	restriction endonuclease	NA	NA	NA	NA	NA
AZP28409.1|941277_941784_+	hypothetical protein	NA	A0A1X9SFE9	Acinetobacter_phage	50.9	5.1e-27
AZP28410.1|941794_942211_+	hypothetical protein	NA	NA	NA	NA	NA
AZP28411.1|942207_942609_+	hypothetical protein	NA	I2GUC9	Acinetobacter_phage	36.0	2.2e-09
AZP28412.1|942743_943097_+	hypothetical protein	NA	I2GUD2	Acinetobacter_phage	39.5	7.0e-07
AZP28413.1|943098_943680_+	hypothetical protein	NA	NA	NA	NA	NA
AZP28414.1|943676_943958_+	hypothetical protein	NA	NA	NA	NA	NA
AZP28415.1|943954_944176_+	hypothetical protein	NA	NA	NA	NA	NA
AZP28416.1|944255_944591_+	hypothetical protein	NA	NA	NA	NA	NA
AZP28417.1|944593_944782_+	hypothetical protein	NA	NA	NA	NA	NA
AZP28418.1|944781_946428_+|head,tail	phage head-tail adapter protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	45.7	2.2e-127
AZP28419.1|946424_946988_+	hypothetical protein	NA	NA	NA	NA	NA
AZP28420.1|946980_947664_+	hypothetical protein	NA	NA	NA	NA	NA
AZP31323.1|947685_948591_+	hypothetical protein	NA	NA	NA	NA	NA
AZP28421.1|948651_948975_+	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	72.4	6.8e-33
AZP28422.1|949036_949600_+	hypothetical protein	NA	A0A2H4JCY7	uncultured_Caudovirales_phage	40.9	5.0e-31
AZP28423.1|949599_951684_+	carbohydrate-binding protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	28.4	1.5e-69
AZP28424.1|951686_952136_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	35.4	1.1e-20
AZP28425.1|952138_952645_+	hypothetical protein	NA	A0A218MN86	uncultured_virus	29.8	3.8e-14
>prophage 2
CP029610	Acinetobacter pittii strain ST220 chromosome, complete genome	4211131	1248316	1263129	4211131		Acinetobacter_phage(100.0%)	10	NA	NA
AZP28663.1|1248316_1248871_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	99.5	7.9e-98
AZP28664.1|1249126_1250626_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	93.8	1.5e-271
AZP28665.1|1250627_1253003_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	97.5	0.0e+00
AZP28666.1|1253009_1253993_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	93.0	4.7e-178
AZP28667.1|1254003_1254699_-	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	96.5	5.1e-118
AZP28668.1|1254708_1255515_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	97.4	6.2e-144
AZP31344.1|1255524_1256574_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	99.4	6.3e-189
AZP28669.1|1256931_1259664_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	95.9	0.0e+00
AZP28670.1|1259671_1262443_+	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	97.9	0.0e+00
AZP28671.1|1262544_1263129_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	99.5	3.9e-111
>prophage 3
CP029610	Acinetobacter pittii strain ST220 chromosome, complete genome	4211131	1532413	1568562	4211131	tail,head,plate,transposase	Mannheimia_phage(19.23%)	46	NA	NA
AZP28897.1|1532413_1533952_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZP28898.1|1533948_1534485_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
AZP28899.1|1534481_1535528_-	hypothetical protein	NA	A0A0M3LQN4	Mannheimia_phage	26.5	1.2e-25
AZP28900.1|1535529_1535892_-	hypothetical protein	NA	NA	NA	NA	NA
AZP28901.1|1535894_1536374_-|plate	baseplate assembly protein	plate	F6MIL4	Haemophilus_phage	40.2	1.4e-13
AZP28902.1|1536370_1537426_-	hypothetical protein	NA	NA	NA	NA	NA
AZP28903.1|1537415_1538588_-	multidrug DMT transporter	NA	NA	NA	NA	NA
AZP28904.1|1538659_1540780_-	hypothetical protein	NA	A0A0M3LPB6	Mannheimia_phage	30.5	3.4e-40
AZP28905.1|1540783_1540981_-	hypothetical protein	NA	NA	NA	NA	NA
AZP28906.1|1541010_1541322_-	hypothetical protein	NA	NA	NA	NA	NA
AZP28907.1|1541329_1541707_-	hypothetical protein	NA	NA	NA	NA	NA
AZP28908.1|1541826_1542636_-|tail	phage tail protein	tail	A0A0M3LQC3	Mannheimia_phage	35.7	3.2e-23
AZP28909.1|1542646_1545667_-	hypothetical protein	NA	NA	NA	NA	NA
AZP28910.1|1545670_1546021_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZP28911.1|1546024_1546636_-	DUF1834 domain-containing protein	NA	NA	NA	NA	NA
AZP28912.1|1546629_1547058_-	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	41.8	3.9e-20
AZP28913.1|1547061_1547970_-|head	head protein	head	H1ZZF0	Pseudomonas_virus	59.6	5.8e-98
AZP28914.1|1547966_1548377_-	hypothetical protein	NA	A0A2P9JZJ1	Alteromonadaceae_phage	45.7	8.1e-23
AZP28915.1|1548379_1549456_-	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	38.2	2.8e-46
AZP28916.1|1549535_1550012_-	phage morphogenesis protein	NA	F8TVC6	EBPR_siphovirus	37.9	2.7e-14
AZP28917.1|1550008_1551268_-|head	phage head morphogenesis protein	head	I6PBD2	Pseudomonas_phage	37.2	1.9e-75
AZP28918.1|1551267_1552881_-	DUF935 domain-containing protein	NA	A0A0M5MS00	Ralstonia_phage	42.3	6.9e-110
AZP28919.1|1553050_1553818_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	62.0	9.3e-89
AZP28920.1|1554000_1554687_+	hypothetical protein	NA	NA	NA	NA	NA
AZP28921.1|1554735_1556373_-	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	46.0	5.9e-117
AZP28922.1|1556372_1556939_-	DUF3486 domain-containing protein	NA	J9SH37	Pseudomonas_phage	36.4	1.4e-17
AZP28923.1|1556947_1557241_-	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	55.7	5.4e-21
AZP28924.1|1557243_1557546_-	hypothetical protein	NA	NA	NA	NA	NA
AZP28925.1|1557545_1557893_-	hypothetical protein	NA	NA	NA	NA	NA
AZP28926.1|1557889_1558390_-	hypothetical protein	NA	Q775E1	Bordetella_phage	49.7	9.8e-39
AZP28927.1|1559057_1559717_-	XRE family transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	38.9	5.6e-26
AZP28928.1|1559817_1560030_+	DNA-binding protein	NA	B5TA78	Burkholderia_phage	46.7	2.7e-06
AZP28929.1|1560235_1560532_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZP28930.1|1560544_1561432_+	hypothetical protein	NA	Q6QID9	Burkholderia_phage	31.5	1.2e-26
AZP28931.1|1561434_1563186_+|transposase	transposase	transposase	Q5ZR04	Pseudomonas_phage	36.0	1.6e-99
AZP28932.1|1563195_1564473_+|transposase	transposase	transposase	Q6QIE1	Burkholderia_phage	46.7	1.6e-93
AZP28933.1|1564567_1564786_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
AZP28934.1|1564782_1565019_+	hypothetical protein	NA	NA	NA	NA	NA
AZP28935.1|1565019_1565706_+	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	48.8	5.7e-29
AZP28936.1|1565698_1566316_+	sulfate transporter	NA	A0A0M3LQ92	Mannheimia_phage	54.0	8.1e-59
AZP28937.1|1566333_1566606_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	62.2	3.5e-22
AZP28938.1|1566605_1566785_+	hypothetical protein	NA	NA	NA	NA	NA
AZP28939.1|1566924_1567638_+	DUF2786 domain-containing protein	NA	A0A2H4JCP9	uncultured_Caudovirales_phage	38.8	1.9e-27
AZP28940.1|1567634_1567922_+	hypothetical protein	NA	NA	NA	NA	NA
AZP28941.1|1567915_1568128_+	hypothetical protein	NA	NA	NA	NA	NA
AZP28942.1|1568124_1568562_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	32.6	7.6e-11
>prophage 4
CP029610	Acinetobacter pittii strain ST220 chromosome, complete genome	4211131	1678968	1725446	4211131	tail,head,terminase	Acinetobacter_phage(90.91%)	68	NA	NA
AZP29041.1|1678968_1680231_+	DUF4102 domain-containing protein	NA	A0A0P0IKP2	Acinetobacter_phage	99.3	1.6e-247
AZP29042.1|1680242_1681325_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	28.6	1.2e-30
AZP29043.1|1681361_1681973_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29044.1|1682110_1682380_-	DNA-binding protein	NA	A0A0N7IRE8	Acinetobacter_phage	98.9	7.8e-43
AZP29045.1|1682380_1682638_-	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	95.3	1.6e-45
AZP29046.1|1682641_1682926_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	100.0	2.3e-45
AZP31369.1|1682922_1683339_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29047.1|1683459_1683756_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29048.1|1683784_1684906_-	AAA family ATPase	NA	A0A0N7IRE0	Acinetobacter_phage	98.1	1.0e-208
AZP29049.1|1684917_1685241_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	97.2	9.7e-56
AZP29050.1|1685243_1685684_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	96.6	6.3e-74
AZP29051.1|1685887_1686421_-	DUF4411 domain-containing protein	NA	NA	NA	NA	NA
AZP29052.1|1686423_1687545_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AZP29053.1|1687701_1687917_-	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	95.8	6.7e-29
AZP29054.1|1687931_1688696_-	LexA family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	98.4	1.0e-140
AZP29055.1|1688773_1688959_+	hypothetical protein	NA	J7HXD2	Acinetobacter_phage	98.4	1.4e-27
AZP29056.1|1688968_1689325_+	transcriptional regulator	NA	J7I452	Acinetobacter_phage	98.3	8.8e-58
AZP31370.1|1689380_1689656_+	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	96.7	8.3e-40
AZP29057.1|1689652_1689949_+	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	95.9	1.7e-46
AZP29058.1|1689945_1690149_+	hypothetical protein	NA	J7I4N3	Acinetobacter_phage	98.5	7.0e-28
AZP29059.1|1690299_1691229_+	DUF1376 domain-containing protein	NA	A0A0P0I481	Acinetobacter_phage	99.4	1.1e-171
AZP29060.1|1691221_1691971_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	99.6	6.2e-138
AZP29061.1|1691967_1692441_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29062.1|1692440_1692842_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	90.1	5.1e-62
AZP29063.1|1692838_1693315_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
AZP29064.1|1693286_1693541_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29065.1|1694003_1694357_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	36.3	3.2e-12
AZP29066.1|1694555_1694792_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29067.1|1695455_1695911_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	98.7	3.5e-83
AZP29068.1|1695972_1696407_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	97.9	1.4e-78
AZP29069.1|1696375_1697017_+	hypothetical protein	NA	A0A0P0I449	Acinetobacter_phage	92.5	2.0e-116
AZP29070.1|1697076_1697634_+	DUF2280 domain-containing protein	NA	A0A0P0IKR0	Acinetobacter_phage	89.2	5.7e-80
AZP29071.1|1697617_1698934_+|terminase	terminase	terminase	A0A0N7IRE3	Acinetobacter_phage	98.9	1.5e-264
AZP29072.1|1698973_1700314_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	96.9	1.2e-248
AZP29073.1|1700323_1701430_+|head	phage head morphogenesis protein	head	A0A0P0IR98	Acinetobacter_phage	93.2	3.1e-194
AZP29074.1|1701438_1701867_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	100.0	5.2e-73
AZP29075.1|1701965_1702202_+	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	94.9	4.8e-36
AZP29076.1|1702214_1702439_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29077.1|1702560_1703112_+	hypothetical protein	NA	A0A2I7RHW2	Vibrio_phage	66.7	1.1e-17
AZP29078.1|1703221_1703977_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	100.0	1.6e-130
AZP29079.1|1703990_1704941_+	methyltransferase	NA	A0A0P0HSG2	Acinetobacter_phage	97.5	6.2e-175
AZP29080.1|1704985_1705321_+	HeH/LEM domain protein	NA	A0A0N7IRE4	Acinetobacter_phage	98.2	2.0e-51
AZP29081.1|1705324_1705705_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.1	1.5e-52
AZP29082.1|1705704_1706073_+	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	98.4	1.7e-64
AZP29083.1|1706110_1706824_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29084.1|1706879_1707284_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	94.7	1.4e-67
AZP29085.1|1707255_1707624_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	91.8	4.3e-60
AZP29086.1|1707580_1708024_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	88.4	5.2e-68
AZP29087.1|1708025_1708244_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	86.1	3.2e-26
AZP29088.1|1708302_1708656_+	hypothetical protein	NA	J7I469	Acinetobacter_phage	97.4	1.3e-58
AZP29089.1|1708655_1709984_+	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	48.4	1.5e-86
AZP29090.1|1710036_1710954_+	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	99.3	2.9e-169
AZP29091.1|1711023_1711539_+	hypothetical protein	NA	A0A0P0J095	Acinetobacter_phage	99.3	6.3e-73
AZP29092.1|1711466_1711796_+	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	55.1	2.2e-23
AZP29093.1|1712038_1712338_+	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
AZP29094.1|1712346_1712805_+	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
AZP29095.1|1712910_1713087_+	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	57.7	8.2e-09
AZP29096.1|1713095_1713419_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AZP29097.1|1713437_1714154_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29098.1|1714272_1718610_+|tail	phage tail tape measure protein	tail	A0A0D4DC37	Acinetobacter_phage	70.3	0.0e+00
AZP29099.1|1718700_1719288_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29100.1|1719380_1719779_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	3.1e-72
AZP29101.1|1719778_1720285_+	DUF1833 domain-containing protein	NA	A0A0D4DCA4	Acinetobacter_phage	92.9	1.2e-87
AZP29102.1|1720281_1720644_+	hypothetical protein	NA	A0A0D4DCJ1	Acinetobacter_phage	98.3	2.6e-65
AZP29103.1|1720636_1724083_+	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	99.3	0.0e+00
AZP29104.1|1724151_1724541_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	98.4	5.6e-66
AZP31371.1|1724582_1725128_+	hypothetical protein	NA	A0A0B5L5G0	Acinetobacter_phage	93.9	1.1e-94
AZP29105.1|1725128_1725446_+	anaerobic dehydrogenase	NA	E5KY21	Escherichia_phage	58.5	4.3e-24
>prophage 5
CP029610	Acinetobacter pittii strain ST220 chromosome, complete genome	4211131	1772292	1812676	4211131	protease,transposase	uncultured_virus(50.0%)	44	NA	NA
AZP29145.1|1772292_1773939_+|transposase	IS66-like element ISAba17 family transposase	transposase	A0A218MNE7	uncultured_virus	52.6	5.0e-140
AZP29146.1|1774151_1774445_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29147.1|1774711_1775140_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZP29148.1|1775136_1775472_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZP29149.1|1775546_1777193_+|transposase	IS66-like element ISAba17 family transposase	transposase	A0A218MNE7	uncultured_virus	52.6	5.0e-140
AZP29150.1|1777216_1777924_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZP29151.1|1777918_1778182_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29152.1|1778717_1779221_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AZP29153.1|1779259_1779565_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	52.5	3.4e-18
AZP29154.1|1779983_1780475_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29155.1|1780890_1782135_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
AZP31373.1|1782179_1782806_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29156.1|1782924_1783416_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AZP29157.1|1783403_1783928_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29158.1|1784120_1785041_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AZP31374.1|1785153_1785873_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZP29159.1|1786073_1787567_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AZP29160.1|1787553_1788663_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AZP29161.1|1788829_1788958_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29162.1|1789005_1790349_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AZP29163.1|1790401_1791130_+	UMP kinase	NA	NA	NA	NA	NA
AZP29164.1|1791214_1791769_+	ribosome recycling factor	NA	NA	NA	NA	NA
AZP29165.1|1791774_1792527_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	41.5	2.5e-22
AZP29166.1|1792526_1793351_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AZP29167.1|1793351_1794548_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AZP29168.1|1794549_1795905_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AZP29169.1|1795962_1798449_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AZP29170.1|1798490_1798991_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
AZP29171.1|1798995_1800066_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZP29172.1|1800072_1800558_+	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ	NA	NA	NA	NA	NA
AZP29173.1|1800554_1801343_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZP29174.1|1801401_1802277_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29175.1|1802701_1803184_-	regulatory protein RecX	NA	NA	NA	NA	NA
AZP29176.1|1803243_1804290_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.2	2.5e-113
AZP29177.1|1804435_1804864_-	RNA-binding protein	NA	NA	NA	NA	NA
AZP31375.1|1804847_1805510_-	haloacid dehalogenase	NA	NA	NA	NA	NA
AZP31376.1|1805957_1806251_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29178.1|1806288_1806825_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZP29179.1|1806853_1807303_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZP29180.1|1807450_1808701_+	kynureninase	NA	NA	NA	NA	NA
AZP29181.1|1808741_1810148_+	amino acid permease	NA	NA	NA	NA	NA
AZP29182.1|1810155_1810902_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZP29183.1|1811508_1811736_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29184.1|1811743_1812676_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.4	6.7e-57
>prophage 6
CP029610	Acinetobacter pittii strain ST220 chromosome, complete genome	4211131	1996044	2058057	4211131	transposase	Enterobacteria_phage(23.08%)	49	NA	NA
AZP29347.1|1996044_1996977_+|transposase	IS5-like element ISAha3 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.6	5.1e-57
AZP29348.1|1997286_1999026_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	31.2	6.6e-74
AZP29349.1|2002077_2003724_-|transposase	IS66-like element ISAba17 family transposase	transposase	A0A218MNE7	uncultured_virus	52.6	5.0e-140
AZP29350.1|2003798_2004134_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZP29351.1|2004130_2004559_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZP29352.1|2004652_2008252_+	hypothetical protein	NA	A0A0R6PJK4	Moraxella_phage	34.3	5.7e-72
AZP29353.1|2008264_2008747_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29354.1|2008980_2009898_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZP29355.1|2009995_2011378_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AZP29356.1|2011486_2013055_+	methylmalonate-semialdehyde dehydrogenase (CoA acylating)	NA	NA	NA	NA	NA
AZP29357.1|2013158_2014550_+	amino acid permease	NA	NA	NA	NA	NA
AZP29358.1|2014609_2015695_-	HlyD family secretion protein	NA	NA	NA	NA	NA
AZP29359.1|2015691_2017269_-	MFS transporter	NA	NA	NA	NA	NA
AZP29360.1|2017435_2018056_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZP29361.1|2018110_2018416_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	52.5	3.4e-18
AZP29362.1|2018454_2018958_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AZP29363.1|2019025_2020603_-	aldehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AZP29364.1|2020618_2022406_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AZP29365.1|2022493_2023669_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AZP29366.1|2023780_2024716_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZP29367.1|2024929_2025901_+	NAD-dependent epimerase	NA	NA	NA	NA	NA
AZP29368.1|2025934_2027311_+	MFS transporter	NA	NA	NA	NA	NA
AZP29369.1|2027310_2028183_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZP29370.1|2028299_2029643_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AZP29371.1|2029967_2030987_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZP29372.1|2030989_2032000_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AZP29373.1|2031996_2032761_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	2.8e-16
AZP29374.1|2032757_2033249_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZP29375.1|2033534_2034419_+	ribose-phosphate pyrophosphokinase	NA	A0A076G6G0	Escherichia_phage	38.3	2.2e-33
AZP29376.1|2034430_2035924_+	nicotinate phosphoribosyltransferase	NA	A0A1W6DY18	Aeromonas_phage	50.6	2.7e-140
AZP29377.1|2035984_2036752_+	NUDIX domain-containing protein	NA	G3MA14	Bacillus_virus	33.0	1.9e-25
AZP31387.1|2036866_2038213_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AZP29378.1|2038888_2039821_-|transposase	IS5-like element ISAha3 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.6	5.1e-57
AZP29379.1|2040198_2041362_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29380.1|2041594_2042566_+	acid phosphatase	NA	NA	NA	NA	NA
AZP29381.1|2042578_2043223_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29382.1|2043258_2043699_-	HD domain-containing protein	NA	A0A0B5H2U9	Vibrio_phage	35.5	9.6e-14
AZP29383.1|2044504_2045086_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZP29384.1|2045086_2046196_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.4	1.8e-29
AZP29385.1|2046208_2046922_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29386.1|2047131_2047650_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZP29387.1|2047902_2048844_+	HicB family protein	NA	NA	NA	NA	NA
AZP29388.1|2048969_2049896_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZP29389.1|2050003_2050903_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZP29390.1|2050997_2051840_-	KR domain-containing protein	NA	NA	NA	NA	NA
AZP29391.1|2051885_2052746_-	KR domain-containing protein	NA	NA	NA	NA	NA
AZP31388.1|2052776_2053691_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZP29392.1|2053882_2054902_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZP29393.1|2057124_2058057_+|transposase	IS5-like element ISAha3 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.6	5.1e-57
>prophage 7
CP029610	Acinetobacter pittii strain ST220 chromosome, complete genome	4211131	2651094	2700636	4211131	tRNA,integrase,transposase,terminase,tail,head	Acinetobacter_phage(28.0%)	57	2656200:2656256	2699419:2699475
AZP29907.1|2651094_2651838_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.2	1.8e-20
AZP29908.1|2651837_2652386_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AZP29909.1|2652369_2652918_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AZP29910.1|2652955_2653495_-	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
AZP29911.1|2653498_2654476_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	7.3e-38
AZP29912.1|2654689_2656111_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.6	1.9e-55
2656200:2656256	attL	ATAACCTTGCCAAGGTTGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCAAAATTT	NA	NA	NA	NA
AZP29913.1|2656464_2657478_+|integrase	integrase	integrase	A0A0R6PHH4	Moraxella_phage	41.5	1.7e-69
AZP29914.1|2657502_2657697_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29915.1|2657836_2658460_-	lysozyme	NA	A0A075DXC6	Acinetobacter_phage	64.5	6.6e-69
AZP29916.1|2658470_2658842_-	hypothetical protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	50.4	5.8e-28
AZP29917.1|2658955_2662630_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29918.1|2662705_2662996_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29919.1|2663110_2663350_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29920.1|2663466_2670999_-	GNAT family N-acetyltransferase	NA	Q775D4	Bordetella_phage	25.4	1.9e-93
AZP29921.1|2671088_2671760_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29922.1|2671764_2674059_-	transglycosylase	NA	NA	NA	NA	NA
AZP29923.1|2674059_2674677_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29924.1|2674673_2675147_-	DUF2833 domain-containing protein	NA	NA	NA	NA	NA
AZP29925.1|2675143_2677177_-	hypothetical protein	NA	Q775D1	Bordetella_phage	40.0	6.0e-135
AZP29926.1|2677176_2677731_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29927.1|2677745_2678111_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	55.0	2.4e-26
AZP29928.1|2678179_2678437_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29929.1|2678439_2678844_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	40.3	2.3e-14
AZP29930.1|2678858_2679854_-	hypothetical protein	NA	Q775C7	Bordetella_phage	53.3	4.0e-92
AZP29931.1|2679871_2680543_-	hypothetical protein	NA	A0A2I7RHR0	Vibrio_phage	33.8	1.6e-12
AZP29932.1|2680511_2680841_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29933.1|2680837_2682526_-|head,tail	phage head-tail adapter protein	head,tail	G9L6C2	Escherichia_phage	32.8	7.3e-70
AZP29934.1|2682527_2682818_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29935.1|2682890_2684513_-|terminase	terminase	terminase	Q775B9	Bordetella_phage	59.7	3.9e-185
AZP29936.1|2684496_2684769_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29937.1|2684796_2685537_-|terminase	terminase small subunit	terminase	A0A1Y0SUQ3	Pseudomonas_phage	47.7	1.8e-49
AZP31425.1|2685537_2685747_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29938.1|2685749_2686097_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1X9SFE9	Acinetobacter_phage	53.9	6.4e-29
AZP29939.1|2686093_2686837_-	DNA replication protein	NA	A0A0D4DBZ2	Acinetobacter_phage	50.6	1.6e-56
AZP29940.1|2686838_2687720_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29941.1|2687716_2688082_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29942.1|2688078_2688657_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29943.1|2688653_2689517_-	hypothetical protein	NA	E2GLY5	Acinetobacter_phage	27.5	4.8e-17
AZP29944.1|2689513_2689735_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29945.1|2689793_2690150_-	transcriptional regulator	NA	J7I452	Acinetobacter_phage	79.7	4.2e-44
AZP29946.1|2690158_2690347_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29947.1|2690450_2691176_+	helix-turn-helix domain-containing protein	NA	A0A0P0I8E0	Acinetobacter_phage	51.3	4.9e-63
AZP29948.1|2691178_2691484_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29949.1|2691646_2692021_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29950.1|2692088_2692967_+	hypothetical protein	NA	I6NVL7	Burkholderia_virus	35.7	2.5e-29
AZP29951.1|2693096_2693669_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29952.1|2693670_2694651_+	recombinase	NA	A0A0A7RWR9	Clostridium_phage	36.3	2.1e-48
AZP29953.1|2694662_2695595_+	transcriptional regulator	NA	A0A2H4J6I3	uncultured_Caudovirales_phage	66.7	1.0e-52
AZP29954.1|2695666_2697148_+	ATP-dependent helicase	NA	A0A075DXT4	Acinetobacter_phage	34.6	8.7e-67
AZP29955.1|2697144_2697378_+	protein ninH	NA	NA	NA	NA	NA
AZP29956.1|2697374_2697686_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29957.1|2697682_2698030_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29958.1|2698026_2698230_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29959.1|2698334_2698631_+	hypothetical protein	NA	NA	NA	NA	NA
AZP29960.1|2698654_2699284_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29961.1|2699788_2700292_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
2699419:2699475	attR	ATAACCTTGCCAAGGTTGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCAAAATTT	NA	NA	NA	NA
AZP29962.1|2700330_2700636_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	52.5	3.4e-18
>prophage 8
CP029610	Acinetobacter pittii strain ST220 chromosome, complete genome	4211131	2722511	2729887	4211131	transposase	Acinetobacter_phage(50.0%)	9	NA	NA
AZP29988.1|2722511_2722727_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	61.7	5.9e-17
AZP29989.1|2723070_2724003_-	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	34.2	3.6e-42
AZP29990.1|2724242_2724860_+	LysE family translocator	NA	NA	NA	NA	NA
AZP29991.1|2724956_2725502_-	hypothetical protein	NA	A0A0N7IRE7	Acinetobacter_phage	71.3	3.0e-73
AZP29992.1|2725532_2725922_-	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	76.7	3.0e-51
AZP29993.1|2726131_2726386_-	hypothetical protein	NA	NA	NA	NA	NA
AZP29994.1|2727058_2727730_+	LexA family transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	55.8	9.1e-64
AZP29995.1|2727880_2728114_-|transposase	transposase	transposase	NA	NA	NA	NA
AZP29996.1|2728621_2729887_+	exodeoxyribonuclease VII large subunit	NA	M1NLU2	Moumouvirus	30.4	1.4e-12
>prophage 9
CP029610	Acinetobacter pittii strain ST220 chromosome, complete genome	4211131	2759792	2845299	4211131	tRNA,terminase,tail,head,capsid	Acinetobacter_phage(60.66%)	97	NA	NA
AZP30024.1|2759792_2760509_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AZP30025.1|2760681_2761308_+	glutathione S-transferase	NA	NA	NA	NA	NA
AZP30026.1|2761321_2762101_-	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
AZP30027.1|2762194_2763622_-	OmpA family protein	NA	NA	NA	NA	NA
AZP30028.1|2763835_2765080_-	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
AZP30029.1|2765083_2766100_-	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
AZP30030.1|2766224_2766572_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30031.1|2766790_2769022_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AZP30032.1|2769040_2769457_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30033.1|2769725_2770220_+	damage-inducible protein CinA	NA	A0A218MNG4	uncultured_virus	42.7	1.3e-27
AZP30034.1|2770270_2772850_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.7	1.3e-123
AZP30035.1|2773149_2773959_+	M23 family peptidase	NA	G9BW84	Planktothrix_phage	34.5	1.0e-16
AZP30036.1|2773955_2774381_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZP30037.1|2774476_2774899_-	OsmC family protein	NA	NA	NA	NA	NA
AZP30038.1|2774977_2775097_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30039.1|2775337_2776045_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AZP30040.1|2776204_2777254_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AZP30041.1|2777308_2778088_-	M48 family peptidase	NA	NA	NA	NA	NA
AZP30042.1|2778203_2778521_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30043.1|2778643_2779963_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.2	3.7e-69
AZP30044.1|2780026_2781193_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
AZP30045.1|2781376_2782468_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30046.1|2782633_2783653_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AZP30047.1|2783923_2786560_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.4	6.3e-76
AZP30048.1|2786846_2788049_+	DUF4102 domain-containing protein	NA	A0A0R6PHZ3	Moraxella_phage	50.4	1.6e-103
AZP30049.1|2788304_2789012_+	hypothetical protein	NA	NA	NA	NA	NA
AZP30050.1|2789107_2789773_+	DUF159 family protein	NA	A0A218MNF5	uncultured_virus	47.9	1.3e-54
AZP30051.1|2789866_2790361_+	DNA polymerase V	NA	A0A2H4J538	uncultured_Caudovirales_phage	61.5	4.8e-46
AZP30052.1|2790364_2791663_+	DUF4113 domain-containing protein	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	60.2	1.5e-155
AZP30053.1|2791697_2792468_+	hypothetical protein	NA	NA	NA	NA	NA
AZP30054.1|2792725_2793271_-	hypothetical protein	NA	J7I0Y1	Acinetobacter_phage	95.0	1.1e-96
AZP30055.1|2793309_2793699_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	85.3	8.7e-59
AZP30056.1|2793758_2794301_-	DUF4376 domain-containing protein	NA	A0A172Q0F8	Acinetobacter_phage	45.3	4.8e-31
AZP30057.1|2794297_2803603_-|tail	phage tail protein	tail	A0A0R6PIC9	Moraxella_phage	64.4	0.0e+00
AZP30058.1|2803669_2804335_-|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	47.3	3.3e-42
AZP30059.1|2804318_2805074_-|tail	phage tail protein	tail	A0A0R6PIM4	Moraxella_phage	56.6	1.5e-86
AZP30060.1|2805080_2805779_-|tail	phage minor tail protein L	tail	A0A0R6PIG8	Moraxella_phage	68.1	4.8e-92
AZP30061.1|2805788_2806145_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30062.1|2806203_2806545_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZP30063.1|2806663_2810713_-|tail	phage tail tape measure protein	tail	A0A0D4DC37	Acinetobacter_phage	42.7	1.7e-173
AZP30064.1|2810837_2811437_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30065.1|2811518_2811923_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	82.1	1.7e-57
AZP30066.1|2812012_2812195_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	91.7	6.9e-27
AZP30067.1|2812263_2812524_-	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	68.6	1.1e-22
AZP30068.1|2812526_2813060_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	61.2	2.8e-44
AZP30069.1|2813106_2814036_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	41.0	6.9e-54
AZP30070.1|2814144_2814357_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	82.6	1.7e-24
AZP30071.1|2814358_2814757_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	76.5	3.5e-55
AZP31429.1|2814758_2815127_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	7.9e-54
AZP30072.1|2815092_2815506_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	75.4	7.5e-53
AZP30073.1|2815687_2816056_-	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	78.7	7.4e-52
AZP30074.1|2816057_2816447_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	95.3	3.4e-63
AZP30075.1|2816451_2817117_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	63.3	1.9e-66
AZP30076.1|2817181_2818135_-|capsid	phage capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	94.0	1.8e-166
AZP30077.1|2818162_2818930_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	86.6	2.4e-108
AZP30078.1|2819044_2819596_-	hypothetical protein	NA	A0A2I7RHW2	Vibrio_phage	66.7	1.1e-17
AZP30079.1|2819718_2819943_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30080.1|2819955_2820192_-	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	94.9	4.8e-36
AZP30081.1|2820188_2821292_-|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	97.3	4.0e-202
AZP30082.1|2821293_2822745_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	99.6	1.5e-284
AZP30083.1|2822741_2824169_-|terminase	terminase	terminase	J7I460	Acinetobacter_phage	98.9	1.4e-268
AZP30084.1|2824158_2824629_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	89.7	2.6e-73
AZP30085.1|2824687_2825329_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	97.7	2.0e-124
AZP30086.1|2825297_2825765_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	76.1	7.4e-65
AZP31430.1|2825937_2826141_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30087.1|2826241_2827012_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	60.8	5.5e-89
AZP30088.1|2827454_2828018_-	hypothetical protein	NA	A0A1B1P9I8	Acinetobacter_phage	52.5	3.2e-46
AZP30089.1|2828039_2828324_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30090.1|2828333_2828741_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	51.8	4.0e-22
AZP31431.1|2828737_2828956_-	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	90.7	9.8e-20
AZP30091.1|2829293_2829752_-	hypothetical protein	NA	A0A1B1P9I5	Acinetobacter_phage	43.4	1.4e-07
AZP31432.1|2829753_2829990_-	hypothetical protein	NA	A0A1X9SFB0	Acinetobacter_phage	91.9	1.2e-31
AZP30092.1|2830153_2830549_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	49.2	2.2e-25
AZP30093.1|2830545_2830953_-	hypothetical protein	NA	NA	NA	NA	NA
AZP31433.1|2830949_2831348_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30094.1|2831347_2831464_-	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	91.7	9.8e-11
AZP30095.1|2831460_2832417_-	helix-turn-helix domain-containing protein	NA	A0A1V0E8B1	Vibrio_phage	41.3	1.4e-17
AZP30096.1|2832413_2832740_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30097.1|2832791_2833292_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30098.1|2833352_2833616_-	transcriptional regulator	NA	NA	NA	NA	NA
AZP30099.1|2833749_2834499_+	XRE family transcriptional regulator	NA	H1ZZB6	Pseudomonas_virus	31.4	6.4e-10
AZP30100.1|2834706_2835156_+	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	98.6	2.6e-75
AZP30101.1|2835148_2835472_+	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	77.6	2.1e-42
AZP30102.1|2835483_2836605_+	AAA family ATPase	NA	A0A0N7IRE0	Acinetobacter_phage	100.0	5.2e-213
AZP30103.1|2836601_2837603_+	hypothetical protein	NA	A0A0P0IKV7	Acinetobacter_phage	97.9	4.1e-185
AZP30104.1|2837604_2837850_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
AZP30105.1|2837853_2838303_+	DUF551 domain-containing protein	NA	A0A0P0HSE1	Acinetobacter_phage	93.8	4.6e-80
AZP30106.1|2838299_2838509_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	6.3e-32
AZP30107.1|2838505_2838721_+	hypothetical protein	NA	I2GUB6	Acinetobacter_phage	94.4	4.5e-33
AZP30108.1|2838722_2838938_+	hypothetical protein	NA	A0A0R6PG25	Moraxella_phage	55.9	3.7e-11
AZP30109.1|2839147_2840428_+	aspartate kinase	NA	NA	NA	NA	NA
AZP30110.1|2840674_2840929_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
AZP30111.1|2840996_2841563_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.6	3.1e-25
AZP30112.1|2841635_2842076_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30113.1|2842262_2842820_+	cytochrome b	NA	NA	NA	NA	NA
AZP30114.1|2842864_2843863_-	adenosine deaminase	NA	NA	NA	NA	NA
AZP30115.1|2843979_2845299_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	3.1e-60
>prophage 10
CP029610	Acinetobacter pittii strain ST220 chromosome, complete genome	4211131	3097476	3154804	4211131	holin,tRNA,transposase	Enterobacteria_phage(16.67%)	53	NA	NA
AZP30312.1|3097476_3098409_+|transposase	IS5-like element ISAha3 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.6	5.1e-57
AZP30313.1|3098884_3099085_+	hypothetical protein	NA	NA	NA	NA	NA
AZP30314.1|3099215_3099731_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AZP30315.1|3099982_3100597_-	MarC family protein	NA	NA	NA	NA	NA
AZP30316.1|3100608_3102675_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.0	2.7e-18
AZP30317.1|3102795_3104418_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	2.7e-21
AZP30318.1|3104670_3105306_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
AZP30319.1|3105298_3106771_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AZP30320.1|3106866_3108525_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.3	1.2e-56
AZP30321.1|3109384_3110317_-|transposase	IS5-like element ISAha3 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.6	3.9e-57
AZP30322.1|3111101_3113087_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AZP30323.1|3113390_3114914_-	MFS transporter	NA	NA	NA	NA	NA
AZP30324.1|3114920_3116072_-	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZP30325.1|3116339_3116873_-	thioesterase family protein	NA	NA	NA	NA	NA
AZP31455.1|3116979_3117993_+	porphobilinogen synthase	NA	NA	NA	NA	NA
AZP30326.1|3118018_3119134_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AZP30327.1|3119125_3120031_-	TIGR01777 family protein	NA	NA	NA	NA	NA
AZP30328.1|3120114_3120567_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30329.1|3120947_3121325_+	VOC family protein	NA	NA	NA	NA	NA
AZP30330.1|3121386_3121899_-	peroxiredoxin	NA	NA	NA	NA	NA
AZP30331.1|3122024_3123293_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
AZP30332.1|3123302_3126899_+	ATP-dependent dsDNA exonuclease	NA	Q5ULP4	Lactobacillus_virus	27.4	4.5e-08
AZP30333.1|3127099_3127792_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AZP30334.1|3127918_3128956_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
AZP30335.1|3128975_3130094_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
AZP30336.1|3130163_3130601_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AZP30337.1|3130712_3131111_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AZP30338.1|3131175_3131490_-	RnfH family protein	NA	NA	NA	NA	NA
AZP30339.1|3131489_3132557_-	hypothetical protein	NA	NA	NA	NA	NA
AZP31456.1|3132483_3132681_+	hypothetical protein	NA	NA	NA	NA	NA
AZP30340.1|3132710_3133166_-	bacteriohemerythrin	NA	NA	NA	NA	NA
AZP30341.1|3133417_3134266_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AZP30342.1|3134374_3135157_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZP30343.1|3135279_3136185_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AZP30344.1|3136200_3137619_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	1.5e-39
AZP30345.1|3137816_3138269_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	57.5	1.5e-46
AZP30346.1|3138293_3140333_-	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.7	9.3e-112
AZP30347.1|3140526_3141180_-	OmpA family lipoprotein	NA	NA	NA	NA	NA
AZP30348.1|3141426_3142353_+	acyltransferase	NA	NA	NA	NA	NA
AZP30349.1|3142369_3143416_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AZP31457.1|3143563_3144265_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
AZP30350.1|3144331_3145144_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
AZP30351.1|3145146_3145419_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
AZP30352.1|3145502_3145790_+	hypothetical protein	NA	NA	NA	NA	NA
AZP30353.1|3145831_3146452_-	threonine export protein RhtC	NA	NA	NA	NA	NA
AZP30354.1|3146603_3149657_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.2	6.6e-77
AZP30355.1|3149926_3150874_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	1.3e-60
AZP30356.1|3150996_3151728_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZP30357.1|3151746_3152562_+	arginyltransferase	NA	NA	NA	NA	NA
AZP30358.1|3152547_3153009_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AZP30359.1|3153115_3153934_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AZP30360.1|3153956_3154460_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AZP30361.1|3154498_3154804_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	52.5	3.4e-18
>prophage 11
CP029610	Acinetobacter pittii strain ST220 chromosome, complete genome	4211131	3179879	3223326	4211131	portal,integrase,transposase,terminase,tail,head,capsid	Acinetobacter_phage(58.7%)	68	3173852:3173869	3211652:3211669
3173852:3173869	attL	AGTACATAAATCGCAAAT	NA	NA	NA	NA
AZP30382.1|3179879_3181094_+|integrase	integrase	integrase	A0A0P0IRB7	Acinetobacter_phage	55.9	7.7e-122
AZP30383.1|3181090_3181285_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	93.8	1.3e-28
AZP30384.1|3181411_3181954_-	hypothetical protein	NA	A0A0B5L5G7	Acinetobacter_phage	88.3	2.4e-91
AZP30385.1|3181943_3182162_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30386.1|3182158_3182509_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30387.1|3182690_3183827_+	acyltransferase	NA	NA	NA	NA	NA
AZP31459.1|3183865_3186868_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30388.1|3186966_3189801_-	hypothetical protein	NA	A0A1B1P9G8	Acinetobacter_phage	94.4	0.0e+00
AZP30389.1|3189766_3190150_-	hypothetical protein	NA	A0A1B1P9H4	Acinetobacter_phage	98.4	5.9e-68
AZP30390.1|3190149_3190647_-	hypothetical protein	NA	A0A1B1P9F1	Acinetobacter_phage	98.2	2.3e-88
AZP30391.1|3190643_3191114_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30392.1|3191132_3193685_-|tail	phage tail tape measure protein	tail	A0A2H4J326	uncultured_Caudovirales_phage	28.0	4.8e-57
AZP31460.1|3193744_3194146_-	hypothetical protein	NA	A0A0D4DBP2	Acinetobacter_phage	33.8	4.5e-10
AZP30393.1|3194188_3194482_-	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	42.3	2.3e-08
AZP30394.1|3194508_3194856_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30395.1|3194898_3195360_-	hypothetical protein	NA	A0A2H4J511	uncultured_Caudovirales_phage	64.9	4.2e-52
AZP30396.1|3195432_3195795_-	DUF3168 domain-containing protein	NA	A0A2H4J359	uncultured_Caudovirales_phage	63.4	1.7e-37
AZP30397.1|3195791_3196253_-	hypothetical protein	NA	A0A2H4J6A2	uncultured_Caudovirales_phage	64.4	5.1e-50
AZP30398.1|3196306_3196621_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30399.1|3196717_3197807_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AZP30400.1|3198031_3198379_-|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	40.6	8.9e-15
AZP30401.1|3198386_3198680_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JAM4	uncultured_Caudovirales_phage	56.1	8.9e-24
AZP30402.1|3198676_3200137_-|portal	phage portal protein	portal	A0A2H4JB65	uncultured_Caudovirales_phage	61.0	2.3e-168
AZP30403.1|3200402_3201737_-|capsid	phage major capsid protein	capsid	A0A2H4JBZ9	uncultured_Caudovirales_phage	58.6	1.1e-132
AZP30404.1|3201733_3202327_-	peptidase U35	NA	A0A2H4J367	uncultured_Caudovirales_phage	76.1	1.6e-83
AZP30405.1|3202417_3203410_-	hypothetical protein	NA	K4I381	Acinetobacter_phage	39.9	9.3e-49
AZP30406.1|3203505_3205179_-|terminase	terminase	terminase	A0A2H4J6B3	uncultured_Caudovirales_phage	76.1	6.0e-250
AZP30407.1|3205181_3205376_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30408.1|3205388_3205838_-	hypothetical protein	NA	A0A2H4J8R0	uncultured_Caudovirales_phage	64.7	5.0e-42
AZP30409.1|3205919_3206165_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30410.1|3206158_3206926_-	hypothetical protein	NA	B5WZZ4	Pseudomonas_phage	50.0	1.2e-22
AZP30411.1|3206876_3207140_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30412.1|3207215_3207422_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30413.1|3207449_3207656_-	hypothetical protein	NA	NA	NA	NA	NA
AZP31461.1|3207706_3208177_-	hypothetical protein	NA	A0A0D4DC11	Acinetobacter_phage	45.2	1.5e-25
AZP30414.1|3208306_3208534_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30415.1|3208571_3208853_-	hypothetical protein	NA	A0A0D4DC07	Acinetobacter_phage	74.2	1.5e-33
AZP30416.1|3208803_3209007_-	hypothetical protein	NA	A0A1B1P9J1	Acinetobacter_phage	82.1	5.7e-22
AZP30417.1|3209715_3210270_-	hypothetical protein	NA	A0A1B1P9I8	Acinetobacter_phage	95.7	1.6e-98
AZP30418.1|3210280_3210685_-	hypothetical protein	NA	A0A0R6PIZ9	Moraxella_phage	52.7	5.0e-25
AZP30419.1|3210681_3210963_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30420.1|3210959_3211541_-	hypothetical protein	NA	NA	NA	NA	NA
AZP31462.1|3211542_3211788_-	hypothetical protein	NA	A0A0D4DBT5	Acinetobacter_phage	39.8	8.2e-07
3211652:3211669	attR	ATTTGCGATTTATGTACT	NA	NA	NA	NA
AZP30421.1|3211934_3212303_-	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	42.9	1.8e-13
AZP30422.1|3212460_3212649_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30423.1|3213417_3214449_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30424.1|3214500_3214821_-	transcriptional regulator	NA	A0A0P0HSE9	Acinetobacter_phage	85.8	1.0e-41
AZP30425.1|3214831_3215032_-	XRE family transcriptional regulator	NA	A0A0P0IKT3	Acinetobacter_phage	98.5	7.9e-32
AZP30426.1|3215145_3215808_+	helix-turn-helix domain-containing protein	NA	A0A0P0IYD9	Acinetobacter_phage	98.2	7.4e-119
AZP30427.1|3215828_3216032_+	hypothetical protein	NA	A0A1B1P9G7	Acinetobacter_phage	98.5	2.4e-28
AZP30428.1|3216282_3216591_-	hypothetical protein	NA	A0A1B1P9H0	Acinetobacter_phage	98.1	3.1e-19
AZP30429.1|3216638_3216806_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	63.4	8.6e-08
AZP30430.1|3216769_3217000_+	hypothetical protein	NA	NA	NA	NA	NA
AZP31463.1|3217011_3217218_+	hypothetical protein	NA	A0A1B1P9G9	Acinetobacter_phage	76.5	1.3e-21
AZP30431.1|3217217_3217748_+	hypothetical protein	NA	A0A059VFZ8	Pseudomonas_phage	39.8	6.5e-25
AZP30432.1|3218337_3218547_+	hypothetical protein	NA	A0A1B1P9G5	Acinetobacter_phage	94.2	2.5e-28
AZP30433.1|3218554_3218869_+	hypothetical protein	NA	A0A1B1P9H1	Acinetobacter_phage	94.2	2.0e-53
AZP30434.1|3218871_3219915_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	43.5	9.9e-17
AZP30435.1|3219925_3220585_+	hypothetical protein	NA	M4QPI3	Sulfitobacter_phage	46.5	2.2e-30
AZP31464.1|3220584_3220875_+	hypothetical protein	NA	NA	NA	NA	NA
AZP30436.1|3220871_3221240_+	hypothetical protein	NA	A0A1B1P9I4	Acinetobacter_phage	95.9	8.5e-64
AZP30437.1|3221244_3221676_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	51.7	3.6e-29
AZP30438.1|3221672_3221882_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	95.7	1.1e-33
AZP30439.1|3221878_3222091_+	hypothetical protein	NA	NA	NA	NA	NA
AZP30440.1|3222087_3222279_+	hypothetical protein	NA	A0A0D4DCB1	Acinetobacter_phage	95.2	3.9e-28
AZP30441.1|3222280_3222550_+	hypothetical protein	NA	A0A172Q0P4	Acinetobacter_phage	57.3	2.3e-18
AZP30442.1|3222550_3222751_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AZP30443.1|3222852_3223326_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	41.6	5.5e-23
>prophage 12
CP029610	Acinetobacter pittii strain ST220 chromosome, complete genome	4211131	3365353	3458553	4211131	tRNA,portal,plate,transposase,terminase,tail,head,capsid	uncultured_Caudovirales_phage(25.0%)	95	NA	NA
AZP30560.1|3365353_3366286_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.4	6.7e-57
AZP31475.1|3368802_3369534_+	hypothetical protein	NA	NA	NA	NA	NA
AZP30561.1|3369689_3370988_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AZP31476.1|3370984_3371533_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZP30562.1|3372220_3372712_-	flavin reductase	NA	NA	NA	NA	NA
AZP30563.1|3372897_3373941_-	methionine synthase	NA	NA	NA	NA	NA
AZP30564.1|3373962_3374949_-	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
AZP30565.1|3375317_3376190_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZP30566.1|3376445_3377054_+	LysE family translocator	NA	NA	NA	NA	NA
AZP31477.1|3377155_3378181_-	fatty acid desaturase	NA	NA	NA	NA	NA
AZP30567.1|3378396_3379404_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZP30568.1|3379461_3380829_-	amidohydrolase	NA	NA	NA	NA	NA
AZP30569.1|3380862_3382248_-	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AZP30570.1|3382410_3383457_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AZP30571.1|3383506_3385006_-	tripartite tricarboxylate transporter TctA	NA	NA	NA	NA	NA
AZP30572.1|3385018_3385465_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
AZP30573.1|3385519_3386572_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
AZP30574.1|3387366_3388296_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZP30575.1|3388573_3389884_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.2	1.2e-51
AZP31478.1|3389997_3390741_+	PROX protein	NA	NA	NA	NA	NA
AZP30576.1|3390903_3391833_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZP30577.1|3391936_3393343_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	NA	NA	NA	NA
AZP30578.1|3393332_3394466_+	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
AZP30579.1|3394543_3395077_-	HPP family protein	NA	NA	NA	NA	NA
AZP31479.1|3395174_3395723_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZP30580.1|3395737_3396397_+	glyoxalase-like domain protein	NA	NA	NA	NA	NA
AZP30581.1|3396481_3397711_-	CoA transferase	NA	NA	NA	NA	NA
AZP30582.1|3397762_3399085_-	MFS transporter	NA	NA	NA	NA	NA
AZP30583.1|3399310_3400531_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZP30584.1|3400776_3401724_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZP30585.1|3401812_3402988_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
AZP30586.1|3403390_3404386_+	adenosine deaminase	NA	NA	NA	NA	NA
AZP30587.1|3404938_3406099_-	DUF3596 domain-containing protein	NA	A0A2H4JGM5	uncultured_Caudovirales_phage	41.2	2.9e-73
AZP30588.1|3406185_3406926_-	DNA polymerase III subunit epsilon	NA	A0A0S0NDC6	Pseudomonas_phage	33.0	1.4e-25
AZP30589.1|3407682_3408015_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30590.1|3408017_3408449_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30591.1|3408515_3409109_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30592.1|3409137_3411858_-	hypothetical protein	NA	A0A077K8T2	Ralstonia_phage	39.0	1.2e-178
AZP30593.1|3411873_3412056_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30594.1|3412060_3412294_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30595.1|3412290_3412500_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30596.1|3412582_3412927_+	hypothetical protein	NA	NA	NA	NA	NA
AZP31480.1|3412969_3413530_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30597.1|3414027_3414561_+	hypothetical protein	NA	NA	NA	NA	NA
AZP30598.1|3414728_3415355_+	hypothetical protein	NA	NA	NA	NA	NA
AZP30599.1|3415392_3416418_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
AZP30600.1|3416481_3416862_+	hypothetical protein	NA	NA	NA	NA	NA
AZP30601.1|3416854_3417874_+	hypothetical protein	NA	NA	NA	NA	NA
AZP30602.1|3417896_3418112_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30603.1|3418115_3418550_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30604.1|3418536_3418839_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30605.1|3418952_3419153_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZP30606.1|3419118_3419922_+	DNA adenine methylase	NA	A0A2H4J8Q1	uncultured_Caudovirales_phage	60.1	3.5e-86
AZP30607.1|3419909_3421412_-	DNA primase	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	47.1	1.0e-91
AZP30608.1|3421408_3421831_-	oxidoreductase	NA	Q9ZXJ9	Pseudomonas_virus	52.1	6.1e-34
AZP30609.1|3421836_3424482_-|tail	phage tail tape measure protein	tail	A4PE52	Ralstonia_virus	40.5	4.1e-152
AZP30610.1|3424478_3424598_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	53.8	7.5e-06
AZP30611.1|3424606_3424942_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	40.7	2.8e-13
AZP30612.1|3425007_3425526_-|tail	phage major tail tube protein	tail	A0A2H4J916	uncultured_Caudovirales_phage	57.3	1.5e-50
AZP30613.1|3425536_3426709_-|tail	phage tail protein	tail	A0A077K9Y4	Ralstonia_phage	69.7	3.7e-161
AZP30614.1|3426914_3427154_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30615.1|3429408_3430014_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	38.7	8.5e-29
AZP30616.1|3430013_3430916_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	50.0	1.9e-72
AZP30617.1|3430912_3431257_-|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	44.9	2.4e-20
AZP30618.1|3431253_3431913_-|plate	phage baseplate assembly protein V	plate	K4HZZ9	Acidithiobacillus_phage	30.4	1.0e-11
AZP30619.1|3431985_3432438_-	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	45.6	4.7e-24
AZP30620.1|3432438_3432939_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	62.9	5.7e-39
AZP30621.1|3432935_3433790_-	hydrolase	NA	A4JWU0	Burkholderia_virus	43.9	5.2e-48
AZP30622.1|3433786_3434059_-	hypothetical protein	NA	Q9ZXL7	Pseudomonas_virus	38.4	1.7e-08
AZP30623.1|3434055_3434412_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30624.1|3434414_3434627_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	60.6	4.2e-15
AZP30625.1|3434623_3435073_-|head	head completion protein	head	E5E3S2	Burkholderia_phage	34.5	1.4e-12
AZP30626.1|3435174_3436065_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	44.4	5.8e-42
AZP30627.1|3436071_3437082_-|capsid	phage major capsid protein, P2 family	capsid	A4PE30	Ralstonia_virus	58.8	6.5e-106
AZP30628.1|3437129_3437960_-|capsid	capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	50.6	1.5e-55
AZP30629.1|3438138_3439917_+|terminase	terminase	terminase	A0A2H4JGK4	uncultured_Caudovirales_phage	67.7	1.4e-228
AZP30630.1|3439916_3440972_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	61.8	2.9e-117
AZP31481.1|3441009_3441621_-	hypothetical protein	NA	A0A0R6PJ56	Moraxella_phage	36.1	2.2e-16
AZP30631.1|3441647_3442640_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30632.1|3442926_3443436_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30633.1|3444588_3445653_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
AZP30634.1|3445797_3447018_-	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
AZP30635.1|3447151_3447631_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.2	1.3e-24
AZP30636.1|3447643_3447964_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AZP31482.1|3448113_3448905_-	cation transporter	NA	NA	NA	NA	NA
AZP31483.1|3449137_3449866_-	copper resistance protein CopB	NA	NA	NA	NA	NA
AZP30637.1|3449879_3451817_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
AZP30638.1|3451856_3452252_-	hypothetical protein	NA	NA	NA	NA	NA
AZP30639.1|3452355_3453177_-	HAD family hydrolase	NA	NA	NA	NA	NA
AZP30640.1|3453533_3454220_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AZP30641.1|3454404_3454677_+	DUF2218 domain-containing protein	NA	A0A218MNG7	uncultured_virus	45.3	8.3e-08
AZP30642.1|3454682_3455528_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZP30643.1|3455496_3456948_-	peptidase C13 family protein	NA	NA	NA	NA	NA
AZP30644.1|3457084_3457876_-	methyltransferase	NA	NA	NA	NA	NA
AZP30645.1|3457887_3458553_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 1
CP029611	Acinetobacter pittii strain ST220 plasmid unnamed, complete sequence	84302	8418	51311	84302	transposase,integrase	Escherichia_phage(30.0%)	37	7971:7986	19608:19623
7971:7986	attL	CCTATTTAAGTGATGT	NA	NA	NA	NA
AZP31537.1|8418_11619_-|integrase	integrase	integrase	NA	NA	NA	NA
AZP31538.1|11623_13963_-	hypothetical protein	NA	NA	NA	NA	NA
AZP31600.1|13975_14398_-	hypothetical protein	NA	NA	NA	NA	NA
AZP31539.1|14714_14882_+	DUF2559 domain-containing protein	NA	NA	NA	NA	NA
AZP31540.1|15840_16098_+	hypothetical protein	NA	NA	NA	NA	NA
AZP31541.1|17017_17323_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZP31542.1|17322_18588_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AZP31543.1|24298_25237_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	37.4	1.5e-43
19608:19623	attR	CCTATTTAAGTGATGT	NA	NA	NA	NA
AZP31544.1|25638_26277_+	chromosome partitioning protein ParA	NA	Q2A085	Sodalis_phage	45.5	9.9e-44
AZP31545.1|26279_26567_+	hypothetical protein	NA	NA	NA	NA	NA
AZP31546.1|27009_27261_+	hypothetical protein	NA	NA	NA	NA	NA
AZP31547.1|27993_28206_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AZP31601.1|28168_28288_+	mercury resistance protein	NA	NA	NA	NA	NA
AZP31548.1|28271_28508_-	mercury resistance protein	NA	NA	NA	NA	NA
AZP31549.1|28504_28870_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AZP31550.1|28887_30573_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.2	1.3e-39
AZP31551.1|30611_31037_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AZP31552.1|31064_31340_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AZP31553.1|31353_31704_-	mercuric transporter	NA	NA	NA	NA	NA
AZP31554.1|31775_32231_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AZP31555.1|32596_33301_-|transposase	IS6 family transposase IS1007	transposase	A0A077SL39	Escherichia_phage	83.6	1.2e-114
AZP31602.1|33316_34465_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AZP31603.1|34712_34940_-	hypothetical protein	NA	NA	NA	NA	NA
AZP31556.1|35533_36238_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.3	4.2e-120
AZP31557.1|37162_37414_+	hypothetical protein	NA	NA	NA	NA	NA
AZP31558.1|37307_37610_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AZP31559.1|37696_38512_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AZP31560.1|38601_39693_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AZP31561.1|39889_40375_-	phenol hydroxylase	NA	NA	NA	NA	NA
AZP31562.1|40561_41065_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	24.8	2.5e-05
AZP31563.1|41103_41409_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	52.5	3.4e-18
AZP31564.1|42489_43422_+|transposase	IS5-like element ISAha3 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.3	4.1e-62
AZP31565.1|43679_44084_+	hypothetical protein	NA	NA	NA	NA	NA
AZP31566.1|44164_45472_+	TolC family protein	NA	NA	NA	NA	NA
AZP31567.1|46939_50086_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
AZP31568.1|50119_50485_+	copper-binding protein	NA	NA	NA	NA	NA
AZP31569.1|50606_51311_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	1.8e-118
