The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034433	Iodobacter sp. H11R3 chromosome, complete genome	3877377	610589	708999	3877377	capsid,integrase,transposase,portal,terminase,tail,lysis,plate,protease	Burkholderia_phage(21.95%)	93	622786:622810	691039:691063
AZN35481.1|610589_611339_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AZN35482.1|611353_612441_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.3e-43
AZN35483.1|612796_613141_-	hypothetical protein	NA	NA	NA	NA	NA
AZN35484.1|613639_614545_-	hypothetical protein	NA	NA	NA	NA	NA
AZN35485.1|614685_618246_-	DEAD/DEAH box helicase	NA	Q6NDX2	Leptospira_phage	24.1	6.6e-12
AZN35486.1|618258_619458_-	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	26.1	6.0e-10
AZN35487.1|619454_621017_-	SAM-dependent DNA methyltransferase	NA	A0A2H4UVB0	Bodo_saltans_virus	29.0	1.8e-22
AZN35488.1|621121_622672_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
622786:622810	attL	TGTCAGGATAGTTGAGATACTCCCT	NA	NA	NA	NA
AZN35489.1|622853_623984_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AZN35490.1|624242_625727_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AZN35491.1|625858_626074_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	40.0	2.3e-05
AZN35492.1|626066_626708_-	hypothetical protein	NA	NA	NA	NA	NA
AZN35493.1|627165_628119_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	39.7	4.3e-51
AZN35494.1|628196_629183_+	endonuclease	NA	A6XMH8	Bacillus_virus	39.2	1.2e-51
AZN35495.1|629179_630121_+	hypothetical protein	NA	NA	NA	NA	NA
AZN35496.1|630159_630828_+	hypothetical protein	NA	NA	NA	NA	NA
AZN38049.1|631267_634372_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.1	1.3e-88
AZN35497.1|634451_638963_+	sugar-binding protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.9	1.8e-38
AZN35498.1|638953_639514_+	hypothetical protein	NA	NA	NA	NA	NA
AZN35499.1|639675_640194_+	hypothetical protein	NA	NA	NA	NA	NA
AZN35500.1|640320_640677_+	hypothetical protein	NA	NA	NA	NA	NA
AZN35501.1|640683_641331_+	hypothetical protein	NA	NA	NA	NA	NA
AZN35502.1|641830_643033_+	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	50.0	2.1e-39
AZN35503.1|643029_643401_+	hypothetical protein	NA	NA	NA	NA	NA
AZN35504.1|644375_645134_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZN35505.1|645275_646190_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZN35506.1|646422_647406_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	28.4	1.6e-16
AZN35507.1|647478_648903_-|integrase	site-specific integrase	integrase	A0A2H4IYX8	uncultured_Caudovirales_phage	42.9	1.1e-79
AZN35508.1|649131_650298_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	54.4	3.3e-114
AZN35509.1|650579_650819_-	hypothetical protein	NA	NA	NA	NA	NA
AZN35510.1|650906_652817_-	hypothetical protein	NA	F1BUM9	Cronobacter_phage	35.3	3.6e-41
AZN35511.1|652813_653272_-	hypothetical protein	NA	NA	NA	NA	NA
AZN35512.1|653355_653658_-	hypothetical protein	NA	NA	NA	NA	NA
AZN35513.1|653717_653954_-	hypothetical protein	NA	NA	NA	NA	NA
AZN35514.1|654040_654514_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZN35515.1|654613_654868_+	hypothetical protein	NA	NA	NA	NA	NA
AZN35516.1|654922_655192_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AZN35517.1|655175_655400_-	TraY domain-containing protein	NA	NA	NA	NA	NA
AZN35518.1|655637_655973_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	35.5	6.2e-05
AZN35519.1|655969_656314_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AZN35520.1|656413_657469_-	phage late control D family protein	NA	A0A1S5NV58	Burkholderia_phage	58.9	3.0e-106
AZN35521.1|657465_657876_-	hypothetical protein	NA	A0A1J0I2L5	Salmonella_phage	50.4	1.4e-30
AZN35522.1|657875_660833_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	42.2	4.6e-160
AZN35523.1|660829_661552_-	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	61.5	9.4e-83
AZN35524.1|661555_661672_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZN35525.1|661680_661986_-|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	62.0	1.7e-22
AZN35526.1|662005_662524_-|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	60.5	8.6e-54
AZN38050.1|662539_663718_-|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	63.5	6.5e-142
AZN35527.1|663808_664333_-	hypothetical protein	NA	NA	NA	NA	NA
AZN35528.1|664337_666791_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	45.8	2.2e-35
AZN35529.1|666787_667333_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	51.2	1.5e-48
AZN35530.1|667325_668225_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	61.5	1.1e-93
AZN35531.1|668228_668579_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	53.0	2.4e-28
AZN38051.1|668578_669262_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	52.1	6.7e-30
AZN35532.1|669374_670325_-	hypothetical protein	NA	NA	NA	NA	NA
AZN35533.1|670397_670850_-	phage virion morphogenesis protein	NA	A0A1S5NPT5	Burkholderia_phage	47.0	5.0e-26
AZN35534.1|670846_671308_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	54.6	6.9e-39
AZN35535.1|671389_671848_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	36.7	3.2e-12
AZN38052.1|671844_672294_-	peptidase M15	NA	C7BGD8	Burkholderia_phage	45.9	2.2e-26
AZN35536.1|672124_672778_-	hypothetical protein	NA	NA	NA	NA	NA
AZN35537.1|672774_673143_-	hypothetical protein	NA	A0A1S5NRL1	Burkholderia_phage	45.8	4.9e-19
AZN35538.1|673147_673354_-|tail	phage tail protein	tail	A0A077K8R0	Ralstonia_phage	61.8	2.1e-16
AZN35539.1|673923_674574_-|terminase	terminase	terminase	A0A077K804	Ralstonia_phage	52.4	3.2e-58
AZN35540.1|674573_675659_-|capsid	phage major capsid protein, P2 family	capsid	K4NZP8	Burkholderia_phage	56.7	4.5e-105
AZN35541.1|675729_676518_-|capsid	GPO family capsid scaffolding protein	capsid	A0A077K9W8	Ralstonia_phage	46.1	2.0e-54
AZN35542.1|676673_678425_+|terminase	terminase ATPase subunit family protein	terminase	E5FFI8	Burkholderia_phage	67.1	1.5e-230
AZN35543.1|678425_679448_+|portal	phage portal protein	portal	E5E3S7	Burkholderia_phage	62.4	4.4e-126
AZN35544.1|679990_680257_+	hypothetical protein	NA	NA	NA	NA	NA
AZN35545.1|680265_680586_+	hypothetical protein	NA	NA	NA	NA	NA
AZN35546.1|680703_681462_+	hypothetical protein	NA	NA	NA	NA	NA
AZN35547.1|681468_682341_+	hypothetical protein	NA	NA	NA	NA	NA
AZN35548.1|682899_683910_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	33.1	2.6e-22
AZN35549.1|684317_684995_-	hypothetical protein	NA	NA	NA	NA	NA
AZN35550.1|684991_685603_-	hypothetical protein	NA	NA	NA	NA	NA
AZN35551.1|685599_686118_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AZN35552.1|687064_687565_+	hypothetical protein	NA	NA	NA	NA	NA
AZN38053.1|687729_687915_-|transposase	transposase	transposase	NA	NA	NA	NA
AZN35553.1|688043_688430_-	hypothetical protein	NA	A0A218MNI5	uncultured_virus	62.5	1.0e-11
AZN35554.1|691190_692273_-	hypothetical protein	NA	NA	NA	NA	NA
691039:691063	attR	AGGGAGTATCTCAACTATCCTGACA	NA	NA	NA	NA
AZN35555.1|692544_692994_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AZN35556.1|693002_693272_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AZN35557.1|693283_694540_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
AZN35558.1|695027_695777_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AZN35559.1|698524_699343_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AZN35560.1|699427_699676_+	hypothetical protein	NA	NA	NA	NA	NA
AZN35561.1|699609_699876_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AZN35562.1|700003_700444_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AZN35563.1|700511_702416_+	hypothetical protein	NA	NA	NA	NA	NA
AZN35564.1|702796_703000_+	hypothetical protein	NA	NA	NA	NA	NA
AZN35565.1|703002_704166_+	hypothetical protein	NA	NA	NA	NA	NA
AZN35566.1|704567_706472_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AZN35567.1|706793_707881_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.7	1.4e-45
AZN35568.1|708249_708999_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP034433	Iodobacter sp. H11R3 chromosome, complete genome	3877377	1237623	1248179	3877377		Tetraselmis_virus(33.33%)	7	NA	NA
AZN35976.1|1237623_1238316_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.2	3.7e-36
AZN35977.1|1238308_1239547_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
AZN35978.1|1239705_1240491_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	31.9	1.1e-25
AZN35979.1|1240745_1240931_-	autonomous glycyl radical cofactor GrcA	NA	A0A060AHY5	Cronobacter_phage	75.0	1.2e-15
AZN35980.1|1241026_1243339_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.4	1.3e-170
AZN35981.1|1243602_1245192_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.2	8.8e-33
AZN35982.1|1245287_1248179_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	24.6	2.6e-22
>prophage 3
CP034433	Iodobacter sp. H11R3 chromosome, complete genome	3877377	2492322	2501411	3877377	tRNA	Bacillus_virus(33.33%)	7	NA	NA
AZN36918.1|2492322_2494932_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	32.3	2.2e-20
AZN36919.1|2495051_2497358_-	type I DNA topoisomerase	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	36.3	3.0e-98
AZN36920.1|2497609_2498686_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	33.8	6.6e-24
AZN36921.1|2498685_2499168_-	hypothetical protein	NA	NA	NA	NA	NA
AZN36922.1|2499127_2499745_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	34.5	7.4e-12
AZN36923.1|2499893_2500397_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.7	1.1e-16
AZN36924.1|2500484_2501411_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.9	3.5e-05
>prophage 4
CP034433	Iodobacter sp. H11R3 chromosome, complete genome	3877377	2586605	2593723	3877377	protease	Lake_Baikal_phage(28.57%)	8	NA	NA
AZN36990.1|2586605_2587829_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	61.1	1.1e-09
AZN36991.1|2587959_2588163_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	71.2	1.8e-20
AZN36992.1|2588277_2588481_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	72.7	1.1e-20
AZN36993.1|2588790_2589102_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	40.0	1.6e-10
AZN36994.1|2589098_2591363_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	9.2e-169
AZN36995.1|2591429_2592254_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AZN36996.1|2592317_2593241_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	27.3	1.3e-28
AZN36997.1|2593237_2593723_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2P1EL10	Moumouvirus	31.9	2.0e-12
