The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027712	Pseudomonas chlororaphis subsp. chlororaphis strain DSM 50083 chromosome, complete genome	6808187	1316369	1404235	6808187	plate,tail,tRNA,protease	Pseudomonas_phage(41.18%)	93	NA	NA
AZD00400.1|1316369_1317722_+|protease	Intramembrane protease RasP/YluC, implicated in cell division based on FtsL cleavage	protease	NA	NA	NA	NA
AZD00401.1|1317796_1320184_+	Outer membrane protein assembly factor YaeT	NA	NA	NA	NA	NA
AZD00402.1|1320229_1320733_+	Outer membrane chaperone Skp, precursor	NA	NA	NA	NA	NA
AZD00403.1|1320736_1321792_+	UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZD00404.1|1321901_1322342_+	3-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AZD00405.1|1322338_1323115_+	Acyl-ADP--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZD00406.1|1323117_1324248_+	Lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AZD00407.1|1324259_1324892_+	Ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	38.9	1.7e-27
AZD00408.1|1325104_1328629_+	DNA polymerase III alpha subunit	NA	A0A2L1IZ23	Streptomyces_phage	38.0	5.2e-195
AZD00409.1|1328769_1329717_+	Acetyl-coenzyme A carboxyl transferase alpha chain	NA	NA	NA	NA	NA
AZD00410.1|1329836_1331165_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AZD00411.1|1331210_1331354_+	hypothetical protein	NA	NA	NA	NA	NA
AZD00412.1|1331439_1333071_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	6.9e-158
AZD00413.1|1333076_1333922_+	2-Keto-3-deoxy-D-manno-octulosonate-8-phosphate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.8	3.6e-49
AZD00414.1|1334079_1335369_+	Enolase	NA	A0A1X9I5Z8	Streptococcus_phage	59.0	2.6e-136
AZD00415.1|1335541_1335820_+	Cell division protein DivIC (FtsB), stabilizes FtsL against RasP cleavage	NA	NA	NA	NA	NA
AZD00416.1|1335816_1336524_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZD00417.1|1336645_1337542_-	Transcriptional regulator, LysR family, in formaldehyde detoxification operon	NA	NA	NA	NA	NA
AZD00418.1|1337648_1338761_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.2	8.3e-30
AZD00419.1|1338849_1339695_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZD00420.1|1339747_1340221_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AZD00421.1|1340217_1341276_+|tRNA	tRNA pseudouridine(13) synthase	tRNA	NA	NA	NA	NA
AZD00422.1|1341263_1342013_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.2	5.2e-68
AZD00423.1|1342012_1342690_+	Protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.0	6.8e-43
AZD00424.1|1342899_1343733_+	Murein hydrolase activator NlpD	NA	A0A0S2SXL7	Bacillus_phage	33.3	6.3e-06
AZD00425.1|1343839_1344799_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.4	7.9e-29
AZD00426.1|1345345_1345669_-	4Fe-4S dicluster domain	NA	NA	NA	NA	NA
AZD00427.1|1345811_1348391_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.5	2.4e-27
AZD00428.1|1348587_1349313_+	Transcriptional regulator	NA	B5TK58	Pseudomonas_phage	91.8	1.5e-125
AZD00429.1|1350161_1350296_+	hypothetical protein	NA	NA	NA	NA	NA
AZD00430.1|1350439_1350787_+	Holin	NA	B5TK61	Pseudomonas_phage	87.7	7.7e-51
AZD00431.1|1350970_1351735_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	26.3	8.9e-07
AZD00432.1|1351968_1352493_+	hypothetical protein	NA	NA	NA	NA	NA
AZD00433.1|1352496_1353105_+|plate	Baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	60.4	6.3e-48
AZD00434.1|1353119_1353452_+|plate	Baseplate assembly protein W	plate	A0A2H4JI46	uncultured_Caudovirales_phage	69.1	2.1e-37
AZD00435.1|1353448_1354444_+|plate	Phage-related baseplate assembly protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	63.5	1.8e-108
AZD00436.1|1354440_1355175_+	Tail protein I	NA	A0A2H4JDK0	uncultured_Caudovirales_phage	52.0	1.2e-40
AZD00437.1|1355171_1355702_+|tail	Phage tail fiber	tail	A2I2X8	Vibrio_virus	62.5	2.0e-50
AZD00438.1|1355815_1356436_+	hypothetical protein	NA	NA	NA	NA	NA
AZD00439.1|1356445_1356697_+	hypothetical protein	NA	H2BCU0	Synechococcus_phage	41.1	3.5e-05
AZD00440.1|1356782_1357004_+	hypothetical protein	NA	NA	NA	NA	NA
AZD00441.1|1357006_1358173_+|tail	Major tail sheath protein	tail	B0ZSG8	Halomonas_phage	57.7	5.0e-126
AZD00442.1|1358172_1358679_+	hypothetical protein	NA	Q6R4W3	Vibrio_virus	35.1	5.8e-23
AZD00443.1|1358832_1359444_+	hypothetical protein	NA	B0ZSH0	Halomonas_phage	35.5	4.0e-26
AZD00444.1|1359440_1359566_+	hypothetical protein	NA	NA	NA	NA	NA
AZD00445.1|1359572_1361762_+|tail	Phage tail length tape-measure protein	tail	A0A2H4JAA5	uncultured_Caudovirales_phage	50.7	2.1e-08
AZD00446.1|1361761_1362145_+|tail	Unclassified tail protein	tail	A0A2H4JAC8	uncultured_Caudovirales_phage	60.6	1.0e-40
AZD00447.1|1362137_1362350_+|tail	P2-like prophage tail protein X	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	61.4	6.9e-18
AZD00448.1|1362359_1363376_+|tail	Phage tail protein D	tail	A0A2H4JH05	uncultured_Caudovirales_phage	57.5	1.0e-106
AZD00449.1|1363515_1364100_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	71.5	5.8e-75
AZD00450.1|1364096_1364279_+	Mu-like prophage FluMu protein GP38	NA	B5TK66	Pseudomonas_phage	91.7	2.5e-24
AZD00451.1|1364278_1365775_+|tail	Bacteriophage tail sheath protein	tail	B5TK67	Pseudomonas_phage	90.6	1.1e-255
AZD00452.1|1365841_1366189_+|tail	Phage tail tube protein	tail	B5TK68	Pseudomonas_phage	93.9	2.9e-58
AZD00453.1|1366185_1366482_+|tail	Phage small tail protein E	tail	B5TK69	Pseudomonas_phage	94.9	2.3e-43
AZD00454.1|1366612_1368565_+|tail	Phage tail length tape-measure protein	tail	B5TK70	Pseudomonas_phage	50.6	1.2e-42
AZD00455.1|1368551_1369790_+|tail	Phage tail/DNA circulation protein	tail	B5TK71	Pseudomonas_phage	75.5	2.9e-180
AZD00456.1|1369793_1370834_+|tail	Prophage tail protein	tail	B5TK72	Pseudomonas_phage	82.9	2.3e-162
AZD00457.1|1370898_1371408_+|plate	Prophage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	88.2	2.9e-78
AZD00458.1|1371407_1371806_+	Bacteriophage protein GP46	NA	B5TK74	Pseudomonas_phage	88.6	4.8e-65
AZD00459.1|1371795_1372836_+	Phage FluMu protein gp47	NA	B5TK75	Pseudomonas_phage	87.3	2.3e-167
AZD00460.1|1372823_1373423_+|tail	Prophage tail protein	tail	B5TK76	Pseudomonas_phage	91.5	2.9e-106
AZD00461.1|1373434_1374289_+|tail	Prophage tail fiber protein	tail	B5TK77	Pseudomonas_phage	76.4	1.5e-23
AZD00462.1|1374293_1374935_+|tail	putative tail fiber assembly-like protein	tail	B5TK78	Pseudomonas_phage	62.6	1.9e-39
AZD00463.1|1375241_1376792_+|tail	Prophage tail fiber protein	tail	A4PE45	Ralstonia_virus	53.6	1.5e-37
AZD00464.1|1376793_1377264_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	34.2	9.3e-07
AZD00465.1|1377658_1378723_+|tail	Prophage tail fiber protein	tail	B5TK79	Pseudomonas_phage	58.5	8.0e-115
AZD00466.1|1378732_1379332_+|tail	Putative tail fiber assembly protein p37	tail	B5TK80	Pseudomonas_phage	47.2	6.4e-45
AZD00467.1|1379353_1379917_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	84.4	2.6e-88
AZD00468.1|1379898_1380435_+	hypothetical protein	NA	B5TK84	Pseudomonas_phage	72.5	5.7e-61
AZD00469.1|1380517_1381018_+	Nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	86.7	2.7e-73
AZD00470.1|1381101_1382154_+	RecA protein	NA	A0A0S2MVG1	Bacillus_phage	60.9	4.4e-113
AZD00471.1|1382162_1382630_+	Regulatory protein RecX	NA	NA	NA	NA	NA
AZD00472.1|1382675_1383791_-	Decarboxylase family protein	NA	NA	NA	NA	NA
AZD00473.1|1384186_1384315_-	hypothetical protein	NA	NA	NA	NA	NA
AZD00474.1|1384324_1384453_-	hypothetical protein	NA	NA	NA	NA	NA
AZD00475.1|1384469_1384892_-	Putative NADPH-quinone reductase (modulator of drug activity B)	NA	NA	NA	NA	NA
AZD00476.1|1385081_1385792_+	putative conserved protein YfiP, contains DTW domain	NA	NA	NA	NA	NA
AZD00477.1|1386125_1386776_+	Transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
AZD00478.1|1386851_1387214_+	Diacylglycerol kinase	NA	NA	NA	NA	NA
AZD00479.1|1387210_1388137_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZD00480.1|1388272_1389052_+	Ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AZD00481.1|1389124_1389820_-	S-adenosylmethionine-dependent methyltransferase YaeB	NA	NA	NA	NA	NA
AZD00482.1|1389882_1390344_-	Uncharacterized protein YehS	NA	Q9EYF4	Enterobacteria_phage	50.7	1.9e-36
AZD00483.1|1390410_1391121_-	Ribosomal large subunit pseudouridine synthase F	NA	NA	NA	NA	NA
AZD00484.1|1391203_1391677_-	Acetyltransferase	NA	NA	NA	NA	NA
AZD00485.1|1391783_1393121_-	Ribosomal protein S12p Asp88 methylthiotransferase	NA	NA	NA	NA	NA
AZD00486.1|1393221_1393491_-	hypothetical protein	NA	NA	NA	NA	NA
AZD00487.1|1393512_1395354_+	Kup system potassium uptake protein	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	35.0	1.0e-77
AZD00488.1|1395556_1396852_-	Alanylphosphatidylglycerol hydrolase, periplasmic	NA	NA	NA	NA	NA
AZD00489.1|1396851_1399500_-	Alanylphosphatidylglycerol synthase	NA	NA	NA	NA	NA
AZD00490.1|1400418_1401483_+	DNA polymerase IV	NA	NA	NA	NA	NA
AZD00491.1|1401548_1402502_-	putative lipoprotein	NA	NA	NA	NA	NA
AZD00492.1|1402519_1404235_-|tRNA	Prolyl-tRNA synthetase, bacterial type	tRNA	NA	NA	NA	NA
>prophage 2
CP027712	Pseudomonas chlororaphis subsp. chlororaphis strain DSM 50083 chromosome, complete genome	6808187	1549870	1617979	6808187	tail,integrase,plate,terminase,protease	uncultured_Caudovirales_phage(42.86%)	80	1545470:1545492	1550270:1550292
1545470:1545492	attL	TGAAGTGGAGCGGGTGAAGGGAA	NA	NA	NA	NA
AZD00635.1|1549870_1550038_-|integrase	Phage integrase, site-specific tyrosine recombinase	integrase	NA	NA	NA	NA
AZD00636.1|1550550_1551435_-	(R)-3-hydroxydecanoyl-ACP:CoA transacylase PhaG (3-hydroxyacyl-CoA-acyl carrier protein transferase)	NA	NA	NA	NA	NA
1550270:1550292	attR	TGAAGTGGAGCGGGTGAAGGGAA	NA	NA	NA	NA
AZD00637.1|1551786_1552479_-	Ribosomal small subunit pseudouridine synthase A	NA	NA	NA	NA	NA
AZD00638.1|1552512_1552746_-	DNA/RNA helicase of superfamily II	NA	NA	NA	NA	NA
AZD00639.1|1552738_1554226_-	GGDEF domain protein	NA	A0A127AWB9	Bacillus_phage	39.2	4.5e-23
AZD00640.1|1554498_1554924_+	putative lipoprotein	NA	NA	NA	NA	NA
AZD00641.1|1554978_1556091_-	3-hydroxyisobutyryl-CoA hydrolase	NA	NA	NA	NA	NA
AZD00642.1|1556222_1556915_+	Uracil-DNA glycosylase, family 1	NA	S4VYQ4	Pandoravirus	45.2	9.7e-53
AZD00643.1|1557086_1558118_-	Ammonia monooxygenase	NA	NA	NA	NA	NA
AZD00644.1|1558110_1559625_-	Tricarboxylate transport membrane protein TctA	NA	NA	NA	NA	NA
AZD00645.1|1559626_1560085_-	Tricarboxylate transport protein TctB	NA	NA	NA	NA	NA
AZD00646.1|1560141_1561131_-	Tricarboxylate transport protein TctC	NA	NA	NA	NA	NA
AZD00647.1|1561211_1562504_-	Outer membrane low permeability porin, OccK5/OpdH tricarboxylate	NA	NA	NA	NA	NA
AZD00648.1|1562740_1563412_+	Tricarboxylate transport transcriptional regulator TctD	NA	NA	NA	NA	NA
AZD00649.1|1563404_1564790_+	Tricarboxylate transport sensor protein TctE	NA	W8CYF6	Bacillus_phage	29.9	6.1e-14
AZD00650.1|1564838_1565660_-	HD-GYP domain (HD superfamily hydrolase)	NA	A0A1C3NFB0	Phage_NCTB	31.4	1.1e-26
AZD00651.1|1565697_1566639_-	Folate-dependent protein for Fe/S cluster synthesis/repair in oxidative stress	NA	NA	NA	NA	NA
AZD00652.1|1566788_1567043_+	Succinate dehydrogenase flavin-adding protein, antitoxin of CptAB toxin-antitoxin	NA	NA	NA	NA	NA
AZD00653.1|1567026_1567479_+	hypothetical protein	NA	NA	NA	NA	NA
AZD00654.1|1567447_1569064_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AZD00655.1|1569633_1570215_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	23.5	6.3e-05
AZD00656.1|1570246_1570834_+	Sigma factor RpoE negative regulatory protein RseA	NA	NA	NA	NA	NA
AZD00657.1|1570842_1571805_+	Sigma factor RpoE negative regulatory protein RseB precursor	NA	NA	NA	NA	NA
AZD00658.1|1571823_1571949_-	hypothetical protein	NA	NA	NA	NA	NA
AZD00659.1|1572053_1573481_+|protease	HtrA protease/chaperone protein	protease	A0A1B1IT49	uncultured_Mediterranean_phage	31.3	5.9e-28
AZD00660.1|1573557_1574991_-|protease	Exported zinc metalloprotease YfgC precursor	protease	NA	NA	NA	NA
AZD00661.1|1575088_1575328_+	Rhodanese-like domain protein	NA	NA	NA	NA	NA
AZD00662.1|1575369_1576440_+	Putative permease PerM (YfgO)	NA	NA	NA	NA	NA
AZD00663.1|1576529_1577003_-	Thiol peroxidase, Bcp-type	NA	NA	NA	NA	NA
AZD00664.1|1577013_1577574_-	Glycine cleavage system transcriptional antiactivator GcvR	NA	NA	NA	NA	NA
AZD00665.1|1577901_1578780_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AZD00666.1|1578797_1579910_+	Outer membrane beta-barrel assembly protein BamC	NA	NA	NA	NA	NA
AZD00667.1|1579914_1580673_+	Metal-dependent hydrolase of the beta-lactamase superfamily I	NA	NA	NA	NA	NA
AZD00668.1|1580701_1581412_+	Phosphoribosylaminoimidazole-succinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	37.1	3.0e-41
AZD00669.1|1582042_1582750_+	hypothetical protein	NA	NA	NA	NA	NA
AZD00670.1|1582739_1583444_+	hypothetical protein	NA	NA	NA	NA	NA
AZD00671.1|1584079_1585315_-	Mobile element protein	NA	A0A2H4JGM5	uncultured_Caudovirales_phage	36.6	4.9e-55
AZD00672.1|1585311_1585566_-	hypothetical protein	NA	NA	NA	NA	NA
AZD00673.1|1585581_1585803_-	Phage protein	NA	Q9ZXI5	Pseudomonas_virus	64.1	1.3e-14
AZD00674.1|1585795_1586794_-	hypothetical protein	NA	NA	NA	NA	NA
AZD00675.1|1586873_1587095_-	hypothetical protein	NA	NA	NA	NA	NA
AZD00676.1|1587091_1587496_-	hypothetical protein	NA	NA	NA	NA	NA
AZD00677.1|1587543_1587861_-	transcriptional regulator, putative	NA	NA	NA	NA	NA
AZD00678.1|1588019_1588310_-	DNA-binding protein Roi-related protein	NA	NA	NA	NA	NA
AZD00679.1|1588319_1588910_-	hypothetical protein	NA	NA	NA	NA	NA
AZD00680.1|1588906_1589083_-	hypothetical protein	NA	NA	NA	NA	NA
AZD00681.1|1589301_1589439_-	hypothetical protein	NA	NA	NA	NA	NA
AZD00682.1|1589988_1590720_-	repressor protein c2	NA	A5VW98	Enterobacteria_phage	37.3	1.4e-30
AZD00683.1|1590799_1591060_+	Regulatory protein Cro of bacteriophage	NA	A0A0D4DBS7	Acinetobacter_phage	43.6	2.5e-09
AZD00684.1|1591397_1591916_+	hypothetical protein	NA	NA	NA	NA	NA
AZD00685.1|1592125_1594342_+	DNA primase, phage associated	NA	A0A2D1GN57	Marinobacter_phage	47.0	1.1e-190
AZD00686.1|1594334_1594697_+	hypothetical protein	NA	NA	NA	NA	NA
AZD00687.1|1595225_1595573_+	Holin	NA	A0A2H4J893	uncultured_Caudovirales_phage	79.6	1.3e-42
AZD00688.1|1595710_1596232_+|terminase	Phage DNA packaging protein, Nu1 subunit of terminase	terminase	A0A2D1GMW4	Marinobacter_phage	40.5	4.3e-21
AZD00689.1|1596236_1598162_+|terminase	Phage terminase, large subunit	terminase	A0A2D1GMT1	Marinobacter_phage	48.6	8.1e-166
AZD00690.1|1598174_1598390_+	hypothetical protein	NA	NA	NA	NA	NA
AZD00691.1|1598392_1600000_+	hypothetical protein	NA	A0A0C5AJ48	Bacteriophage	42.9	1.8e-94
AZD00692.1|1600002_1601223_+|protease	Periplasmic serine protease (ClpP class)	protease	A0A219YB02	Aeromonas_phage	43.0	1.0e-49
AZD00693.1|1601234_1601585_+	hypothetical protein	NA	NA	NA	NA	NA
AZD00694.1|1601596_1602628_+	hypothetical protein	NA	A0A0C5ABI0	Bacteriophage	41.2	4.9e-69
AZD00695.1|1602629_1602809_+	hypothetical protein	NA	NA	NA	NA	NA
AZD00696.1|1602810_1603131_+	hypothetical protein	NA	NA	NA	NA	NA
AZD00697.1|1603127_1603790_+	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	61.5	1.4e-72
AZD00698.1|1603782_1604316_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	47.7	4.4e-37
AZD00699.1|1604312_1604894_+|plate	Baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	63.1	9.6e-54
AZD00700.1|1604937_1605153_+	hypothetical protein	NA	NA	NA	NA	NA
AZD00701.1|1605155_1605482_+|plate	Phage baseplate assembly protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	65.1	6.2e-34
AZD00702.1|1605478_1606360_+|plate	Baseplate assembly protein J	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	68.9	1.1e-109
AZD00703.1|1606361_1606973_+|tail	Phage tail fiber	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	66.5	3.1e-63
AZD00704.1|1607067_1608513_+|tail	Phage tail fiber protein	tail	A0A077K818	Ralstonia_phage	57.4	5.9e-68
AZD00705.1|1609045_1610215_+|tail	Phage tail sheath monomer	tail	A0A2H4J869	uncultured_Caudovirales_phage	81.0	1.2e-180
AZD00706.1|1610227_1610737_+|tail	Phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	71.9	1.6e-65
AZD00707.1|1610761_1611058_+	hypothetical protein	NA	A0A2H4J873	uncultured_Caudovirales_phage	56.4	2.3e-19
AZD00708.1|1611189_1613790_+	Phage protein	NA	A0A2H4JG00	uncultured_Caudovirales_phage	32.3	7.8e-71
AZD00709.1|1613799_1614645_+	Phage protein U	NA	A0A2H4J875	uncultured_Caudovirales_phage	51.8	9.3e-74
AZD00710.1|1614619_1614826_+|tail	Phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	68.7	7.1e-20
AZD00711.1|1614882_1615962_+|tail	Phage tail protein D	tail	A0A2H4JBF6	uncultured_Caudovirales_phage	74.6	1.1e-148
AZD00712.1|1615958_1616510_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	78.0	1.2e-77
AZD00713.1|1616506_1617034_+	hypothetical protein	NA	B5TK84	Pseudomonas_phage	64.5	8.4e-49
AZD00714.1|1617184_1617979_+	Dam modification methylase	NA	C7BGE1	Burkholderia_phage	66.5	4.5e-102
>prophage 3
CP027712	Pseudomonas chlororaphis subsp. chlororaphis strain DSM 50083 chromosome, complete genome	6808187	2309840	2361838	6808187	tail,terminase	Pseudomonas_phage(52.94%)	69	NA	NA
AZD01341.1|2309840_2312003_-	C-5 cytosine-specific DNA methylase family protein	NA	Q5QF27	Pseudomonas_virus	61.3	8.0e-255
AZD01342.1|2312338_2312482_-	hypothetical protein	NA	NA	NA	NA	NA
AZD01343.1|2312534_2313629_+	hypothetical protein	NA	NA	NA	NA	NA
AZD01344.1|2313859_2314156_-	hypothetical protein	NA	A0A1B0Z2L8	Pseudomonas_phage	53.0	3.0e-11
AZD01345.1|2314237_2314651_-	hypothetical protein	NA	A0A0U4JNY7	Pseudomonas_phage	57.4	4.0e-38
AZD01346.1|2314757_2315360_+	hypothetical protein	NA	NA	NA	NA	NA
AZD01347.1|2315636_2316074_-	hypothetical protein	NA	A0A2H4J0R5	uncultured_Caudovirales_phage	31.5	2.1e-05
AZD01348.1|2316084_2316648_-	hypothetical protein	NA	A0A2H4IZG3	uncultured_Caudovirales_phage	75.9	4.0e-73
AZD01349.1|2316644_2317394_-	Phage exonuclease	NA	I3PUZ3	Vibrio_phage	44.9	9.2e-49
AZD01350.1|2317533_2317707_-	hypothetical protein	NA	A0A0S2SY66	Pseudomonas_phage	54.4	1.5e-07
AZD01351.1|2317703_2317904_-	hypothetical protein	NA	NA	NA	NA	NA
AZD01352.1|2317900_2318092_-	hypothetical protein	NA	A0A1B0VMB8	Pseudomonas_phage	50.8	6.2e-10
AZD01353.1|2318088_2318520_-	hypothetical protein	NA	NA	NA	NA	NA
AZD01354.1|2318662_2318830_-	hypothetical protein	NA	NA	NA	NA	NA
AZD01355.1|2319291_2320152_-	Phage protein	NA	A0A1B0YZX8	Pseudomonas_phage	63.6	1.2e-89
AZD01356.1|2320685_2321870_-	hypothetical protein	NA	NA	NA	NA	NA
AZD01357.1|2321997_2323092_-	Putative cI prophage repressor protein	NA	A0A2H4IZH7	uncultured_Caudovirales_phage	65.5	2.1e-94
AZD01358.1|2323090_2323279_+	Phage protein	NA	B5WZX7	Pseudomonas_phage	64.5	9.1e-14
AZD01359.1|2323297_2323477_+	hypothetical protein	NA	NA	NA	NA	NA
AZD01360.1|2323543_2323750_+	hypothetical protein	NA	NA	NA	NA	NA
AZD01361.1|2323771_2323981_+	hypothetical protein	NA	NA	NA	NA	NA
AZD01362.1|2324093_2324231_+	hypothetical protein	NA	NA	NA	NA	NA
AZD01363.1|2324648_2325620_+	Primosomal protein I	NA	A0A1B0VME0	Pseudomonas_phage	75.1	3.9e-116
AZD01364.1|2325606_2326401_+	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	47.3	1.2e-54
AZD01365.1|2326400_2326907_+	hypothetical protein	NA	Q9MC52	Pseudomonas_phage	34.5	3.8e-14
AZD01366.1|2326903_2327290_+	hypothetical protein	NA	NA	NA	NA	NA
AZD01367.1|2327286_2327757_+	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	62.8	1.3e-53
AZD01368.1|2327753_2328335_+	NinG recombination protein	NA	A0A125RNK9	Pseudomonas_phage	70.6	4.4e-75
AZD01369.1|2328331_2329003_+	hypothetical protein	NA	A0A2H4J9G7	uncultured_Caudovirales_phage	67.7	3.7e-81
AZD01370.1|2329191_2329731_+	hypothetical protein	NA	NA	NA	NA	NA
AZD01371.1|2330079_2330271_+	hypothetical protein	NA	NA	NA	NA	NA
AZD01372.1|2330267_2330564_-	hypothetical protein	NA	A0A2H4J0J5	uncultured_Caudovirales_phage	63.3	5.4e-29
AZD01373.1|2330702_2331026_+	hypothetical protein	NA	A0A1B0VME9	Pseudomonas_phage	83.2	1.7e-39
AZD01374.1|2331027_2331300_+	hypothetical protein	NA	A0A1B0VME7	Pseudomonas_phage	77.5	2.6e-33
AZD01375.1|2331304_2331601_+	hypothetical protein	NA	V5K3F8	Pseudomonas_phage	35.0	2.3e-11
AZD01376.1|2332429_2333041_+	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	83.0	9.6e-97
AZD01377.1|2333072_2333534_+	Phage protein	NA	A0A1B0VMH2	Pseudomonas_phage	78.1	9.3e-52
AZD01378.1|2333520_2334822_+|terminase	Phage terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.3	8.2e-146
AZD01379.1|2334818_2336237_+	structural protein	NA	A0A1B0VMH0	Pseudomonas_phage	93.9	1.1e-268
AZD01380.1|2336211_2337306_+	Phage protein	NA	A0A1B0VMF3	Pseudomonas_phage	91.4	7.8e-182
AZD01381.1|2337817_2338546_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	92.1	3.1e-118
AZD01382.1|2338558_2339521_+	putative phage protein	NA	A0A1B0VMF8	Pseudomonas_phage	90.6	2.9e-164
AZD01383.1|2339566_2340157_+	hypothetical protein	NA	A0A1B0VMF7	Pseudomonas_phage	41.4	1.2e-27
AZD01384.1|2340211_2340715_+	phage-related conserved hypothetical protein	NA	A0A1B0VND3	Pseudomonas_phage	86.2	5.9e-76
AZD01385.1|2340981_2341350_+	phage-related conserved hypothetical protein	NA	A0A1B0VRJ4	Pseudomonas_phage	80.0	1.7e-48
AZD01386.1|2341346_2341943_+	hypothetical protein	NA	A0A2H4J0Q3	uncultured_Caudovirales_phage	52.3	4.1e-52
AZD01387.1|2341939_2342356_+	hypothetical protein	NA	A0A1B0VMI0	Pseudomonas_phage	65.2	2.0e-45
AZD01388.1|2342754_2343402_+	putative phage protein	NA	A0A2H4J6K6	uncultured_Caudovirales_phage	58.6	4.3e-63
AZD01389.1|2343411_2343795_+	hypothetical protein	NA	A0A2H4J9Y6	uncultured_Caudovirales_phage	46.5	6.8e-24
AZD01390.1|2343848_2344115_+	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	60.0	9.2e-20
AZD01391.1|2344142_2347142_+|tail	Phage tail length tape-measure protein 1	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	43.8	6.1e-176
AZD01392.1|2347141_2347480_+	Phage protein	NA	A0A2H4JI07	uncultured_Caudovirales_phage	81.2	2.2e-50
AZD01393.1|2347489_2348239_+|tail	Phage minor tail protein	tail	A0A2H4J4Q5	uncultured_Caudovirales_phage	80.3	9.3e-118
AZD01394.1|2348241_2349042_+|tail	Phage tail assembly protein	tail	A0A2H4J1J7	uncultured_Caudovirales_phage	86.0	2.2e-133
AZD01395.1|2349019_2349415_-	hypothetical protein	NA	NA	NA	NA	NA
AZD01396.1|2349485_2349752_+	hypothetical protein	NA	A0A0S2SYE8	Pseudomonas_phage	61.6	2.3e-18
AZD01397.1|2350218_2350413_+	hypothetical protein	NA	NA	NA	NA	NA
AZD01398.1|2350811_2351138_+	hypothetical protein	NA	NA	NA	NA	NA
AZD01399.1|2351525_2352146_+|tail	Phage tail assembly protein I	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	57.9	9.9e-57
AZD01400.1|2352227_2353244_+	Phage protein	NA	A0A0M4S6X1	Salmonella_phage	43.8	1.9e-65
AZD01401.1|2353302_2356575_+|tail	Phage tail fiber protein	tail	A0A2H4J8Z6	uncultured_Caudovirales_phage	77.8	0.0e+00
AZD01402.1|2356613_2356871_+	hypothetical protein	NA	NA	NA	NA	NA
AZD01403.1|2356879_2357605_+	hypothetical protein	NA	A0A059VF40	Pseudomonas_phage	30.1	8.1e-10
AZD01404.1|2357661_2358222_+	hypothetical protein	NA	A0A2H4J2B7	uncultured_Caudovirales_phage	41.2	1.4e-09
AZD01405.1|2358218_2358614_+|tail	Phage tail fiber protein	tail	A0A2P1JUG3	Erwinia_phage	39.7	2.1e-12
AZD01406.1|2358671_2359097_+	structural protein P5, putative	NA	A0A2H4J6R1	uncultured_Caudovirales_phage	91.4	2.5e-67
AZD01407.1|2359093_2359465_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	52.5	3.4e-20
AZD01408.1|2359461_2359719_+	Phage protein	NA	B5WZU5	Pseudomonas_phage	64.7	1.8e-20
AZD01409.1|2359780_2361838_-	O-antigen acetylase	NA	A0A1R3Y5Q6	Salmonella_virus	40.4	4.9e-92
>prophage 4
CP027712	Pseudomonas chlororaphis subsp. chlororaphis strain DSM 50083 chromosome, complete genome	6808187	4379448	4385707	6808187	tRNA	uncultured_Caudovirales_phage(83.33%)	8	NA	NA
AZD03194.1|4379448_4379841_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusD	tRNA	A0A2H4JA39	uncultured_Caudovirales_phage	84.6	8.7e-59
AZD03195.1|4379844_4380207_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusC	tRNA	A0A2H4J8C0	uncultured_Caudovirales_phage	72.5	8.1e-43
AZD03196.1|4380206_4380506_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusB	tRNA	A0A2H4JG28	uncultured_Caudovirales_phage	70.7	3.7e-33
AZD03197.1|4380502_4380838_+|tRNA	tRNA 2-thiouridine synthesis protein TusE	tRNA	A0A2H4J8B6	uncultured_Caudovirales_phage	81.1	4.2e-46
AZD03198.1|4380834_4381836_+	Anthranilate phosphoribosyltransferase like	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	84.4	6.1e-165
AZD03199.1|4381924_4382932_+	Glutathione S-transferase, omega	NA	NA	NA	NA	NA
AZD03200.1|4383031_4384426_-	Precorrin-2 oxidase	NA	NA	NA	NA	NA
AZD03201.1|4384426_4385707_-|tRNA	Seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.8	4.7e-101
