The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029617	Streptomyces sp. WAC 01529 chromosome, complete genome	8270461	833965	844104	8270461	capsid	Rhodococcus_phage(50.0%)	12	NA	NA
AZM51756.1|833965_838237_-	hypothetical protein	NA	D6PSZ3	Lactobacillus_phage	41.9	3.8e-22
AZM51757.1|838256_838535_-	hypothetical protein	NA	NA	NA	NA	NA
AZM51758.1|838549_838972_-	hypothetical protein	NA	G9FHI3	Rhodococcus_phage	50.4	4.7e-26
AZM51759.1|839044_839383_+	hypothetical protein	NA	A0A2D1GPL8	Mycobacterium_phage	36.3	1.8e-07
AZM51760.1|839476_839965_-	hypothetical protein	NA	NA	NA	NA	NA
AZM51761.1|839964_840381_-	hypothetical protein	NA	G9FHI1	Rhodococcus_phage	63.8	7.6e-45
AZM51762.1|840656_840995_-	hypothetical protein	NA	NA	NA	NA	NA
AZM51763.1|841006_841450_-	hypothetical protein	NA	NA	NA	NA	NA
AZM51764.1|841451_842063_-	hypothetical protein	NA	G9FHH7	Rhodococcus_phage	43.0	3.1e-34
AZM51765.1|842068_842314_-	hypothetical protein	NA	NA	NA	NA	NA
AZM51766.1|842313_842748_-	hypothetical protein	NA	NA	NA	NA	NA
AZM51767.1|842817_844104_-|capsid	phage major capsid protein	capsid	M4QRD3	Tetraselmis_viridis_virus	27.0	1.4e-25
>prophage 2
CP029617	Streptomyces sp. WAC 01529 chromosome, complete genome	8270461	2800152	2845556	8270461	integrase,head,capsid,tail	Streptomyces_phage(93.48%)	64	2799943:2799986	2849694:2849737
2799943:2799986	attL	CCTTCTAAGCGCTTGGCCGCAGGTTCGAGTCCTGCCGGGGGCGC	NA	NA	NA	NA
AZM57620.1|2800152_2801079_+|integrase	integrase	integrase	A0A142F1N9	Bacillus_phage	25.0	2.2e-12
AZM57621.1|2801551_2801971_-	hypothetical protein	NA	NA	NA	NA	NA
AZM57622.1|2802125_2802566_+	hypothetical protein	NA	NA	NA	NA	NA
AZM53299.1|2802459_2802801_+	hypothetical protein	NA	NA	NA	NA	NA
AZM53300.1|2802896_2803250_+	hypothetical protein	NA	A0A0M3UKC5	Streptomyces_phage	53.6	4.1e-23
AZM53301.1|2803246_2803510_+	hypothetical protein	NA	NA	NA	NA	NA
AZM53302.1|2803506_2803929_+	hypothetical protein	NA	NA	NA	NA	NA
AZM53303.1|2803925_2804213_+	hypothetical protein	NA	A0A0M4RBC4	Streptomyces_phage	68.3	1.3e-24
AZM53304.1|2804209_2804605_+	hypothetical protein	NA	NA	NA	NA	NA
AZM53305.1|2804601_2805432_+	hypothetical protein	NA	A0A0M4R1V5	Streptomyces_phage	84.8	5.4e-135
AZM57623.1|2805454_2806522_+	hypothetical protein	NA	A0A0M4QTT9	Streptomyces_phage	72.1	1.3e-144
AZM57624.1|2806542_2807337_+	DNA polymerase III subunit epsilon	NA	Q6VY79	Streptomyces_phage	70.3	6.2e-96
AZM53306.1|2807333_2807792_+	hypothetical protein	NA	A0A0M4RQ88	Streptomyces_phage	48.6	7.9e-35
AZM53307.1|2807788_2808397_+	hypothetical protein	NA	Q6VY77	Streptomyces_phage	68.8	1.0e-66
AZM57625.1|2808438_2809119_+	DNA cytosine methyltransferase	NA	A0A2L1IVN1	Streptomyces_phage	49.8	6.6e-54
AZM53308.1|2809115_2809316_+	hypothetical protein	NA	NA	NA	NA	NA
AZM53309.1|2809312_2809588_+	hypothetical protein	NA	A0A0M4S2J7	Streptomyces_phage	72.5	1.3e-29
AZM53310.1|2809593_2810034_+	hypothetical protein	NA	A0A0M3UKC6	Streptomyces_phage	68.3	5.6e-46
AZM53311.1|2810030_2810387_+	hypothetical protein	NA	A0A0M4QZK4	Streptomyces_phage	63.0	1.2e-30
AZM53312.1|2810399_2811347_+	hypothetical protein	NA	A0A0M4R9L6	Streptomyces_phage	40.1	2.5e-51
AZM53313.1|2811343_2811835_+	hypothetical protein	NA	A0A0M5M0M5	Streptomyces_phage	57.9	3.5e-33
AZM53314.1|2811831_2812083_+	hypothetical protein	NA	A0A0M4S3F5	Streptomyces_phage	70.0	5.6e-11
AZM53315.1|2812604_2812826_+	hypothetical protein	NA	NA	NA	NA	NA
AZM57626.1|2812916_2813282_+	hypothetical protein	NA	A0A0M4R1W0	Streptomyces_phage	53.1	1.5e-20
AZM53316.1|2813278_2813710_+	hypothetical protein	NA	NA	NA	NA	NA
AZM53317.1|2813712_2813949_+	hypothetical protein	NA	NA	NA	NA	NA
AZM57627.1|2814331_2814961_+	hypothetical protein	NA	A0A0M4S2K5	Streptomyces_phage	73.2	4.8e-67
AZM53318.1|2815028_2815244_-	prevent-host-death family protein	NA	A0A0M4QZL2	Streptomyces_phage	80.3	2.7e-22
AZM53319.1|2815327_2816059_+	hypothetical protein	NA	A0A0M4R9M3	Streptomyces_phage	79.0	1.6e-21
AZM53320.1|2816191_2817238_+	hypothetical protein	NA	A0A0M5M0U6	Streptomyces_phage	54.0	7.4e-97
AZM53321.1|2817434_2818013_+	hypothetical protein	NA	NA	NA	NA	NA
AZM53322.1|2818009_2818519_+	hypothetical protein	NA	NA	NA	NA	NA
AZM53323.1|2818515_2819169_+	hypothetical protein	NA	Q6VY63	Streptomyces_phage	41.1	3.1e-24
AZM53324.1|2819333_2819531_+	hypothetical protein	NA	NA	NA	NA	NA
AZM53325.1|2819600_2819801_+	hypothetical protein	NA	NA	NA	NA	NA
AZM53326.1|2820283_2820544_+	hypothetical protein	NA	A0A0M4R1W7	Streptomyces_phage	65.3	6.5e-18
AZM53327.1|2820540_2820720_+	hypothetical protein	NA	NA	NA	NA	NA
AZM53328.1|2820709_2821006_+	HNH endonuclease	NA	A0A0M4QTV1	Streptomyces_phage	66.7	4.0e-32
AZM57628.1|2821305_2821884_+	DNA primase	NA	Q6VY59	Streptomyces_phage	69.7	1.9e-70
AZM53329.1|2821934_2822447_+	hypothetical protein	NA	A0A2P1A0P1	Gordonia_phage	44.5	1.0e-22
AZM53330.1|2822436_2824128_+	Terminase	NA	A0A1B3AY92	Gordonia_phage	52.6	5.3e-161
AZM53331.1|2824147_2825569_+	hypothetical protein	NA	A0A0K1Y587	Streptomyces_phage	63.6	4.3e-172
AZM53332.1|2825565_2826387_+	hypothetical protein	NA	A0A0K1Y588	Streptomyces_phage	70.1	1.6e-102
AZM53333.1|2826441_2827185_+	hypothetical protein	NA	Q6VY53	Streptomyces_phage	58.8	6.4e-18
AZM53334.1|2827200_2827590_+|head	head decoration protein	head	Q6VY52	Streptomyces_phage	67.2	5.4e-45
AZM53335.1|2827607_2828642_+|capsid	phage capsid protein	capsid	A0A0K1Y5W3	Streptomyces_phage	49.0	8.2e-80
AZM57629.1|2829001_2829409_+	hypothetical protein	NA	A0A0K1Y592	Streptomyces_phage	79.1	3.9e-54
AZM57630.1|2829405_2829759_+	hypothetical protein	NA	A0A0K1Y5A7	Streptomyces_phage	75.2	6.2e-48
AZM53336.1|2829761_2830031_+	hypothetical protein	NA	A0A0K1Y5T2	Streptomyces_phage	79.3	3.2e-28
AZM53337.1|2830030_2830435_+	hypothetical protein	NA	A0A0K1Y5W8	Streptomyces_phage	69.7	6.7e-46
AZM53338.1|2830508_2831177_+|tail	phage tail protein	tail	A0A0K1Y595	Streptomyces_phage	79.3	1.1e-96
AZM57631.1|2831281_2831605_+	hypothetical protein	NA	A0A0K1Y596	Streptomyces_phage	72.9	4.4e-40
AZM53339.1|2831658_2832090_+	hypothetical protein	NA	A0A0K1Y5B2	Streptomyces_phage	69.4	4.8e-50
AZM53340.1|2832096_2836470_+	hypothetical protein	NA	Q6VY42	Streptomyces_phage	47.4	8.0e-153
AZM53341.1|2836474_2837365_+	hypothetical protein	NA	A0A0K1Y5X3	Streptomyces_phage	75.4	7.9e-116
AZM57632.1|2837364_2838513_+|tail	phage tail protein	tail	A0A0K1Y599	Streptomyces_phage	65.9	6.8e-144
AZM57633.1|2838509_2839439_+	hypothetical protein	NA	A0A0K1Y5A0	Streptomyces_phage	66.3	1.3e-108
AZM53342.1|2839451_2840075_+	hypothetical protein	NA	A0A0K1Y5B7	Streptomyces_phage	45.9	1.2e-46
AZM53343.1|2840091_2842716_+	hypothetical protein	NA	A0A0K1Y5U2	Streptomyces_phage	43.9	7.5e-138
AZM53344.1|2842729_2842996_+	hypothetical protein	NA	NA	NA	NA	NA
AZM53345.1|2843261_2844206_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
AZM53346.1|2844226_2844505_+	hypothetical protein	NA	NA	NA	NA	NA
AZM53347.1|2844543_2844876_+	hypothetical protein	NA	A0A0K1Y5A5	Streptomyces_phage	74.6	4.7e-13
AZM53348.1|2844872_2845556_+	hypothetical protein	NA	A0A0M4QTS6	Streptomyces_phage	77.5	6.2e-28
2849694:2849737	attR	CCTTCTAAGCGCTTGGCCGCAGGTTCGAGTCCTGCCGGGGGCGC	NA	NA	NA	NA
>prophage 3
CP029617	Streptomyces sp. WAC 01529 chromosome, complete genome	8270461	3922483	3941823	8270461	capsid,head,coat,tail	Streptomyces_phage(75.0%)	25	NA	NA
AZM57748.1|3922483_3922906_+	hypothetical protein	NA	D7NW47	Streptomyces_phage	44.6	3.9e-20
AZM54155.1|3922889_3924530_+	hypothetical protein	NA	D7NW48	Streptomyces_phage	59.7	5.1e-185
AZM54156.1|3924540_3926070_+	hypothetical protein	NA	D7NW49	Streptomyces_phage	62.1	7.6e-175
AZM54157.1|3926066_3927032_+	hypothetical protein	NA	A0A2H5BLR1	Streptomyces_phage	38.8	2.0e-40
AZM54158.1|3927075_3927837_+	hypothetical protein	NA	D7NW52	Streptomyces_phage	59.5	4.2e-41
AZM54159.1|3927850_3928714_+|coat	P22 coat protein - protein 5 domain protein	coat	D7NW53	Streptomyces_phage	50.2	1.3e-70
AZM54160.1|3928737_3929115_+	hypothetical protein	NA	NA	NA	NA	NA
AZM54161.1|3929663_3930257_+	hypothetical protein	NA	D7NW55	Streptomyces_phage	54.3	3.2e-52
AZM57749.1|3930307_3930595_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AZM54162.1|3930605_3930932_+	hypothetical protein	NA	D7NW57	Streptomyces_phage	51.4	2.3e-20
AZM54163.1|3930934_3931312_+	hypothetical protein	NA	D7NW58	Streptomyces_phage	44.9	3.2e-18
AZM54164.1|3931308_3931518_+	hypothetical protein	NA	NA	NA	NA	NA
AZM54165.1|3931514_3931916_+	DUF3168 domain-containing protein	NA	D7NW59	Streptomyces_phage	62.6	6.0e-39
AZM54166.1|3931928_3932351_+|capsid	outer capsid protein Hoc	capsid	D7NW60	Streptomyces_phage	69.3	1.6e-50
AZM54167.1|3932350_3932563_+	hypothetical protein	NA	NA	NA	NA	NA
AZM54168.1|3932559_3932928_+	hypothetical protein	NA	D7NW62	Streptomyces_phage	52.5	1.6e-25
AZM54169.1|3932960_3933275_+	hypothetical protein	NA	A0A0R6PJ91	Moraxella_phage	52.9	3.4e-05
AZM54170.1|3933297_3935430_+	hypothetical protein	NA	A0A1J0MC44	Streptomyces_phage	40.7	1.6e-21
AZM54171.1|3935449_3936829_+	hypothetical protein	NA	A0A0R8VCN8	Thermobifida_phage	39.4	4.6e-78
AZM54172.1|3936839_3939536_+	hypothetical protein	NA	A0A0R8V0A4	Thermobifida_phage	42.4	6.4e-217
AZM54173.1|3939545_3940076_+	hypothetical protein	NA	A0A0R8VCH8	Thermobifida_phage	36.1	9.1e-19
AZM54174.1|3940140_3940935_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4PI36	Streptomyces_phage	43.6	4.2e-52
AZM54175.1|3940946_3941174_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	59.6	2.7e-12
AZM54176.1|3941176_3941389_+	hypothetical protein	NA	NA	NA	NA	NA
AZM54177.1|3941388_3941823_+	hypothetical protein	NA	Q6VY36	Streptomyces_phage	52.9	8.8e-36
>prophage 4
CP029617	Streptomyces sp. WAC 01529 chromosome, complete genome	8270461	6391554	6403872	8270461	plate,tail	Synechococcus_phage(50.0%)	12	NA	NA
AZM56056.1|6391554_6392172_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZM56057.1|6392168_6394148_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
AZM56058.1|6394154_6394568_-|plate	baseplate protein	plate	A0A0E3F3H3	Synechococcus_phage	34.4	3.0e-09
AZM56059.1|6394630_6396526_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AZM56060.1|6396545_6397295_-	peptidase M23	NA	NA	NA	NA	NA
AZM56061.1|6397296_6397734_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZM56062.1|6397790_6398246_-	hypothetical protein	NA	NA	NA	NA	NA
AZM56063.1|6398418_6399102_+	hypothetical protein	NA	NA	NA	NA	NA
AZM56064.1|6399141_6399993_+	hypothetical protein	NA	NA	NA	NA	NA
AZM56065.1|6401322_6401769_-	hypothetical protein	NA	NA	NA	NA	NA
AZM56066.1|6401768_6402212_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZM56067.1|6402267_6403872_-|tail	phage tail protein	tail	J9PVC2	Bacillus_phage	34.7	1.9e-67
