The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034349	Staphylococcus aureus subsp. aureus strain 80wphwpl chromosome, complete genome	2714208	697859	705680	2714208		Hokovirus(16.67%)	10	NA	NA
AZL90768.1|697859_698915_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
AZL90769.1|698914_699601_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZL90770.1|699575_700049_-	DoxX family protein	NA	NA	NA	NA	NA
AZL90771.1|700391_700832_-	hypothetical protein	NA	NA	NA	NA	NA
AZL90772.1|701111_701696_-	hypothetical protein	NA	NA	NA	NA	NA
AZL90773.1|701794_702508_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
AZL90774.1|702511_702931_-	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
AZL90775.1|702932_703601_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
AZL90776.1|703951_704545_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	43.5	2.6e-38
AZL90777.1|704528_705680_+	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
>prophage 2
CP034349	Staphylococcus aureus subsp. aureus strain 80wphwpl chromosome, complete genome	2714208	717652	731790	2714208		uncultured_Caudovirales_phage(50.0%)	15	NA	NA
AZL90787.1|717652_718711_+	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.5	5.7e-20
AZL90788.1|718869_719412_+	5'(3')-deoxyribonucleotidase	NA	NA	NA	NA	NA
AZL90789.1|719963_720881_-	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	8.2e-07
AZL90790.1|720971_721073_+	hypothetical protein	NA	NA	NA	NA	NA
AZL90791.1|721150_722656_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
AZL90792.1|722717_722966_-	hypothetical protein	NA	NA	NA	NA	NA
AZL90793.1|722995_723496_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	66.2	2.7e-52
AZL90794.1|723515_724382_-	DMT family transporter	NA	NA	NA	NA	NA
AZL90795.1|724766_724916_+	ribonucleoside-diphosphate reductase	NA	NA	NA	NA	NA
AZL90796.1|725183_725582_+	protein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
AZL90797.1|725544_727650_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
AZL90798.1|727769_728741_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
AZL90799.1|729117_730089_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	79.9	1.0e-140
AZL90800.1|730075_731032_+	iron ABC transporter permease	NA	A0A2H4J116	uncultured_Caudovirales_phage	60.0	5.5e-06
AZL90801.1|731028_731790_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.1	7.2e-17
>prophage 3
CP034349	Staphylococcus aureus subsp. aureus strain 80wphwpl chromosome, complete genome	2714208	814784	830428	2714208	integrase,terminase,coat	Staphylococcus_phage(89.47%)	25	814625:814644	830883:830902
814625:814644	attL	GTTATTCCTGCTAAATAATT	NA	NA	NA	NA
AZL90879.1|814784_816005_-|integrase	site-specific integrase	integrase	Q4ZE80	Staphylococcus_phage	47.3	1.1e-99
AZL90880.1|816018_817407_-	SAP domain protein	NA	NA	NA	NA	NA
AZL90881.1|817433_818006_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZL90882.1|818177_818399_+	XRE family transcriptional regulator	NA	A0A2H4JFN1	uncultured_Caudovirales_phage	43.5	2.0e-07
AZL90883.1|818399_818672_+	helix-turn-helix domain-containing protein	NA	Q4ZE77	Staphylococcus_phage	84.4	7.7e-38
AZL90884.1|818683_818839_+	pathogenicity island protein	NA	NA	NA	NA	NA
AZL90885.1|818823_819027_+	pathogenicity island protein	NA	A0A1W6JQF4	Staphylococcus_phage	100.0	1.0e-31
AZL90886.1|819028_819412_+	pathogenicity island protein	NA	A0A1W6JQI7	Staphylococcus_phage	90.6	1.0e-56
AZL90887.1|819412_819706_+	DUF1474 family protein	NA	A0A1W6JQH0	Staphylococcus_phage	100.0	1.3e-43
AZL90888.1|819793_820663_+	mobile element-associated protein	NA	Q4ZE74	Staphylococcus_phage	95.2	1.1e-162
AZL90889.1|820676_822386_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	95.8	0.0e+00
AZL90890.1|822715_823096_+	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	98.4	1.5e-68
AZL90891.1|823092_823734_+	pathogenicity island protein	NA	Q4ZE67	Staphylococcus_phage	93.4	1.9e-111
AZL90892.1|824269_824611_+	pathogenicity island protein	NA	Q4ZE66	Staphylococcus_phage	99.1	1.4e-57
AZL90893.1|824622_825201_+	pathogenicity island protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.4	1.4e-28
AZL90894.1|825218_825437_+	hypothetical protein	NA	NA	NA	NA	NA
AZL90895.1|825487_826015_+|coat	spore coat protein	coat	Q4ZE87	Staphylococcus_phage	96.0	1.6e-87
AZL92670.1|826146_826359_+	pathogenicity island family protein	NA	Q4ZE86	Staphylococcus_phage	91.4	1.7e-29
AZL90896.1|826355_826925_+|terminase	terminase small subunit	terminase	A0A1W6JQF0	Staphylococcus_phage	97.4	6.0e-101
AZL90897.1|827125_828148_+	hypothetical protein	NA	NA	NA	NA	NA
AZL90898.1|828166_828730_+	hypothetical protein	NA	NA	NA	NA	NA
AZL90899.1|828978_829533_-	DUF4888 domain-containing protein	NA	A0A1W6JQE5	Staphylococcus_phage	76.6	4.7e-74
AZL90900.1|829907_830060_+	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	100.0	3.1e-20
AZL90901.1|830130_830241_+	hypothetical protein	NA	W5R8J7	Staphylococcus_phage	97.2	3.8e-12
AZL90902.1|830227_830428_+	hypothetical protein	NA	W5R9N2	Staphylococcus_phage	100.0	3.7e-29
830883:830902	attR	GTTATTCCTGCTAAATAATT	NA	NA	NA	NA
>prophage 4
CP034349	Staphylococcus aureus subsp. aureus strain 80wphwpl chromosome, complete genome	2714208	917765	966902	2714208	tRNA,protease,holin,transposase	Bacillus_virus(22.22%)	44	NA	NA
AZL90982.1|917765_918713_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
AZL90983.1|918828_920298_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZL90984.1|920348_921335_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
AZL90985.1|921337_922318_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
AZL90986.1|922310_923273_+	ABC transporter permease	NA	NA	NA	NA	NA
AZL90987.1|923284_924166_+	ABC transporter permease	NA	NA	NA	NA	NA
AZL90988.1|924254_925822_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
AZL90989.1|926117_927764_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.1	2.8e-292
AZL90990.1|927790_928780_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AZL90991.1|929074_929470_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AZL90992.1|929840_930560_+	adaptor protein MecA	NA	NA	NA	NA	NA
AZL90993.1|930680_931667_+	competence protein CoiA	NA	NA	NA	NA	NA
AZL90994.1|931714_933523_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	9.3e-47
AZL90995.1|933982_934789_-	DsbA family protein	NA	NA	NA	NA	NA
AZL90996.1|934811_935177_-	globin	NA	NA	NA	NA	NA
AZL90997.1|935280_935874_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AZL90998.1|936059_936407_+	hypothetical protein	NA	NA	NA	NA	NA
AZL90999.1|936423_937059_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AZL91000.1|937075_937885_+	NAD(+) kinase	NA	NA	NA	NA	NA
AZL91001.1|937881_938736_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AZL91002.1|938756_940142_+	magnesium transporter	NA	NA	NA	NA	NA
AZL91003.1|940151_941996_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AZL91004.1|942273_943044_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AZL91005.1|943238_944324_-	AI-2E family transporter	NA	NA	NA	NA	NA
AZL91006.1|944665_946234_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
AZL91007.1|946376_947135_+	esterase family protein	NA	NA	NA	NA	NA
AZL91008.1|947300_948026_+	hypothetical protein	NA	NA	NA	NA	NA
AZL91009.1|948027_948879_+	base excision DNA repair protein	NA	NA	NA	NA	NA
AZL91010.1|949621_950131_+	hypothetical protein	NA	NA	NA	NA	NA
AZL91011.1|950243_951452_-	MFS transporter	NA	NA	NA	NA	NA
AZL91012.1|951411_952587_-	diacylglycerol beta-glucosyltransferase	NA	NA	NA	NA	NA
AZL91013.1|953018_954503_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
AZL91014.1|954483_954744_+	hypothetical protein	NA	NA	NA	NA	NA
AZL91015.1|954743_956306_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
AZL91016.1|956607_957411_+	hypothetical protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
AZL91017.1|957629_959954_+|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	26.8	4.0e-10
AZL91018.1|959970_961329_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
AZL92673.1|961467_962979_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AZL91019.1|963467_964037_-	competence protein ComK	NA	NA	NA	NA	NA
AZL91020.1|964246_964465_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
AZL91021.1|964545_965532_-	lipoate--protein ligase	NA	NA	NA	NA	NA
AZL91022.1|965730_965907_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AZL91023.1|965921_966524_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZL92674.1|966824_966902_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 5
CP034349	Staphylococcus aureus subsp. aureus strain 80wphwpl chromosome, complete genome	2714208	1003770	1012243	2714208		Synechococcus_phage(33.33%)	9	NA	NA
AZL91059.1|1003770_1004253_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
AZL91060.1|1004239_1005364_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AZL91061.1|1005367_1006072_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.6	7.3e-48
AZL91062.1|1006071_1006335_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AZL91063.1|1006336_1007008_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AZL91064.1|1007000_1009190_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.2	5.1e-140
AZL91065.1|1009168_1010653_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	8.5e-46
AZL91066.1|1010645_1011674_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	7.6e-62
AZL91067.1|1011676_1012243_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.6e-29
>prophage 6
CP034349	Staphylococcus aureus subsp. aureus strain 80wphwpl chromosome, complete genome	2714208	1553068	1561380	2714208	tRNA	Staphylococcus_phage(16.67%)	7	NA	NA
AZL91558.1|1553068_1553854_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
AZL91559.1|1553979_1554870_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
AZL91560.1|1554879_1556226_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	1.4e-55
AZL91561.1|1556339_1557440_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	3.0e-08
AZL91562.1|1557442_1558120_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AZL91563.1|1558250_1559357_-	RNA polymerase sigma factor SigA	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
AZL91564.1|1559580_1561380_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.5e-54
>prophage 7
CP034349	Staphylococcus aureus subsp. aureus strain 80wphwpl chromosome, complete genome	2714208	1630817	1641779	2714208	tRNA,transposase	uncultured_Mediterranean_phage(42.86%)	8	NA	NA
AZL91632.1|1630817_1631336_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
AZL91633.1|1631357_1633631_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	6.2e-64
AZL91634.1|1633833_1636113_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
AZL91635.1|1636362_1638009_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
AZL91636.1|1638306_1638567_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
AZL91637.1|1638585_1639725_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
AZL91638.1|1639747_1640773_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AZL91639.1|1640774_1641779_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
>prophage 8
CP034349	Staphylococcus aureus subsp. aureus strain 80wphwpl chromosome, complete genome	2714208	1764907	1834405	2714208	tRNA,protease,transposase	Staphylococcus_phage(93.18%)	67	NA	NA
AZL91749.1|1764907_1771015_-	YSIRK signal domain/LPXTG anchor domain surface protein	NA	A0A2H4PQU6	Staphylococcus_phage	68.3	8.7e-222
AZL91750.1|1771338_1771650_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	96.1	4.5e-50
AZL91751.1|1771671_1774089_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	98.7	0.0e+00
AZL91752.1|1774377_1775559_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	9.6e-218
AZL91753.1|1775668_1776622_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	99.3	6.4e-79
AZL91754.1|1776618_1777182_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	95.7	1.1e-99
AZL91755.1|1777300_1777702_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZL91756.1|1778274_1779102_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZL91757.1|1779104_1779224_-	hypothetical protein	NA	NA	NA	NA	NA
AZL91758.1|1779235_1779427_-	hypothetical protein	NA	NA	NA	NA	NA
AZL91759.1|1779335_1780337_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	98.8	1.9e-182
AZL91760.1|1780458_1780923_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	97.4	3.2e-68
AZL91761.1|1780935_1782117_-	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	6.6e-227
AZL91762.1|1782127_1782760_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.0	8.4e-112
AZL92701.1|1782766_1783798_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.3	5.8e-195
AZL91763.1|1784290_1785793_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	5.0e-30
AZL91764.1|1786435_1786750_+	ArsR family transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	1.3e-52
AZL91765.1|1786749_1788042_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	95.1	2.6e-216
AZL91766.1|1788128_1788983_-	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
AZL91767.1|1789258_1789483_-	hypothetical protein	NA	NA	NA	NA	NA
AZL91768.1|1789681_1790152_+	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	85.8	7.7e-70
AZL91769.1|1790264_1790708_+	competence protein ComK	NA	NA	NA	NA	NA
AZL91770.1|1790694_1791138_-	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	77.4	2.4e-49
AZL91771.1|1791435_1792071_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZL91772.1|1792237_1792858_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZL91773.1|1793256_1793970_-	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
AZL91774.1|1794228_1794531_+	hypothetical protein	NA	NA	NA	NA	NA
AZL91775.1|1794785_1795151_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
AZL91776.1|1795147_1795501_+	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	97.4	4.2e-20
AZL91777.1|1795750_1796584_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.6	1.2e-158
AZL91778.1|1796795_1797704_-	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.7	9.8e-138
AZL91779.1|1797828_1799022_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
AZL91780.1|1799393_1800986_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	99.8	0.0e+00
AZL92702.1|1801278_1802025_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	97.2	3.3e-139
AZL91781.1|1802029_1802503_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	9.5e-84
AZL91782.1|1802568_1802826_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
AZL91783.1|1802822_1803824_-	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	96.7	8.5e-183
AZL91784.1|1803828_1805307_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.2	2.4e-282
AZL92703.1|1805465_1805921_-	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	94.5	3.5e-75
AZL91785.1|1806223_1806874_+	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	88.4	1.0e-51
AZL91786.1|1806954_1807950_+	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	3.8e-74
AZL91787.1|1808025_1808652_+	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	84.1	4.5e-81
AZL91788.1|1808692_1809037_+	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	5.1e-55
AZL91789.1|1809134_1809707_+	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.8	3.2e-25
AZL91790.1|1809855_1811223_-	FRG domain-containing protein	NA	NA	NA	NA	NA
AZL91791.1|1811222_1811792_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	54.8	2.2e-39
AZL91792.1|1811984_1812431_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AZL91793.1|1812512_1812737_-	hypothetical protein	NA	NA	NA	NA	NA
AZL91794.1|1812881_1812977_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
AZL91795.1|1813099_1813201_+	hypothetical protein	NA	NA	NA	NA	NA
AZL91796.1|1813375_1813819_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AZL91797.1|1813818_1814262_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AZL91798.1|1815228_1817649_+	hyaluronate lyase	NA	NA	NA	NA	NA
AZL92704.1|1817774_1818134_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AZL91799.1|1818361_1818811_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AZL91800.1|1818853_1820464_+	lipase	NA	NA	NA	NA	NA
AZL91801.1|1820478_1820778_+	secretion protein	NA	NA	NA	NA	NA
AZL91802.1|1823200_1824049_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	46.9	8.6e-35
AZL91803.1|1824041_1825781_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.6	3.2e-286
AZL91804.1|1825960_1826680_-|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	98.3	1.0e-129
AZL91805.1|1826849_1827566_-|protease	serine protease SplE	protease	A0A2H4PQN5	Staphylococcus_phage	97.1	6.6e-129
AZL91806.1|1827729_1828446_-|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	64.7	2.4e-86
AZL91807.1|1828612_1829329_-|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	62.6	5.5e-83
AZL91808.1|1829452_1830172_-|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	93.7	6.4e-124
AZL91809.1|1830472_1830718_+	hypothetical protein	NA	NA	NA	NA	NA
AZL91810.1|1831186_1831702_+	hypothetical protein	NA	NA	NA	NA	NA
AZL91811.1|1832837_1834405_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
