The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034338	Pseudomonas entomophila strain 1257 chromosome, complete genome	6049604	1953910	2012806	6049604	head,tail,terminase,portal,protease,integrase,plate,capsid,holin,lysis,tRNA	uncultured_Caudovirales_phage(48.57%)	64	1947805:1947835	2017646:2017676
1947805:1947835	attL	CCCTTCGCGGGTAAACCCGCTCCCACAGGTT	NA	NA	NA	NA
AZL67917.1|1953910_1954921_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AZL67918.1|1955025_1956147_+|integrase	site-specific integrase	integrase	L7TP61	Pseudomonas_virus	61.2	1.0e-131
AZL67919.1|1957156_1957366_-	hypothetical protein	NA	NA	NA	NA	NA
AZL67920.1|1957676_1958291_+	hypothetical protein	NA	NA	NA	NA	NA
AZL67921.1|1958466_1958742_-	Pyocin activator protein PrtN	NA	A0A2K8HN48	Pseudomonas_phage	60.4	3.5e-22
AZL67922.1|1958738_1958957_-	hypothetical protein	NA	NA	NA	NA	NA
AZL67923.1|1958953_1960783_-	DNA cytosine methyltransferase	NA	A0A1I9KFW0	Aeromonas_phage	35.6	6.2e-91
AZL67924.1|1961336_1961744_-	hypothetical protein	NA	NA	NA	NA	NA
AZL67925.1|1961801_1962119_-	transcriptional regulator	NA	NA	NA	NA	NA
AZL67926.1|1962069_1962288_-	hypothetical protein	NA	NA	NA	NA	NA
AZL67927.1|1962277_1962562_-	DNA-binding protein	NA	NA	NA	NA	NA
AZL67928.1|1962571_1962883_-	hypothetical protein	NA	NA	NA	NA	NA
AZL67929.1|1963129_1963798_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	40.2	5.7e-34
AZL67930.1|1963901_1964126_+	XRE family transcriptional regulator	NA	A0A127KNT2	Pseudomonas_phage	58.6	1.7e-14
AZL67931.1|1964731_1965250_+	hypothetical protein	NA	NA	NA	NA	NA
AZL67932.1|1965242_1965461_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
AZL67933.1|1965450_1967667_+	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	46.3	3.2e-182
AZL67934.1|1967663_1968029_+	hypothetical protein	NA	NA	NA	NA	NA
AZL67935.1|1968541_1968889_+|holin	holin	holin	A0A2H4J893	uncultured_Caudovirales_phage	79.6	1.2e-43
AZL67936.1|1969025_1969547_+	DNA packaging protein	NA	A0A2D1GMW4	Marinobacter_phage	41.9	2.3e-22
AZL67937.1|1969551_1971477_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	50.2	1.9e-167
AZL67938.1|1971488_1971704_+	hypothetical protein	NA	NA	NA	NA	NA
AZL67939.1|1971706_1973314_+|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	42.0	2.0e-93
AZL67940.1|1973316_1974537_+	S49 family peptidase	NA	A0A219YB02	Aeromonas_phage	41.6	9.7e-48
AZL67941.1|1974549_1974900_+|head	head decoration protein	head	A0A2D1GMY6	Marinobacter_phage	34.5	2.6e-06
AZL67942.1|1974911_1975943_+|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	42.3	1.8e-71
AZL67943.1|1975944_1976250_+	hypothetical protein	NA	NA	NA	NA	NA
AZL67944.1|1976252_1976573_+	hypothetical protein	NA	NA	NA	NA	NA
AZL67945.1|1976569_1977232_+	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	61.5	1.4e-72
AZL67946.1|1977224_1977713_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	48.0	4.2e-34
AZL67947.1|1977709_1978354_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.4	3.7e-54
AZL67948.1|1978395_1978617_+	hypothetical protein	NA	NA	NA	NA	NA
AZL67949.1|1978619_1978946_+|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	60.4	2.9e-31
AZL67950.1|1978942_1979824_+|plate	baseplate assembly protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	68.6	9.3e-109
AZL67951.1|1979825_1980437_+|tail	phage tail protein I	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	60.5	4.5e-62
AZL67952.1|1980429_1982586_+	hypothetical protein	NA	M1TAS6	Escherichia_phage	34.1	1.5e-54
AZL67953.1|1982607_1982967_+	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	45.5	5.6e-12
AZL67954.1|1983049_1984216_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	82.0	6.4e-182
AZL67955.1|1984228_1984738_+|tail	phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	73.7	2.3e-67
AZL67956.1|1984765_1985062_+|tail	phage tail assembly protein	tail	A0A2H4J873	uncultured_Caudovirales_phage	56.4	2.4e-21
AZL67957.1|1985193_1987776_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	37.1	4.0e-67
AZL67958.1|1987785_1988625_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	54.3	3.3e-79
AZL67959.1|1988599_1988806_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	70.1	2.9e-21
AZL67960.1|1988861_1989914_+	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	71.5	6.9e-143
AZL67961.1|1989937_1990489_+	glycoside hydrolase family 19 protein	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	65.9	3.3e-64
AZL67962.1|1990488_1991031_+|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	50.3	2.3e-25
AZL67963.1|1991182_1991977_+	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	67.5	2.4e-103
AZL67964.1|1992238_1994875_-	hypothetical protein	NA	NA	NA	NA	NA
AZL67965.1|1996006_1996324_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZL67966.1|1996325_1996622_-	DNA-binding protein	NA	NA	NA	NA	NA
AZL67967.1|1996850_1997867_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AZL67968.1|1997960_1998230_-	DUF3077 domain-containing protein	NA	NA	NA	NA	NA
AZL67969.1|1998385_1998634_-	hypothetical protein	NA	NA	NA	NA	NA
AZL67970.1|1999118_1999454_+	hypothetical protein	NA	A0A2H4JER5	uncultured_Caudovirales_phage	61.5	1.7e-26
AZL67971.1|1999874_2000912_-	hypothetical protein	NA	NA	NA	NA	NA
AZL67972.1|2001373_2001616_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AZL67973.1|2002088_2002865_-	hypothetical protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	51.5	2.0e-59
AZL67974.1|2003100_2003532_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	45.5	8.8e-20
AZL71419.1|2003524_2004799_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	48.7	6.3e-106
AZL67975.1|2007140_2007845_+	hypothetical protein	NA	NA	NA	NA	NA
AZL67976.1|2007844_2008777_+	hypothetical protein	NA	NA	NA	NA	NA
AZL67977.1|2008872_2009580_-	hypothetical protein	NA	NA	NA	NA	NA
AZL67978.1|2009654_2010128_-	hypothetical protein	NA	NA	NA	NA	NA
AZL67979.1|2010178_2012806_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
2017646:2017676	attR	CCCTTCGCGGGTAAACCCGCTCCCACAGGTT	NA	NA	NA	NA
>prophage 2
CP034338	Pseudomonas entomophila strain 1257 chromosome, complete genome	6049604	2960954	3058389	6049604	head,tail,terminase,portal,integrase,plate,capsid,holin,tRNA	Pseudomonas_phage(43.4%)	110	2980793:2980811	3063131:3063149
AZL68728.1|2960954_2961656_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AZL68729.1|2961826_2962207_+	RidA family protein	NA	NA	NA	NA	NA
AZL68730.1|2962476_2964477_+	U32 family peptidase	NA	Q6DW11	Phage_TP	30.9	2.3e-22
AZL68731.1|2964621_2965179_+	transcriptional regulator	NA	NA	NA	NA	NA
AZL68732.1|2965349_2966753_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
AZL68733.1|2966752_2969884_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	2.4e-50
AZL68734.1|2969899_2971042_-	MexC family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZL68735.1|2971223_2972756_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AZL68736.1|2972757_2973201_-	hypothetical protein	NA	NA	NA	NA	NA
AZL68737.1|2973347_2974358_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	27.7	9.0e-07
AZL68738.1|2974379_2975516_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.4	2.9e-38
AZL68739.1|2976041_2977292_-	OprD family porin	NA	NA	NA	NA	NA
AZL68740.1|2977354_2978557_-	benzoate transporter BenE	NA	NA	NA	NA	NA
AZL68741.1|2978670_2979597_-	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
AZL68742.1|2979634_2979925_-	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
AZL68743.1|2980057_2981182_-	muconate cycloisomerase	NA	NA	NA	NA	NA
2980793:2980811	attL	GCCACCGAGCAGCTCGCTG	NA	NA	NA	NA
AZL68744.1|2981211_2982534_-	MFS transporter	NA	NA	NA	NA	NA
AZL68745.1|2982590_2983352_-	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	NA	NA	NA	NA
AZL68746.1|2983531_2984542_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
AZL68747.1|2984610_2985096_-	benzoate 1,2-dioxygenase small subunit	NA	NA	NA	NA	NA
AZL68748.1|2985092_2986451_-	benzoate 1,2-dioxygenase large subunit	NA	NA	NA	NA	NA
AZL68749.1|2986706_2987249_-	hypothetical protein	NA	NA	NA	NA	NA
AZL68750.1|2987245_2988724_-	hypothetical protein	NA	NA	NA	NA	NA
AZL68751.1|2989367_2990429_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	50.0	1.1e-84
AZL68752.1|2990513_2990795_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AZL71455.1|2990805_2992743_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZL68753.1|2992739_2993798_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
AZL68754.1|2993797_2994814_+	ABC transporter permease	NA	NA	NA	NA	NA
AZL68755.1|2994946_2996335_+	AAA family ATPase	NA	NA	NA	NA	NA
AZL68756.1|2996585_2997977_+	GntP family permease	NA	NA	NA	NA	NA
AZL68757.1|2997987_2998758_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
AZL68758.1|2998813_2999293_+	ecotin	NA	NA	NA	NA	NA
AZL68759.1|2999369_3001328_+	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
AZL68760.1|3001364_3001640_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AZL68761.1|3001771_3004204_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AZL68762.1|3004200_3004824_-	LysE family translocator	NA	NA	NA	NA	NA
AZL68763.1|3005017_3005833_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZL68764.1|3006394_3007189_-	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	50.4	5.7e-65
AZL68765.1|3007264_3007777_+	DUF3016 domain-containing protein	NA	NA	NA	NA	NA
AZL68766.1|3007780_3008290_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
AZL68767.1|3008426_3008669_+	hypothetical protein	NA	NA	NA	NA	NA
AZL68768.1|3008675_3009179_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	53.3	1.2e-20
AZL68769.1|3009273_3009630_-	hypothetical protein	NA	NA	NA	NA	NA
AZL68770.1|3009896_3010103_+	hypothetical protein	NA	NA	NA	NA	NA
AZL68771.1|3011250_3012417_+	acyltransferase	NA	NA	NA	NA	NA
AZL68772.1|3012413_3012554_-	DUF2514 family protein	NA	NA	NA	NA	NA
AZL68773.1|3012645_3012855_-	hypothetical protein	NA	NA	NA	NA	NA
AZL68774.1|3012872_3013082_-	hypothetical protein	NA	A0A2H4JG60	uncultured_Caudovirales_phage	46.0	2.0e-06
AZL68775.1|3013086_3013575_-	DUF2514 domain-containing protein	NA	A0A2H4J3Q6	uncultured_Caudovirales_phage	74.2	3.8e-35
AZL68776.1|3013586_3014216_-	glycoside hydrolase family 19 protein	NA	A0A2H4J3Y3	uncultured_Caudovirales_phage	81.2	2.7e-94
AZL68777.1|3014256_3014601_-|tail	tail assembly chaperone	tail	A0A0M4RTP2	Salmonella_phage	37.2	6.8e-07
AZL68778.1|3014597_3015983_-	hypothetical protein	NA	A0A077K818	Ralstonia_phage	52.9	9.7e-28
AZL68779.1|3015987_3016587_-	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	59.0	6.4e-61
AZL68780.1|3016577_3017606_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	55.1	3.0e-98
AZL71456.1|3017595_3017991_-	hypothetical protein	NA	B5TK74	Pseudomonas_phage	49.2	1.5e-29
AZL71457.1|3017990_3018596_-|plate	phage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	45.6	7.0e-39
AZL68781.1|3018595_3019705_-|plate	baseplate protein	plate	B5TK72	Pseudomonas_phage	56.2	4.9e-107
AZL68782.1|3019708_3020980_-	hydroxyacid dehydrogenase	NA	B5TK71	Pseudomonas_phage	40.4	4.2e-78
AZL68783.1|3020983_3022957_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	52.3	1.4e-104
AZL68784.1|3023086_3023398_-|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	58.1	9.4e-24
AZL68785.1|3023397_3023745_-|tail	phage tail protein	tail	B5TK68	Pseudomonas_phage	54.8	2.2e-29
AZL68786.1|3023802_3025308_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	61.0	2.6e-167
AZL68787.1|3025304_3025496_-	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	50.9	2.1e-05
AZL68788.1|3025492_3026089_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	35.5	3.4e-22
AZL68789.1|3026096_3026609_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	33.9	2.0e-10
AZL68790.1|3026586_3026991_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AZL68791.1|3026993_3027545_-	hypothetical protein	NA	NA	NA	NA	NA
AZL68792.1|3027547_3027796_-	hypothetical protein	NA	NA	NA	NA	NA
AZL71458.1|3027849_3029145_-|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	60.9	9.1e-145
AZL68793.1|3029224_3030196_-	S49 family peptidase	NA	A4JX00	Burkholderia_virus	52.6	1.5e-83
AZL68794.1|3030192_3031464_-|portal	phage portal protein	portal	A4JWZ9	Burkholderia_virus	62.9	3.0e-148
AZL68795.1|3031466_3031655_-	hypothetical protein	NA	A4JWZ8	Burkholderia_virus	56.7	4.4e-08
AZL68796.1|3031651_3033448_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	40.3	2.7e-115
AZL68797.1|3033407_3033875_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	57.1	5.7e-41
AZL68798.1|3034011_3034332_-	HNH endonuclease	NA	Q9B020	Phage_GMSE-1	42.3	1.8e-17
AZL68799.1|3034335_3034659_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	52.5	7.5e-24
AZL68800.1|3034732_3035284_-	hypothetical protein	NA	NA	NA	NA	NA
AZL68801.1|3035865_3036552_-	hypothetical protein	NA	A0A1B0VMF2	Pseudomonas_phage	63.6	3.9e-78
AZL68802.1|3036562_3036880_-	hypothetical protein	NA	A0A2D1GNG3	Pseudomonas_phage	61.9	3.1e-30
AZL68803.1|3036876_3037173_-	hypothetical protein	NA	NA	NA	NA	NA
AZL68804.1|3037169_3038468_-|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	54.1	1.8e-124
AZL68805.1|3038464_3038905_-	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	66.7	1.5e-43
AZL68806.1|3038901_3039198_-	DUF1364 domain-containing protein	NA	H9C174	Pectobacterium_phage	73.6	4.0e-32
AZL71459.1|3039179_3039386_-	hypothetical protein	NA	NA	NA	NA	NA
AZL68807.1|3039394_3040078_-	Replication protein P	NA	B5WZY0	Pseudomonas_phage	49.2	2.1e-47
AZL68808.1|3040074_3040803_-	hypothetical protein	NA	A0A1J0MCP9	Streptomyces_phage	41.7	3.1e-17
AZL68809.1|3040918_3041443_+	hypothetical protein	NA	NA	NA	NA	NA
AZL68810.1|3041762_3041993_-	hypothetical protein	NA	A0A1W6JTD1	Pseudomonas_phage	59.2	1.8e-16
AZL71460.1|3042139_3042838_+	helix-turn-helix transcriptional regulator	NA	W6MVG5	Pseudomonas_phage	59.6	3.7e-68
AZL68811.1|3043299_3043974_+	polysaccharide lyase family 7 protein	NA	NA	NA	NA	NA
AZL71461.1|3044137_3044968_+	hypothetical protein	NA	A0A1B0YZX8	Pseudomonas_phage	63.3	2.2e-80
AZL68812.1|3044971_3045355_+	LuxR family transcriptional regulator	NA	A0A2H4JA92	uncultured_Caudovirales_phage	58.8	2.1e-25
AZL68813.1|3045377_3045647_+	hypothetical protein	NA	NA	NA	NA	NA
AZL68814.1|3045643_3046189_+	hypothetical protein	NA	NA	NA	NA	NA
AZL68815.1|3046270_3046654_+	hypothetical protein	NA	NA	NA	NA	NA
AZL68816.1|3046955_3047159_-	hypothetical protein	NA	NA	NA	NA	NA
AZL68817.1|3047273_3047987_+	hypothetical protein	NA	NA	NA	NA	NA
AZL68818.1|3048074_3048953_-	hypothetical protein	NA	NA	NA	NA	NA
AZL68819.1|3049155_3049506_+	hypothetical protein	NA	A0A1B0VME6	Pseudomonas_phage	50.0	1.8e-07
AZL68820.1|3049718_3050072_+	hypothetical protein	NA	NA	NA	NA	NA
AZL68821.1|3050055_3050409_-	hypothetical protein	NA	NA	NA	NA	NA
AZL68822.1|3050494_3051421_-	hypothetical protein	NA	NA	NA	NA	NA
AZL68823.1|3051751_3052702_+	DNA cytosine methyltransferase	NA	Q6V7R9	Burkholderia_virus	56.7	3.0e-105
AZL68824.1|3053289_3053619_+	hypothetical protein	NA	A0A1B0VM42	Pseudomonas_phage	67.9	2.0e-40
AZL68825.1|3053615_3053813_+	hypothetical protein	NA	A0A2H4J399	uncultured_Caudovirales_phage	68.6	4.7e-05
AZL68826.1|3053809_3054193_+	ASCH domain-containing protein	NA	A0A291AUQ6	Sinorhizobium_phage	45.5	1.9e-26
AZL68827.1|3054189_3054495_+	hypothetical protein	NA	A0A2H4JA03	uncultured_Caudovirales_phage	91.1	2.1e-44
AZL68828.1|3054538_3055333_+	site-specific DNA-methyltransferase	NA	A0A0H5BBV5	Pseudomonas_phage	67.4	1.8e-98
AZL68829.1|3055588_3056782_+|integrase	site-specific integrase	integrase	J7HXC4	Pseudomonas_phage	57.1	1.2e-122
AZL68830.1|3056802_3058389_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.8	4.9e-60
3063131:3063149	attR	GCCACCGAGCAGCTCGCTG	NA	NA	NA	NA
>prophage 3
CP034338	Pseudomonas entomophila strain 1257 chromosome, complete genome	6049604	3493672	3532404	6049604	head,tail,terminase,portal,protease,integrase,capsid,holin	Pseudomonas_phage(62.16%)	53	3516080:3516096	3530378:3530394
AZL69191.1|3493672_3494161_-	glycoside hydrolase	NA	Q9MC90	Pseudomonas_phage	66.0	8.6e-56
AZL69192.1|3494219_3494573_-	hypothetical protein	NA	NA	NA	NA	NA
AZL69193.1|3494576_3495806_-	hypothetical protein	NA	NA	NA	NA	NA
AZL69194.1|3495816_3496557_-	hypothetical protein	NA	NA	NA	NA	NA
AZL69195.1|3496837_3500530_-	DUF1983 domain-containing protein	NA	A0A2D1GNE3	Pseudomonas_phage	54.0	0.0e+00
AZL69196.1|3500584_3501169_-|tail	tail assembly protein	tail	A0A2D1GNM2	Pseudomonas_phage	70.0	7.4e-70
AZL69197.1|3501165_3501948_-|tail	phage tail protein	tail	A0A2D1GNP8	Pseudomonas_phage	75.8	9.1e-124
AZL69198.1|3501951_3502653_-|tail	phage minor tail protein L	tail	A0A2D1GNF3	Pseudomonas_phage	77.4	9.4e-104
AZL69199.1|3502689_3503037_-|tail	phage tail protein	tail	A0A2D1GNJ1	Pseudomonas_phage	52.6	1.2e-27
AZL69200.1|3503036_3506435_-|tail	phage tail tape measure protein	tail	A0A2D1GNQ1	Pseudomonas_phage	43.9	3.3e-61
AZL69201.1|3506490_3506877_-	hypothetical protein	NA	NA	NA	NA	NA
AZL71481.1|3506911_3507169_-	hypothetical protein	NA	Q9MCA3	Pseudomonas_phage	47.7	3.9e-15
AZL69202.1|3507195_3507534_-	hypothetical protein	NA	NA	NA	NA	NA
AZL69203.1|3507543_3508269_-|tail	phage tail protein	tail	H2BDC0	Pseudomonas_virus	44.5	6.6e-44
AZL69204.1|3508558_3508927_-	DUF3168 domain-containing protein	NA	A0A1J0GUW9	Halomonas_phage	58.2	2.7e-33
AZL69205.1|3508935_3509400_-	hypothetical protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	48.0	2.5e-28
AZL69206.1|3509392_3509734_-|head,tail	head-tail adaptor protein	head,tail	K7PH08	Enterobacteria_phage	50.0	2.4e-20
AZL69207.1|3509733_3510210_-|head,tail	phage gp6-like head-tail connector protein	head,tail	G3ENA1	Psychrobacter_phage	38.3	2.9e-16
AZL69208.1|3510646_3511861_-|capsid	phage major capsid protein	capsid	A0A0U4JIW8	Pseudomonas_phage	81.3	9.6e-181
AZL69209.1|3511875_3512751_-|protease	Clp protease ClpP	protease	A0A0U4B0J0	Pseudomonas_phage	72.5	4.0e-112
AZL69210.1|3512764_3514165_-|portal	phage portal protein	portal	A0A0U4IJ43	Pseudomonas_phage	83.5	1.7e-226
AZL69211.1|3514161_3515859_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	58.1	1.3e-180
AZL69212.1|3515855_3516329_-	hypothetical protein	NA	A0A2H4J8R0	uncultured_Caudovirales_phage	41.6	2.0e-17
3516080:3516096	attL	GGTCGACCAGGTCGCCC	NA	NA	NA	NA
AZL69213.1|3516478_3516817_-	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	51.9	3.8e-26
AZL69214.1|3516816_3517005_-	hypothetical protein	NA	NA	NA	NA	NA
AZL69215.1|3517065_3517347_-|holin	phage holin family protein	holin	A0A2H4J0H1	uncultured_Caudovirales_phage	92.5	1.8e-42
AZL69216.1|3517347_3517722_-	hypothetical protein	NA	A0A2H4J7X6	uncultured_Caudovirales_phage	95.2	4.7e-62
AZL69217.1|3517786_3518146_-	hypothetical protein	NA	NA	NA	NA	NA
AZL69218.1|3518325_3518700_-	antitermination protein Q	NA	A0A1W6JTD2	Pseudomonas_phage	49.6	1.5e-28
AZL69219.1|3518696_3518984_-	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	41.4	7.6e-12
AZL69220.1|3518976_3520311_-|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	46.8	1.2e-107
AZL69221.1|3520307_3520652_-	hypothetical protein	NA	A0A0H5ARQ3	Pseudomonas_phage	55.7	1.0e-31
AZL69222.1|3520648_3522031_-	replicative DNA helicase	NA	A0A1W6JTB3	Pseudomonas_phage	62.9	7.1e-164
AZL69223.1|3522027_3522828_-	ATP-binding protein	NA	A0A1W6JTD8	Pseudomonas_phage	49.0	1.9e-60
AZL69224.1|3522808_3523543_-	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	50.4	1.0e-39
AZL69225.1|3523547_3523778_-	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	63.2	5.5e-21
AZL69226.1|3523774_3524167_-	hypothetical protein	NA	NA	NA	NA	NA
AZL69227.1|3524163_3524928_-	phage antirepressor	NA	E7DUM4	Liberibacter_phage	48.9	2.3e-31
AZL69228.1|3524924_3525212_-	hypothetical protein	NA	NA	NA	NA	NA
AZL69229.1|3525192_3525477_-	hypothetical protein	NA	NA	NA	NA	NA
AZL69230.1|3525473_3525770_-	hypothetical protein	NA	NA	NA	NA	NA
AZL69231.1|3525766_3526024_-	hypothetical protein	NA	NA	NA	NA	NA
AZL69232.1|3526397_3526694_-	hypothetical protein	NA	NA	NA	NA	NA
AZL69233.1|3526800_3527595_+	helix-turn-helix domain-containing protein	NA	A0A1B0VRI7	Pseudomonas_phage	51.2	9.1e-63
AZL69234.1|3527762_3528152_+	helix-turn-helix transcriptional regulator	NA	A0A0A0YWH0	Pseudomonas_phage	59.7	1.4e-29
AZL69235.1|3528242_3528434_+	carbon storage regulator	NA	J7I430	Pseudomonas_phage	60.8	2.4e-09
AZL69236.1|3528423_3528651_+	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	60.7	8.7e-11
AZL69237.1|3528637_3529009_+	hypothetical protein	NA	NA	NA	NA	NA
AZL69238.1|3529005_3529197_+	hypothetical protein	NA	NA	NA	NA	NA
AZL69239.1|3529506_3530241_+	hypothetical protein	NA	NA	NA	NA	NA
AZL69240.1|3530237_3531026_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	58.8	1.9e-76
3530378:3530394	attR	GGGCGACCTGGTCGACC	NA	NA	NA	NA
AZL69241.1|3531035_3531266_+	hypothetical protein	NA	A0A2H4JA17	uncultured_Caudovirales_phage	78.9	1.6e-28
AZL69242.1|3531267_3532404_+	recombinase XerD	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	66.6	9.7e-151
>prophage 4
CP034338	Pseudomonas entomophila strain 1257 chromosome, complete genome	6049604	3804331	3813988	6049604	tRNA	uncultured_Caudovirales_phage(80.0%)	12	NA	NA
AZL71496.1|3804331_3804541_-	hypothetical protein	NA	A0A2H4JG60	uncultured_Caudovirales_phage	56.2	3.1e-07
AZL69463.1|3804551_3804761_-	hypothetical protein	NA	A0A2H4JG60	uncultured_Caudovirales_phage	50.9	2.8e-08
AZL69464.1|3805435_3806107_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	88.8	1.1e-101
AZL69465.1|3806295_3807675_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.4	4.8e-27
AZL69466.1|3807762_3808155_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	82.2	1.8e-56
AZL69467.1|3808156_3808516_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	64.2	4.7e-35
AZL69468.1|3808515_3808812_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	64.6	3.5e-28
AZL69469.1|3808808_3809144_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	76.6	7.5e-43
AZL69470.1|3809140_3810142_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	79.3	7.7e-152
AZL69471.1|3810238_3811201_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AZL69472.1|3811314_3812706_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AZL69473.1|3812707_3813988_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.7	2.9e-95
>prophage 5
CP034338	Pseudomonas entomophila strain 1257 chromosome, complete genome	6049604	4599451	4708654	6049604	tail,protease,integrase,plate,holin,lysis,tRNA	uncultured_Caudovirales_phage(25.58%)	110	4593896:4593912	4636053:4636069
4593896:4593912	attL	CTGGTTGAAGTGGCGAG	NA	NA	NA	NA
AZL70141.1|4599451_4600705_+|integrase	site-specific integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	25.0	8.5e-07
AZL70142.1|4601176_4601851_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	37.7	1.8e-27
AZL70143.1|4601861_4602509_-	7-carboxy-7-deazaguanine synthase QueE	NA	NA	NA	NA	NA
AZL70144.1|4602669_4603479_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
AZL70145.1|4603485_4603983_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
AZL70146.1|4604037_4605339_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
AZL70147.1|4605335_4606412_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AZL70148.1|4606411_4606864_-	protein TolR	NA	NA	NA	NA	NA
AZL70149.1|4606878_4607574_-	protein TolQ	NA	NA	NA	NA	NA
AZL70150.1|4607576_4608029_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
AZL70151.1|4608154_4609201_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	26.5	2.3e-05
AZL70152.1|4609197_4609815_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AZL70153.1|4609923_4610448_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
AZL70154.1|4610600_4611353_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZL70155.1|4611456_4613232_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	26.1	7.3e-12
AZL70156.1|4613326_4613548_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AZL70157.1|4613610_4613979_-	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
AZL70158.1|4614160_4614634_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	37.1	6.2e-19
AZL70159.1|4614937_4615528_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	48.3	2.3e-10
AZL70160.1|4615546_4615753_-	hypothetical protein	NA	NA	NA	NA	NA
AZL70161.1|4615756_4616176_-	HIT domain-containing protein	NA	NA	NA	NA	NA
AZL70162.1|4616923_4618204_+	OprD family porin	NA	NA	NA	NA	NA
AZL70163.1|4618361_4620077_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AZL70164.1|4620098_4621052_+	hypothetical protein	NA	NA	NA	NA	NA
AZL70165.1|4621098_4622163_-	DNA polymerase IV	NA	NA	NA	NA	NA
AZL70166.1|4623128_4625771_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
AZL70167.1|4625770_4627063_+	virulence factor family protein	NA	NA	NA	NA	NA
AZL70168.1|4627099_4629010_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.1	1.2e-76
AZL70169.1|4629245_4630577_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AZL70170.1|4630671_4631130_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZL70171.1|4631250_4631961_+	RNA-binding protein	NA	NA	NA	NA	NA
AZL70172.1|4632009_4632471_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	48.7	3.8e-37
AZL70173.1|4632470_4633166_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AZL70174.1|4633243_4634023_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
AZL70175.1|4634143_4635070_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZL70176.1|4635073_4635439_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AZL70177.1|4635514_4636165_-	DNA-binding response regulator	NA	NA	NA	NA	NA
4636053:4636069	attR	CTCGCCACTTCAACCAG	NA	NA	NA	NA
AZL70178.1|4636420_4637131_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AZL70179.1|4637344_4637767_+	hypothetical protein	NA	NA	NA	NA	NA
AZL70180.1|4637768_4637969_-	hypothetical protein	NA	NA	NA	NA	NA
AZL70181.1|4638275_4639394_+	LOG family protein	NA	NA	NA	NA	NA
AZL70182.1|4639442_4639913_-	recombination regulator RecX	NA	NA	NA	NA	NA
AZL70183.1|4639921_4640989_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.7	9.2e-111
AZL70184.1|4641093_4641576_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.7	4.1e-58
AZL70185.1|4641624_4642122_-|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	48.8	8.0e-25
AZL70186.1|4642118_4642670_-	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	67.2	1.3e-68
AZL70187.1|4642587_4642866_-	Com family DNA-binding transcriptional regulator	NA	B5TK59	Pseudomonas_phage	66.7	1.4e-07
AZL70188.1|4642978_4644025_-	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	70.2	5.1e-138
AZL70189.1|4644076_4644283_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	62.7	7.4e-17
AZL70190.1|4644257_4645103_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	55.7	1.1e-82
AZL70191.1|4645115_4646723_-	hypothetical protein	NA	NA	NA	NA	NA
AZL70192.1|4647057_4647360_-|tail	phage tail assembly protein	tail	A0A2H4J873	uncultured_Caudovirales_phage	56.4	7.3e-21
AZL70193.1|4647372_4647882_-|tail	phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	71.3	1.5e-63
AZL70194.1|4647895_4649062_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	80.7	1.0e-179
AZL70195.1|4649159_4649735_-	hypothetical protein	NA	B5TK80	Pseudomonas_phage	38.4	3.2e-17
AZL70196.1|4649742_4650645_-|tail	phage tail protein	tail	B5TK79	Pseudomonas_phage	52.8	1.6e-71
AZL70197.1|4650641_4651037_-	hypothetical protein	NA	NA	NA	NA	NA
AZL70198.1|4651033_4653466_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	31.2	1.8e-48
AZL70199.1|4653458_4654070_-|tail	phage tail protein I	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	62.0	4.5e-62
AZL70200.1|4654071_4654953_-|plate	baseplate assembly protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	66.6	5.8e-103
AZL70201.1|4654949_4655276_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	67.0	6.2e-34
AZL70202.1|4655272_4655518_-	Com family DNA-binding transcriptional regulator	NA	B5TK59	Pseudomonas_phage	68.6	1.9e-11
AZL70203.1|4655550_4656153_-|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	73.5	1.0e-45
AZL70204.1|4656149_4656647_-	hypothetical protein	NA	NA	NA	NA	NA
AZL70205.1|4656643_4656997_-|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	81.2	1.4e-44
AZL70206.1|4657465_4658212_-	helix-turn-helix transcriptional regulator	NA	B5TK58	Pseudomonas_phage	83.5	2.7e-117
AZL70207.1|4658353_4660927_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.0	9.9e-26
AZL70208.1|4661066_4661390_+	Ferredoxin 1	NA	NA	NA	NA	NA
AZL70209.1|4661857_4662865_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	3.0e-34
AZL70210.1|4662970_4663828_-	LysM peptidoglycan-binding domain-containing protein	NA	I3PV79	Clostridium_phage	36.2	1.9e-13
AZL70211.1|4664005_4664686_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.5	2.4e-43
AZL70212.1|4664682_4665432_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.4	5.4e-65
AZL70213.1|4665419_4666478_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AZL70214.1|4666474_4666948_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AZL70215.1|4667125_4667974_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZL71525.1|4667984_4669097_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.5	8.0e-33
AZL70216.1|4669205_4670105_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZL70217.1|4670221_4670929_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZL70218.1|4670925_4671207_-	cell division protein FtsB	NA	NA	NA	NA	NA
AZL70219.1|4671363_4672653_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.4	4.3e-139
AZL70220.1|4672807_4673653_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.4	1.3e-51
AZL70221.1|4673656_4675285_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.9	4.5e-157
AZL70222.1|4675554_4676838_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AZL70223.1|4676957_4677905_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
AZL70224.1|4678012_4681537_-	DNA polymerase III subunit alpha	NA	A0A1C9LWZ5	Streptomyces_phage	36.1	1.1e-192
AZL70225.1|4681726_4682350_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	41.5	1.6e-22
AZL70226.1|4682351_4683479_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AZL70227.1|4683480_4684257_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZL70228.1|4684253_4684694_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
AZL70229.1|4684808_4685864_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZL70230.1|4685865_4686369_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
AZL70231.1|4686413_4688762_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AZL70232.1|4688837_4690190_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
AZL70233.1|4690223_4691414_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AZL70234.1|4691410_4692226_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AZL70235.1|4692225_4692981_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	38.1	8.5e-18
AZL70236.1|4692996_4693554_-	ribosome recycling factor	NA	NA	NA	NA	NA
AZL70237.1|4693550_4694294_-	UMP kinase	NA	NA	NA	NA	NA
AZL70238.1|4694471_4695335_-	elongation factor Ts	NA	NA	NA	NA	NA
AZL70239.1|4695521_4696259_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AZL70240.1|4696631_4697414_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AZL70241.1|4697439_4700142_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
AZL70242.1|4700163_4701363_+	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
AZL70243.1|4701811_4702570_+	peptidase M12	NA	NA	NA	NA	NA
AZL70244.1|4702702_4704349_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
AZL70245.1|4704629_4704977_+	ArsC family reductase	NA	NA	NA	NA	NA
AZL70246.1|4705008_4706043_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AZL70247.1|4706121_4707327_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	37.9	8.1e-71
AZL70248.1|4707323_4707734_+	SufE family protein	NA	NA	NA	NA	NA
AZL70249.1|4707844_4708654_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	A0A291ATS8	Pandoravirus	33.6	7.7e-17
>prophage 6
CP034338	Pseudomonas entomophila strain 1257 chromosome, complete genome	6049604	4861642	4869415	6049604		Planktothrix_phage(16.67%)	10	NA	NA
AZL70375.1|4861642_4862452_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.2	5.9e-25
AZL70376.1|4862698_4863673_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.2	4.4e-35
AZL70377.1|4863673_4864198_+	HAD family hydrolase	NA	A0A140XBD6	Dickeya_phage	46.6	3.1e-27
AZL70378.1|4864206_4864779_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AZL70379.1|4864765_4865290_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AZL70380.1|4865290_4866016_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	6.4e-23
AZL70381.1|4866200_4867694_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AZL70382.1|4867772_4868081_+	ribosome-associated translation inhibitor RaiA	NA	A0A0M7QCF2	Escherichia_phage	35.2	1.5e-05
AZL70383.1|4868093_4868558_+	PTS IIA-like nitrogen-regulatory protein PtsN	NA	NA	NA	NA	NA
AZL70384.1|4868560_4869415_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.9	6.9e-08
