The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034309	Arcobacter skirrowii strain A2S6 chromosome, complete genome	1877752	1018229	1026955	1877752		Synechococcus_phage(25.0%)	10	NA	NA
AZL54040.1|1018229_1019285_-	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	51.9	6.1e-91
AZL54041.1|1019293_1020439_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	63.8	4.6e-124
AZL54042.1|1020438_1020903_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AZL54043.1|1020912_1022289_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	34.8	2.7e-62
AZL54044.1|1022285_1022606_-	MarR family EPS-associated transcriptional regulator	NA	NA	NA	NA	NA
AZL54045.1|1022680_1023781_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	44.6	3.4e-76
AZL54046.1|1023782_1024604_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	57.8	7.1e-87
AZL54047.1|1024600_1025494_-	dTDP-4-dehydrorhamnose reductase	NA	K7QJU0	Escherichia_phage	35.8	5.6e-37
AZL54048.1|1025486_1026062_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D8EQH2	Escherichia_phage	46.5	2.4e-33
AZL54049.1|1026064_1026955_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	60.8	6.5e-102
>prophage 2
CP034309	Arcobacter skirrowii strain A2S6 chromosome, complete genome	1877752	1384739	1443320	1877752	integrase,protease,transposase	Erysipelothrix_phage(14.29%)	50	1376683:1376703	1433894:1433914
1376683:1376703	attL	ATCCCGCACATCTCCACCAAT	NA	NA	NA	NA
AZL54395.1|1384739_1385900_+|integrase	site-specific integrase	integrase	Q56VN7	Pseudomonas_phage	22.2	9.3e-08
AZL54396.1|1386779_1386968_-	hypothetical protein	NA	NA	NA	NA	NA
AZL54397.1|1387163_1387352_+	hypothetical protein	NA	NA	NA	NA	NA
AZL54398.1|1387372_1388260_-	hypothetical protein	NA	G3MA89	Bacillus_virus	40.2	2.5e-45
AZL54399.1|1388228_1388522_-	hypothetical protein	NA	NA	NA	NA	NA
AZL54400.1|1388591_1389254_-	chromosome partitioning protein ParA	NA	A4JWV7	Burkholderia_virus	31.8	1.2e-15
AZL54401.1|1389383_1392350_-	type III restriction endonuclease subunit R	NA	A0A2K5B256	Erysipelothrix_phage	45.1	9.4e-222
AZL54402.1|1392384_1393260_-	Abi family protein	NA	A3QSC6	Clostridium_virus	33.7	2.7e-36
AZL54403.1|1393396_1394686_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
AZL54404.1|1394746_1396594_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	48.6	4.4e-161
AZL54405.1|1396685_1397426_-	hypothetical protein	NA	NA	NA	NA	NA
AZL54406.1|1397526_1398261_-	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
AZL54407.1|1401780_1402077_+|transposase	transposase	transposase	NA	NA	NA	NA
AZL54408.1|1402124_1402955_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	2.1e-49
AZL54409.1|1403254_1404292_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	39.0	5.0e-21
AZL54410.1|1404284_1405172_-	hypothetical protein	NA	NA	NA	NA	NA
AZL54411.1|1405290_1406217_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AZL54412.1|1406807_1407356_-	hypothetical protein	NA	NA	NA	NA	NA
AZL54413.1|1407343_1408378_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
AZL54414.1|1408544_1410221_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
AZL54415.1|1410220_1412758_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
AZL54416.1|1412837_1414718_+	hypothetical protein	NA	NA	NA	NA	NA
AZL54417.1|1414641_1415418_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AZL54418.1|1415740_1417645_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.8	5.8e-07
AZL54895.1|1418518_1419562_+	response regulator	NA	W8CYM9	Bacillus_phage	25.6	6.7e-05
AZL54419.1|1419558_1422573_+	response regulator	NA	A0A1V0SGX0	Hokovirus	30.6	5.2e-58
AZL54420.1|1423140_1423506_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	43.2	9.7e-20
AZL54421.1|1423590_1424952_-	hypothetical protein	NA	NA	NA	NA	NA
AZL54422.1|1424948_1425614_-	response regulator	NA	NA	NA	NA	NA
AZL54423.1|1426399_1426585_+	hypothetical protein	NA	NA	NA	NA	NA
AZL54424.1|1426780_1427053_-	hypothetical protein	NA	NA	NA	NA	NA
AZL54425.1|1427055_1427340_-	hypothetical protein	NA	NA	NA	NA	NA
AZL54426.1|1427342_1427591_-	hypothetical protein	NA	NA	NA	NA	NA
AZL54427.1|1427633_1427915_-	hypothetical protein	NA	NA	NA	NA	NA
AZL54428.1|1428055_1428274_+	hypothetical protein	NA	NA	NA	NA	NA
AZL54429.1|1428424_1428652_+	hypothetical protein	NA	NA	NA	NA	NA
AZL54430.1|1428972_1429635_+	hypothetical protein	NA	NA	NA	NA	NA
AZL54431.1|1429695_1430028_-	hypothetical protein	NA	NA	NA	NA	NA
AZL54432.1|1430011_1430449_-	hypothetical protein	NA	NA	NA	NA	NA
AZL54433.1|1430441_1430957_-	hypothetical protein	NA	NA	NA	NA	NA
AZL54434.1|1430959_1431346_-	hypothetical protein	NA	NA	NA	NA	NA
AZL54435.1|1431450_1431822_-	hypothetical protein	NA	NA	NA	NA	NA
AZL54436.1|1431831_1432083_-	hypothetical protein	NA	NA	NA	NA	NA
AZL54437.1|1432438_1432852_+	hypothetical protein	NA	NA	NA	NA	NA
AZL54438.1|1432844_1433102_+	hypothetical protein	NA	NA	NA	NA	NA
AZL54439.1|1433129_1433693_+	hypothetical protein	NA	NA	NA	NA	NA
AZL54440.1|1434117_1434447_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
1433894:1433914	attR	ATCCCGCACATCTCCACCAAT	NA	NA	NA	NA
AZL54441.1|1440378_1440840_-	c-type cytochrome	NA	NA	NA	NA	NA
AZL54442.1|1440811_1443019_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	40.9	1.5e-147
AZL54443.1|1443020_1443320_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A218MMY6	uncultured_virus	39.6	4.5e-15
