The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034281	Klebsiella pneumoniae strain I72, complete genome	5430436	1235381	1283840	5430436	terminase,tail,holin,coat,transposase	Salmonella_phage(27.66%)	63	NA	NA
AZL42763.1|1235381_1236611_+	DUF4102 domain-containing protein	NA	H6WRW7	Salmonella_phage	96.1	6.6e-238
AZL46596.1|1236588_1236864_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	72.7	9.2e-31
AZL42764.1|1236902_1237142_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	71.8	2.5e-24
AZL42765.1|1237149_1237458_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	57.8	8.4e-25
AZL46597.1|1237454_1238171_-	hypothetical protein	NA	R9VWB9	Serratia_phage	63.1	6.5e-76
AZL42766.1|1238214_1239303_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	56.2	3.7e-107
AZL42767.1|1239315_1242423_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	59.4	2.0e-294
AZL42768.1|1242560_1242716_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	75.0	1.2e-14
AZL42769.1|1242724_1242916_-	DUF1482 family protein	NA	NA	NA	NA	NA
AZL42770.1|1243402_1243606_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	74.6	1.4e-20
AZL42771.1|1243654_1244461_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AZL42772.1|1244457_1245306_-	hypothetical protein	NA	NA	NA	NA	NA
AZL42773.1|1245476_1245872_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	73.3	3.1e-48
AZL42774.1|1245976_1246210_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
AZL42775.1|1246212_1246749_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.4	3.6e-63
AZL42776.1|1246836_1247025_+	hypothetical protein	NA	NA	NA	NA	NA
AZL42777.1|1247039_1247948_+	DNA-binding protein	NA	V5URT9	Shigella_phage	54.1	1.7e-89
AZL42778.1|1247950_1248700_+	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
AZL42779.1|1248707_1249043_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	5.8e-11
AZL42780.1|1249035_1249827_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	2.2e-64
AZL42781.1|1249819_1250437_+	ead/Ea22-like family protein	NA	A6N3G8	Burkholderia_virus	52.1	3.7e-19
AZL42782.1|1250433_1250613_+	hypothetical protein	NA	NA	NA	NA	NA
AZL42783.1|1250609_1251086_+	DUF551 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	56.3	7.7e-17
AZL42784.1|1251244_1251472_+	hypothetical protein	NA	NA	NA	NA	NA
AZL42785.1|1251695_1251878_+	hypothetical protein	NA	NA	NA	NA	NA
AZL42786.1|1251942_1252194_+	hypothetical protein	NA	NA	NA	NA	NA
AZL42787.1|1252193_1253678_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AZL42788.1|1253756_1253990_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
AZL42789.1|1254095_1254344_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
AZL42790.1|1254378_1254975_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	1.3e-90
AZL42791.1|1254974_1255181_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	72.7	1.1e-23
AZL42792.1|1255183_1255480_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	1.2e-36
AZL42793.1|1255476_1255833_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	63.2	2.6e-41
AZL42794.1|1255948_1256770_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
AZL46598.1|1256915_1258189_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
AZL42795.1|1258350_1258737_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
AZL42796.1|1258723_1259005_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.5	1.7e-19
AZL42797.1|1259004_1259631_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	75.4	6.4e-88
AZL42798.1|1259836_1260019_-	hypothetical protein	NA	NA	NA	NA	NA
AZL42799.1|1260230_1260422_+	hypothetical protein	NA	NA	NA	NA	NA
AZL42800.1|1260521_1261526_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	44.2	2.7e-35
AZL42801.1|1261503_1262808_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	1.8e-145
AZL42802.1|1262811_1264236_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.1	5.8e-193
AZL42803.1|1264219_1265332_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.0	1.3e-107
AZL42804.1|1265438_1266203_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	61.8	8.7e-79
AZL42805.1|1266290_1267427_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.3	1.3e-155
AZL42806.1|1267476_1267734_+	hypothetical protein	NA	NA	NA	NA	NA
AZL42807.1|1267737_1268148_+	protein singed	NA	A0A0H5AUF0	Pseudomonas_phage	39.7	6.0e-10
AZL42808.1|1268149_1268533_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	46.0	4.1e-21
AZL42809.1|1268534_1269086_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	40.5	2.0e-29
AZL42810.1|1269082_1269475_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AZL42811.1|1269498_1270671_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.0e-22
AZL42812.1|1270725_1271208_+	hypothetical protein	NA	NA	NA	NA	NA
AZL42813.1|1271345_1271552_+	hypothetical protein	NA	NA	NA	NA	NA
AZL42814.1|1271628_1271985_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
AZL42815.1|1272033_1272555_+	hypothetical protein	NA	NA	NA	NA	NA
AZL42816.1|1272666_1276266_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	29.7	1.8e-81
AZL42817.1|1276265_1276739_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.6	2.3e-61
AZL42818.1|1276725_1277208_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	96.9	1.3e-83
AZL42819.1|1277217_1277598_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
AZL42820.1|1277594_1280663_+	kinase	NA	A0A286S259	Klebsiella_phage	97.8	0.0e+00
AZL42821.1|1282857_1283652_+	hypothetical protein	NA	NA	NA	NA	NA
AZL42822.1|1283648_1283840_+	hypothetical protein	NA	A0A248XD24	Klebsiella_phage	89.1	7.5e-16
>prophage 2
CP034281	Klebsiella pneumoniae strain I72, complete genome	5430436	1475513	1573009	5430436	protease,portal,terminase,tail,plate,holin,head,capsid,tRNA	Escherichia_phage(20.0%)	97	NA	NA
AZL42988.1|1475513_1476863_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AZL42989.1|1476859_1477549_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AZL42990.1|1477548_1479225_+	OmpA family protein	NA	NA	NA	NA	NA
AZL42991.1|1479227_1479719_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AZL42992.1|1479949_1480114_+	hypothetical protein	NA	NA	NA	NA	NA
AZL42993.1|1480139_1482497_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AZL46604.1|1482506_1483049_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AZL42994.1|1483122_1483593_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AZL46605.1|1483935_1486338_+	hypothetical protein	NA	NA	NA	NA	NA
AZL42995.1|1486334_1486778_+	hypothetical protein	NA	NA	NA	NA	NA
AZL42996.1|1486935_1487319_+	DUF4087 domain-containing protein	NA	NA	NA	NA	NA
AZL42997.1|1487790_1488219_+	hypothetical protein	NA	NA	NA	NA	NA
AZL46606.1|1488435_1488735_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AZL42998.1|1488797_1489061_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	50.0	1.2e-06
AZL42999.1|1489063_1490272_+	hypothetical protein	NA	NA	NA	NA	NA
AZL46607.1|1490264_1493636_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
AZL43000.1|1494128_1495736_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AZL43001.1|1495769_1497539_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AZL43002.1|1497502_1498585_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AZL43003.1|1498620_1499145_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AZL43004.1|1499149_1501471_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	2.7e-14
AZL43005.1|1501467_1501971_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.0	1.5e-18
AZL43006.1|1501964_1502309_+	hypothetical protein	NA	NA	NA	NA	NA
AZL46608.1|1502341_1503079_+	hypothetical protein	NA	NA	NA	NA	NA
AZL46609.1|1503321_1503804_+	hypothetical protein	NA	NA	NA	NA	NA
AZL43007.1|1505687_1506572_+	glycine zipper family protein	NA	NA	NA	NA	NA
AZL43008.1|1506561_1507119_+	hypothetical protein	NA	NA	NA	NA	NA
AZL43009.1|1507626_1508025_+	hypothetical protein	NA	NA	NA	NA	NA
AZL43010.1|1508813_1509263_+	hypothetical protein	NA	NA	NA	NA	NA
AZL43011.1|1509259_1509793_+	hypothetical protein	NA	NA	NA	NA	NA
AZL43012.1|1510940_1512110_+	DUF4102 domain-containing protein	NA	A0A2R2Z2Y0	Escherichia_phage	86.1	1.9e-202
AZL43013.1|1512214_1513057_+	hypothetical protein	NA	NA	NA	NA	NA
AZL43014.1|1513158_1513359_-	DNA-binding protein	NA	G3CFG7	Escherichia_phage	60.0	1.8e-12
AZL43015.1|1514166_1514682_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.4	2.9e-70
AZL43016.1|1515057_1516134_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.4	2.8e-147
AZL43017.1|1516261_1517047_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	2.9e-61
AZL43018.1|1517046_1517346_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	48.6	1.1e-13
AZL43019.1|1517974_1518670_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	2.7e-87
AZL43020.1|1518767_1519010_+	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
AZL43021.1|1519044_1519506_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
AZL43022.1|1519743_1519923_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
AZL43023.1|1519912_1520866_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	69.0	6.1e-90
AZL43024.1|1520862_1521672_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	2.9e-109
AZL43025.1|1521681_1522059_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
AZL43026.1|1522071_1523052_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.5	7.6e-136
AZL43027.1|1523065_1523644_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
AZL43028.1|1523863_1524289_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	83.7	1.9e-59
AZL43029.1|1524285_1524441_+	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	68.8	2.5e-09
AZL43030.1|1524939_1525335_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
AZL43031.1|1525321_1525603_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
AZL43032.1|1525602_1526232_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	1.2e-105
AZL43033.1|1526239_1526515_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	66.3	1.9e-23
AZL46610.1|1526465_1526660_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	83.6	2.7e-21
AZL43034.1|1526716_1527376_-	hypothetical protein	NA	NA	NA	NA	NA
AZL43035.1|1527575_1527926_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	73.7	3.4e-46
AZL43036.1|1528084_1528582_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	2.5e-63
AZL43037.1|1528585_1530337_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.2	6.7e-252
AZL43038.1|1530484_1531711_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
AZL43039.1|1531703_1532303_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	83.0	1.0e-90
AZL43040.1|1532312_1533551_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
AZL43041.1|1533628_1533946_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	4.8e-23
AZL43042.1|1533954_1534293_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	67.9	3.3e-38
AZL43043.1|1534289_1534739_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
AZL43044.1|1534735_1535083_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
AZL43045.1|1535139_1535844_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.5	9.5e-80
AZL43046.1|1535874_1536279_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.2	1.9e-32
AZL43047.1|1536281_1536587_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
AZL43048.1|1536660_1536894_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
AZL43049.1|1536955_1540342_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.5	4.0e-301
AZL43050.1|1540363_1540837_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
AZL43051.1|1540823_1541300_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	64.6	5.3e-50
AZL43052.1|1541312_1541693_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	83.3	2.0e-60
AZL43053.1|1541689_1544767_+	kinase	NA	A0A286S259	Klebsiella_phage	62.2	0.0e+00
AZL43054.1|1547451_1548546_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.5	1.4e-178
AZL43055.1|1548580_1549681_-	acyltransferase	NA	C6ZR20	Salmonella_phage	27.2	1.8e-05
AZL46611.1|1549836_1550157_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	1.1e-22
AZL43056.1|1550367_1551297_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
AZL43057.1|1551586_1552348_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AZL43058.1|1552409_1553738_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AZL43059.1|1554105_1554390_+	DUF406 family protein	NA	NA	NA	NA	NA
AZL43060.1|1554549_1555860_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AZL43061.1|1555859_1558004_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AZL43062.1|1558213_1558699_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AZL43063.1|1558719_1559271_-	endonuclease SmrB	NA	NA	NA	NA	NA
AZL43064.1|1559438_1560371_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AZL43065.1|1560412_1561498_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
AZL43066.1|1561500_1562325_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AZL43067.1|1562324_1563134_+	hypothetical protein	NA	NA	NA	NA	NA
AZL43068.1|1563133_1563682_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AZL46612.1|1563713_1563995_+	YfcL family protein	NA	NA	NA	NA	NA
AZL43069.1|1564056_1566045_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AZL43070.1|1566203_1567424_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AZL43071.1|1567633_1568809_+	MFS transporter	NA	NA	NA	NA	NA
AZL43072.1|1568895_1569873_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AZL43073.1|1569983_1571120_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
AZL43074.1|1571183_1572197_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZL43075.1|1572196_1573009_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 3
CP034281	Klebsiella pneumoniae strain I72, complete genome	5430436	1771892	1778797	5430436		Planktothrix_phage(33.33%)	6	NA	NA
AZL43246.1|1771892_1772756_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AZL43247.1|1772766_1773540_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AZL46619.1|1773780_1774674_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AZL43248.1|1774919_1776281_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AZL43249.1|1776599_1777322_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AZL43250.1|1777318_1778797_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 4
CP034281	Klebsiella pneumoniae strain I72, complete genome	5430436	2745656	2756543	5430436		Escherichia_phage(87.5%)	9	NA	NA
AZL44138.1|2745656_2748764_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AZL44139.1|2748818_2750084_+	MFS transporter	NA	NA	NA	NA	NA
AZL44140.1|2750114_2751203_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	1.8e-210
AZL44141.1|2751289_2751550_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AZL46674.1|2751847_2752708_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
AZL44142.1|2752728_2753490_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AZL44143.1|2753750_2754653_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AZL44144.1|2754664_2755930_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
AZL44145.1|2755922_2756543_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
CP034281	Klebsiella pneumoniae strain I72, complete genome	5430436	3285782	3342650	5430436	protease,portal,terminase,tail,plate,head,capsid,integrase	Enterobacteria_phage(41.94%)	61	3283884:3283904	3318966:3318986
3283884:3283904	attL	AACCCGGAGTGCTCCGGGTTT	NA	NA	NA	NA
AZL44633.1|3285782_3286937_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	81.2	6.5e-179
AZL44634.1|3287090_3288272_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	68.3	3.7e-153
AZL44635.1|3288271_3288787_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	64.7	1.7e-57
AZL44636.1|3288841_3289141_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	75.0	2.2e-30
AZL46705.1|3289137_3289311_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	66.7	8.6e-11
AZL44637.1|3289294_3292222_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	45.5	2.8e-210
AZL44638.1|3292233_3292722_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.3	4.7e-54
AZL44639.1|3292850_3293993_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	47.6	1.7e-33
AZL44640.1|3294008_3294812_-	hypothetical protein	NA	NA	NA	NA	NA
AZL44641.1|3294808_3297088_-	hypothetical protein	NA	A0A2D1GNM3	Pseudomonas_phage	38.3	1.3e-13
AZL44642.1|3297089_3297692_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	45.4	6.1e-43
AZL44643.1|3297684_3298584_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	61.2	8.1e-92
AZL44644.1|3298570_3298936_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.3	3.9e-29
AZL44645.1|3298932_3299517_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	58.2	1.8e-60
AZL44646.1|3299516_3300158_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	50.0	9.6e-47
AZL44647.1|3300154_3300613_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	47.1	5.3e-31
AZL44648.1|3300609_3300909_-	peptidase	NA	NA	NA	NA	NA
AZL44649.1|3301149_3301701_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	8.3e-31
AZL44650.1|3301697_3301979_-	hypothetical protein	NA	B9A7B8	Serratia_phage	58.4	8.2e-19
AZL44651.1|3301969_3302170_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	64.6	1.1e-14
AZL44652.1|3302169_3302667_-|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	71.5	8.2e-62
AZL44653.1|3302769_3303690_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	76.5	5.2e-86
AZL44654.1|3303737_3304787_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.8	5.5e-108
AZL44655.1|3304811_3305645_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.2	9.4e-95
AZL44656.1|3305805_3307527_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	66.3	2.8e-226
AZL44657.1|3307526_3308573_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.1	7.6e-142
AZL44658.1|3309126_3309390_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	40.2	2.5e-09
AZL44659.1|3309475_3309850_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZL44660.1|3310680_3313287_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.7	5.4e-197
AZL46706.1|3313387_3313663_+	hypothetical protein	NA	NA	NA	NA	NA
AZL44661.1|3314146_3315115_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	50.8	2.7e-77
AZL44662.1|3315123_3315702_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	40.0	9.3e-33
AZL44663.1|3315698_3315923_-	hypothetical protein	NA	NA	NA	NA	NA
AZL44664.1|3315991_3316264_-	hypothetical protein	NA	NA	NA	NA	NA
AZL44665.1|3316279_3316666_-	hypothetical protein	NA	NA	NA	NA	NA
AZL46707.1|3316682_3316880_-	DUF4761 domain-containing protein	NA	NA	NA	NA	NA
AZL44666.1|3317071_3317404_-	hypothetical protein	NA	NA	NA	NA	NA
AZL44667.1|3317498_3317801_+	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	61.0	2.6e-26
AZL44668.1|3317888_3318896_+|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	52.5	6.9e-100
AZL44669.1|3318992_3320240_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
3318966:3318986	attR	AACCCGGAGTGCTCCGGGTTT	NA	NA	NA	NA
AZL44670.1|3320392_3320842_+	transcriptional regulator	NA	NA	NA	NA	NA
AZL44671.1|3320957_3321746_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZL44672.1|3321766_3321988_-	hypothetical protein	NA	NA	NA	NA	NA
AZL44673.1|3322244_3322367_+	hypothetical protein	NA	NA	NA	NA	NA
AZL44674.1|3322485_3323877_-	APC family permease	NA	NA	NA	NA	NA
AZL44675.1|3323866_3324058_-	hypothetical protein	NA	NA	NA	NA	NA
AZL44676.1|3324230_3325652_-	glutamine synthetase	NA	NA	NA	NA	NA
AZL44677.1|3325865_3326630_+	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
AZL44678.1|3326655_3327213_+	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
AZL46708.1|3327532_3329020_+	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
AZL44679.1|3329022_3330303_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AZL46709.1|3330299_3331241_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZL44680.1|3331344_3332430_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
AZL44681.1|3332885_3334493_+	BCCT family transporter	NA	NA	NA	NA	NA
AZL44682.1|3334529_3335654_+	ring-hydroxylating oxygenase subunit alpha	NA	NA	NA	NA	NA
AZL44683.1|3335672_3337121_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZL44684.1|3337178_3338144_+	oxidoreductase	NA	NA	NA	NA	NA
AZL44685.1|3338313_3338502_-	hypothetical protein	NA	NA	NA	NA	NA
AZL44686.1|3338473_3339712_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AZL44687.1|3340068_3341721_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
AZL44688.1|3341990_3342650_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 6
CP034281	Klebsiella pneumoniae strain I72, complete genome	5430436	3447162	3538033	5430436	protease,portal,tail,plate,lysis,head,capsid,integrase,tRNA	Salmonella_phage(63.16%)	91	3502762:3502780	3538108:3538126
AZL44764.1|3447162_3448455_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AZL44765.1|3448545_3449889_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AZL44766.1|3449897_3450509_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AZL44767.1|3450631_3454906_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AZL44768.1|3455041_3455536_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AZL44769.1|3456041_3457037_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
AZL44770.1|3457151_3458918_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	1.3e-21
AZL44771.1|3458918_3460640_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AZL44772.1|3460684_3461386_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZL44773.1|3461739_3461958_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZL44774.1|3462088_3464368_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AZL44775.1|3464398_3464716_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AZL44776.1|3465041_3465263_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AZL44777.1|3465339_3467280_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	41.0	5.0e-38
AZL44778.1|3467276_3468392_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AZL44779.1|3468538_3470197_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AZL44780.1|3470616_3471312_+	aquaporin Z	NA	NA	NA	NA	NA
AZL44781.1|3471427_3472327_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AZL44782.1|3472470_3474123_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AZL44783.1|3474133_3475102_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AZL44784.1|3475313_3475748_-	DoxX family protein	NA	NA	NA	NA	NA
AZL44785.1|3475899_3477618_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AZL44786.1|3477656_3478658_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AZL44787.1|3478668_3480111_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZL44788.1|3480198_3481212_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZL44789.1|3481208_3482039_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AZL44790.1|3482070_3483210_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AZL44791.1|3483262_3483442_+	hypothetical protein	NA	NA	NA	NA	NA
AZL44792.1|3484087_3484603_+	lipoprotein	NA	NA	NA	NA	NA
AZL44793.1|3484829_3485558_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AZL44794.1|3485578_3486310_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZL44795.1|3486316_3487033_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AZL44796.1|3487032_3487701_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AZL44797.1|3487884_3488616_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZL44798.1|3488702_3490175_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AZL44799.1|3490171_3490888_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AZL44800.1|3490966_3492094_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AZL44801.1|3492135_3492624_-	DUF2593 family protein	NA	NA	NA	NA	NA
AZL44802.1|3492681_3493527_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AZL44803.1|3493523_3494477_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AZL46713.1|3494487_3495621_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AZL44804.1|3495784_3496897_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AZL44805.1|3497245_3497725_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AZL44806.1|3497813_3498716_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AZL44807.1|3498830_3499553_-	nitroreductase NfsA	NA	NA	NA	NA	NA
AZL44808.1|3499536_3499824_-	DUF1418 family protein	NA	NA	NA	NA	NA
AZL44809.1|3500026_3500290_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AZL44810.1|3500296_3500680_-	hypothetical protein	NA	NA	NA	NA	NA
AZL44811.1|3500946_3502632_+	transporter	NA	NA	NA	NA	NA
3502762:3502780	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
AZL44812.1|3502852_3503071_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AZL44813.1|3503161_3504262_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	86.9	9.3e-175
AZL44814.1|3504258_3504744_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
AZL44815.1|3504740_3507818_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	61.7	0.0e+00
AZL44816.1|3507810_3507930_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AZL44817.1|3507944_3508247_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	2.0e-39
AZL44818.1|3508301_3508817_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
AZL44819.1|3508826_3509999_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	8.6e-203
AZL44820.1|3510132_3510609_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	50.5	1.4e-15
AZL44821.1|3512040_3512646_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	5.8e-110
AZL44822.1|3512638_3513547_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	5.9e-143
AZL44823.1|3513533_3513893_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
AZL44824.1|3513889_3514468_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	1.2e-93
AZL44825.1|3514536_3514983_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AZL44826.1|3514975_3515407_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	4.9e-71
AZL46714.1|3515369_3515615_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.3	4.1e-30
AZL44827.1|3515502_3515931_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	4.9e-47
AZL44828.1|3515927_3516305_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.0e-16
AZL46715.1|3516306_3516780_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AZL44829.1|3516799_3517015_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.4e-26
AZL44830.1|3517018_3517222_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	91.0	5.2e-31
AZL44831.1|3517221_3517686_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AZL44832.1|3517781_3518432_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AZL44833.1|3518435_3519494_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.7	9.9e-182
AZL44834.1|3519510_3520344_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AZL44835.1|3520486_3522253_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AZL44836.1|3522252_3523278_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	85.5	2.1e-168
AZL44837.1|3523313_3524243_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
AZL44838.1|3525571_3526249_-	hypothetical protein	NA	NA	NA	NA	NA
AZL44839.1|3526363_3526669_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AZL46716.1|3526607_3526796_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AZL44840.1|3528844_3531259_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
AZL44841.1|3531255_3532113_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	3.6e-158
AZL44842.1|3532109_3532337_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
AZL44843.1|3532336_3532570_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	93.5	7.8e-31
AZL44844.1|3532637_3532979_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	97.3	8.7e-55
AZL44845.1|3533096_3533393_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	84.6	1.0e-19
AZL44846.1|3533400_3533910_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AZL44847.1|3533942_3534164_-	regulator	NA	NA	NA	NA	NA
AZL44848.1|3534252_3535194_+	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	8.9e-33
AZL44849.1|3535234_3536284_+	hypothetical protein	NA	NA	NA	NA	NA
AZL44850.1|3536980_3538033_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.6	2.5e-108
3538108:3538126	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 7
CP034281	Klebsiella pneumoniae strain I72, complete genome	5430436	3988503	4045268	5430436	protease,terminase,lysis,head,coat,integrase,tRNA	Cronobacter_phage(18.97%)	79	3986647:3986692	4032515:4032560
3986647:3986692	attL	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AZL45246.1|3988503_3990801_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	51.8	6.8e-18
AZL45247.1|3990887_3993365_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.5	5.1e-197
AZL45248.1|3993351_3993747_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	56.3	3.3e-37
AZL45249.1|3993743_3994214_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.2e-27
AZL46736.1|3994213_3994633_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	8.2e-31
AZL45250.1|3995336_3995960_-	hypothetical protein	NA	NA	NA	NA	NA
AZL45251.1|3995982_3999261_-	hypothetical protein	NA	R9TMK1	Aeromonas_phage	50.4	9.5e-191
AZL45252.1|3999321_3999843_-	hypothetical protein	NA	NA	NA	NA	NA
AZL45253.1|3999917_4000130_-	hypothetical protein	NA	H6WRV2	Salmonella_phage	49.3	8.4e-08
AZL45254.1|4000188_4000662_-	DUF2335 domain-containing protein	NA	S5WJ01	Leptospira_phage	26.3	3.8e-08
AZL45255.1|4000630_4000828_-	hypothetical protein	NA	NA	NA	NA	NA
AZL45256.1|4000957_4001215_-	hypothetical protein	NA	A0A1V0E5Q1	Salmonella_phage	69.8	2.6e-19
AZL45257.1|4001217_4001973_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	52.2	2.8e-61
AZL45258.1|4002148_4002853_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.2	6.2e-63
AZL45259.1|4002920_4003685_-	hypothetical protein	NA	G0ZNE6	Cronobacter_phage	44.0	4.7e-40
AZL45260.1|4003743_4004127_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	48.8	3.2e-29
AZL45261.1|4004123_4004492_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	82.8	3.8e-48
AZL45262.1|4004494_4004857_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	3.3e-20
AZL45263.1|4004856_4005030_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	54.4	5.4e-13
AZL45264.1|4005029_4005410_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	3.5e-28
AZL45265.1|4005412_4005724_-	hypothetical protein	NA	NA	NA	NA	NA
AZL45266.1|4005756_4006812_-|coat	phage coat protein	coat	A0A1W6DYD5	Salmonella_phage	53.5	1.3e-101
AZL45267.1|4006808_4007270_-	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	3.8e-29
AZL45268.1|4007269_4008625_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	53.1	2.3e-130
AZL45269.1|4008697_4008994_-	hypothetical protein	NA	NA	NA	NA	NA
AZL45270.1|4009060_4010074_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	64.3	2.1e-104
AZL45271.1|4010000_4011470_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.3	2.4e-149
AZL45272.1|4011482_4012955_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.5	3.4e-249
AZL45273.1|4012954_4013470_-	hypothetical protein	NA	A0A0H5AUE2	Pseudomonas_phage	61.9	1.5e-50
AZL45274.1|4013527_4013911_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	95.3	2.3e-64
AZL46737.1|4013947_4014202_-	Rz1 lytic protein	NA	Q8SBD8	Shigella_phage	69.1	1.5e-22
AZL45275.1|4014089_4014479_-	DUF2570 domain-containing protein	NA	S5FKR3	Shigella_phage	50.0	2.0e-23
AZL45276.1|4014475_4015006_-	lysozyme	NA	G9L6J6	Escherichia_phage	79.1	3.5e-79
AZL45277.1|4015008_4015257_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AZL45278.1|4015847_4016537_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.0	5.5e-56
AZL45279.1|4016533_4016674_-	YlcG family protein	NA	NA	NA	NA	NA
AZL45280.1|4016670_4017306_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	72.8	1.1e-79
AZL45281.1|4017298_4017469_-	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
AZL45282.1|4017474_4018071_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	2.1e-56
AZL45283.1|4018176_4018434_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	64.0	4.4e-19
AZL45284.1|4018581_4019214_-	NYN domain-containing protein	NA	A0A0R6PGY5	Moraxella_phage	34.1	9.9e-20
AZL45285.1|4019455_4019824_-	hypothetical protein	NA	K7PH64	Enterobacterial_phage	37.9	8.3e-11
AZL45286.1|4019996_4020410_-	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	42.4	1.1e-08
AZL45287.1|4020406_4020811_-	hypothetical protein	NA	NA	NA	NA	NA
AZL45288.1|4020807_4021227_-	hypothetical protein	NA	T1SBJ7	Salmonella_phage	54.6	1.3e-20
AZL45289.1|4021223_4021448_-	hypothetical protein	NA	H9C169	Pectobacterium_phage	47.9	1.0e-11
AZL45290.1|4021444_4021747_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZL45291.1|4021743_4022481_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	54.9	7.6e-64
AZL45292.1|4022477_4023506_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	78.0	8.1e-64
AZL45293.1|4023502_4024300_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	72.8	3.5e-91
AZL45294.1|4024385_4024607_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AZL45295.1|4024656_4024872_-	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	60.9	5.5e-15
AZL45296.1|4024971_4025604_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.5	4.6e-33
AZL45297.1|4026039_4026246_+	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
AZL45298.1|4026326_4026611_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	1.5e-39
AZL45299.1|4026627_4027374_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	5.3e-65
AZL45300.1|4027370_4027862_+	hypothetical protein	NA	A0A162E9J4	Salmonella_phage	37.3	5.3e-21
AZL46738.1|4027839_4028463_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	1.5e-57
AZL45301.1|4028491_4029019_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	2.4e-56
AZL45302.1|4029015_4029786_+	dcm methylase	NA	D5LH17	Escherichia_phage	50.0	8.8e-63
AZL45303.1|4029782_4030004_+	hypothetical protein	NA	NA	NA	NA	NA
AZL45304.1|4030000_4030720_+	hypothetical protein	NA	R9VWB9	Serratia_phage	61.7	1.2e-74
AZL45305.1|4030716_4030908_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
AZL45306.1|4030904_4031123_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	50.7	2.2e-11
AZL45307.1|4031124_4031460_+	DNA-binding protein	NA	NA	NA	NA	NA
AZL45308.1|4031336_4032500_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	5.0e-203
AZL45309.1|4032930_4033797_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4032515:4032560	attR	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AZL45310.1|4033798_4034011_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AZL45311.1|4034056_4035442_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
AZL45312.1|4035617_4036112_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
AZL45313.1|4036115_4036838_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AZL45314.1|4036945_4037284_+	hypothetical protein	NA	NA	NA	NA	NA
AZL45315.1|4037380_4037890_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AZL45316.1|4037886_4038954_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AZL45317.1|4039065_4040142_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AZL45318.1|4040249_4041395_-	porin	NA	NA	NA	NA	NA
AZL45319.1|4041576_4043991_-	ABC transporter permease	NA	NA	NA	NA	NA
AZL45320.1|4043987_4044674_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.6e-31
AZL45321.1|4044641_4045268_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 8
CP034281	Klebsiella pneumoniae strain I72, complete genome	5430436	4779144	4789446	5430436		Liberibacter_phage(57.14%)	8	NA	NA
AZL45968.1|4779144_4782207_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	70.8	0.0e+00
AZL45969.1|4782206_4783409_-	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	44.4	7.5e-77
AZL45970.1|4783409_4784909_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	77.9	9.0e-205
AZL45971.1|4784905_4786405_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	77.4	2.0e-228
AZL45972.1|4786404_4786632_-	XRE family transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	43.2	2.3e-11
AZL45973.1|4788249_4788462_+	hypothetical protein	NA	NA	NA	NA	NA
AZL45974.1|4788654_4789071_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	81.9	4.2e-59
AZL46769.1|4789161_4789446_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	91.4	4.5e-41
>prophage 1
CP034282	Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence	193222	1101	52344	193222	transposase,integrase	Escherichia_phage(36.36%)	45	NA	NA
AZL46794.1|1101_1806_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZL46795.1|2034_2316_+	hypothetical protein	NA	NA	NA	NA	NA
AZL46796.1|2931_3267_-	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
AZL46797.1|3158_3386_-	protein SamB	NA	NA	NA	NA	NA
AZL46798.1|3425_4073_+	hypothetical protein	NA	NA	NA	NA	NA
AZL46799.1|4137_4512_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AZL46800.1|4535_5099_+	chlorite dismutase	NA	NA	NA	NA	NA
AZL46801.1|6500_7205_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZL46802.1|9949_10654_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZL46803.1|10972_12406_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AZL46804.1|12439_13648_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AZL46805.1|13660_13873_-	resolvase	NA	NA	NA	NA	NA
AZL46806.1|13914_14679_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AZL46807.1|14821_15088_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AZL46808.1|15308_15782_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AZL46809.1|15937_16951_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZL46957.1|16919_17204_+|transposase	transposase	transposase	NA	NA	NA	NA
AZL46810.1|17496_18201_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZL46811.1|19073_19718_-	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
AZL46812.1|22125_25023_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AZL46813.1|25117_25723_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
AZL46814.1|26499_26892_+	cysteine hydrolase	NA	NA	NA	NA	NA
AZL46815.1|27029_27914_+	EamA family transporter	NA	NA	NA	NA	NA
AZL46816.1|27945_29145_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AZL46817.1|29223_29901_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZL46958.1|29932_30175_-	relaxase	NA	NA	NA	NA	NA
AZL46818.1|31796_32501_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZL46959.1|32644_33199_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AZL46960.1|33329_34160_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AZL46819.1|34791_35496_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZL46820.1|35602_36463_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
AZL46821.1|36475_37018_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AZL46822.1|38211_38916_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZL46823.1|41237_41570_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AZL46824.1|41616_42492_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AZL46825.1|42747_44010_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AZL46826.1|44573_45131_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AZL46827.1|45313_46174_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AZL46828.1|46383_46923_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZL46829.1|46894_47731_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AZL46830.1|47730_48534_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AZL46831.1|48594_49410_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AZL46832.1|49739_49916_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AZL46833.1|50097_51102_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AZL46834.1|51375_52344_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.0e-173
