The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024707	Klebsiella pneumoniae strain cr-hvkp3 chromosome, complete genome	5370942	2911777	2922664	5370942		Escherichia_phage(87.5%)	9	NA	NA
AZL01451.1|2911777_2914885_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AZL01452.1|2914939_2916205_+	MFS transporter	NA	NA	NA	NA	NA
AZL01453.1|2916235_2917324_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AZL01454.1|2917410_2917671_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AZL01455.1|2917968_2918829_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AZL01456.1|2918849_2919611_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AZL01457.1|2919871_2920774_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.0	1.7e-158
AZL01458.1|2920785_2922051_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	99.5	1.7e-233
AZL01459.1|2922043_2922664_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 2
CP024707	Klebsiella pneumoniae strain cr-hvkp3 chromosome, complete genome	5370942	3551379	3560842	5370942	tRNA,protease	Brazilian_cedratvirus(16.67%)	9	NA	NA
AZL02035.1|3551379_3553101_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AZL02036.1|3553145_3553847_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZL02037.1|3554200_3554419_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZL02038.1|3554538_3556818_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AZL02039.1|3556848_3557166_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AZL02040.1|3557491_3557713_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AZL02041.1|3557646_3557850_-	hypothetical protein	NA	NA	NA	NA	NA
AZL02042.1|3557789_3559730_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	2.5e-37
AZL02043.1|3559726_3560842_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 3
CP024707	Klebsiella pneumoniae strain cr-hvkp3 chromosome, complete genome	5370942	4044171	4090751	5370942	tail,transposase,tRNA,head,integrase,coat	Salmonella_phage(26.53%)	66	4075566:4075580	4094661:4094675
AZL02462.1|4044171_4046355_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.7	1.3e-82
AZL02463.1|4046441_4048913_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	45.2	1.1e-202
AZL02464.1|4048899_4049295_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	52.8	2.3e-35
AZL02465.1|4049291_4049762_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	37.0	9.9e-25
AZL02466.1|4049761_4050181_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.8	1.8e-30
AZL02467.1|4050351_4050618_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
AZL02468.1|4050594_4050774_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AZL02469.1|4050818_4051061_-	hypothetical protein	NA	NA	NA	NA	NA
AZL02470.1|4051060_4054501_-	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	47.8	8.5e-166
AZL02471.1|4054595_4055099_-	hypothetical protein	NA	NA	NA	NA	NA
AZL03828.1|4055201_4055429_-	hypothetical protein	NA	NA	NA	NA	NA
AZL02472.1|4055652_4055841_+	hypothetical protein	NA	NA	NA	NA	NA
AZL03829.1|4055892_4056213_-	hypothetical protein	NA	NA	NA	NA	NA
AZL03830.1|4056220_4056559_-	hypothetical protein	NA	NA	NA	NA	NA
AZL02473.1|4056633_4056888_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
AZL02474.1|4056890_4057646_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.4	1.1e-60
AZL02475.1|4057821_4058499_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	58.4	9.7e-74
AZL02476.1|4058551_4059304_-	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
AZL02477.1|4059372_4059765_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	3.3e-34
AZL02478.1|4059761_4060187_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.2	2.5e-27
AZL02479.1|4060189_4060552_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	2.5e-20
AZL02480.1|4060551_4060725_-	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	50.0	3.9e-11
AZL02481.1|4060724_4061105_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
AZL02482.1|4061107_4061347_-	hypothetical protein	NA	NA	NA	NA	NA
AZL02483.1|4061379_4062435_-|coat	phage coat protein	coat	A0A1W6DYD5	Salmonella_phage	53.2	3.8e-101
AZL02484.1|4062431_4062893_-	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
AZL02485.1|4062892_4064248_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.6	2.8e-128
AZL02486.1|4064270_4064615_+	hypothetical protein	NA	NA	NA	NA	NA
AZL03831.1|4064615_4065617_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	5.2e-116
AZL02487.1|4065552_4067004_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	53.3	1.7e-123
AZL02488.1|4067016_4068489_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	85.7	4.6e-254
AZL02489.1|4068475_4068955_-	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	62.9	7.4e-52
AZL02490.1|4068986_4069622_-	hypothetical protein	NA	I6S676	Salmonella_phage	80.7	1.4e-101
AZL02491.1|4069747_4069966_+	hypothetical protein	NA	NA	NA	NA	NA
AZL02492.1|4070413_4070764_-	hypothetical protein	NA	H2EQH5	Salmonella_phage	38.9	1.3e-10
AZL02493.1|4070760_4071255_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	91.5	4.0e-85
AZL02494.1|4071257_4071572_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	4.9e-44
AZL02495.1|4072389_4073436_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
AZL02496.1|4073487_4074042_-	hypothetical protein	NA	NA	NA	NA	NA
AZL02497.1|4074498_4075026_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	58.8	1.7e-41
AZL02498.1|4075022_4075541_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	91.5	5.1e-91
AZL02499.1|4075540_4076047_-	Ead domain protein	NA	A0A2H4FRZ0	Salmonella_phage	58.7	6.0e-28
4075566:4075580	attL	GCGGCGGCCAGCGCT	NA	NA	NA	NA
AZL02500.1|4076039_4076303_-	DUF4752 domain-containing protein	NA	T1S9K2	Salmonella_phage	76.8	2.6e-30
AZL02501.1|4076299_4076824_-	hypothetical protein	NA	A0A193GYX5	Enterobacter_phage	74.4	1.7e-12
AZL02502.1|4076820_4077123_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZL02503.1|4077122_4077899_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	65.0	8.8e-95
AZL02504.1|4077895_4078624_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	7.8e-37
AZL02505.1|4078757_4078979_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AZL02506.1|4079018_4079252_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
AZL02507.1|4079356_4080046_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.3e-86
AZL03832.1|4080068_4080188_+	hypothetical protein	NA	NA	NA	NA	NA
AZL03833.1|4080351_4081776_+	AAA family ATPase	NA	NA	NA	NA	NA
AZL02508.1|4081852_4082056_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	68.7	1.0e-18
AZL02509.1|4082483_4082690_+	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
AZL02510.1|4082770_4083055_+	hypothetical protein	NA	G8C7T1	Escherichia_phage	77.7	5.6e-39
AZL02511.1|4083066_4083570_+	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	29.5	6.0e-12
AZL02512.1|4083566_4084190_+	YqaJ-like viral recombinase	NA	S0A2A9	Cellulophaga_phage	49.0	3.5e-46
AZL02513.1|4084186_4084345_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	2.3e-10
AZL02514.1|4084341_4085466_+	site-specific DNA-methyltransferase	NA	A0A1P8DTZ3	Salmonella_phage	48.1	3.0e-88
AZL02515.1|4085462_4085684_+	hypothetical protein	NA	NA	NA	NA	NA
AZL02516.1|4085680_4086217_+	hypothetical protein	NA	J9Q748	Salmonella_phage	74.9	9.4e-72
AZL02517.1|4086213_4086432_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
AZL02518.1|4086645_4087809_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	5.0e-203
AZL02519.1|4088239_4089106_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AZL02520.1|4089107_4089320_+	ribosome-associated protein	NA	NA	NA	NA	NA
AZL02521.1|4089365_4090751_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
4094661:4094675	attR	GCGGCGGCCAGCGCT	NA	NA	NA	NA
>prophage 1
CP024708	Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence	237216	97703	162546	237216	integrase,transposase	Salmonella_phage(20.0%)	58	97672:97731	159951:161006
97672:97731	attL	GGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGCATCCTCCCG	NA	NA	NA	NA
AZL03984.1|97703_98672_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.2e-172
AZL03985.1|99453_99939_+	hypothetical protein	NA	NA	NA	NA	NA
AZL03986.1|101397_101898_-	transcriptional repressor	NA	NA	NA	NA	NA
AZL03987.1|102042_102444_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
AZL03988.1|102480_103701_+	GTP-binding protein	NA	NA	NA	NA	NA
AZL03989.1|103761_103968_-	hypothetical protein	NA	NA	NA	NA	NA
AZL03990.1|103970_105620_-	ferrous iron transporter B	NA	NA	NA	NA	NA
AZL03991.1|105631_106762_-	thioredoxin reductase	NA	NA	NA	NA	NA
AZL03992.1|108293_108746_-	transcriptional repressor	NA	NA	NA	NA	NA
AZL03993.1|108843_110043_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AZL03994.1|110113_110536_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AZL03995.1|110599_111535_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
AZL03996.1|111524_112085_+	carbonate dehydratase	NA	NA	NA	NA	NA
AZL03997.1|112151_113081_+	isocitrate dehydrogenase	NA	A0A140B3P3	Vibrio_phage	25.2	1.5e-11
AZL03998.1|113097_113922_-	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
AZL03999.1|114372_115374_+	hypothetical protein	NA	A0A2K9L6B6	Tupanvirus	41.5	9.7e-54
AZL04000.1|115366_116218_+	hypothetical protein	NA	NA	NA	NA	NA
AZL04001.1|116214_117561_+	dihydroorotase	NA	NA	NA	NA	NA
AZL04002.1|117624_118647_+	porphobilinogen synthase	NA	NA	NA	NA	NA
AZL04003.1|120860_121343_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZL04004.1|121330_121597_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AZL04005.1|121791_122022_-	hypothetical protein	NA	NA	NA	NA	NA
AZL04006.1|122035_122239_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AZL04007.1|122299_122794_-	DNA-binding protein	NA	NA	NA	NA	NA
AZL04008.1|122835_125805_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.3	0.0e+00
AZL04009.1|125807_126365_-|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
AZL04010.1|126494_127571_-	signal peptidase II	NA	NA	NA	NA	NA
AZL04011.1|127567_129973_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
AZL04012.1|130058_130493_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AZL04013.1|130788_132189_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AZL04014.1|132185_132866_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AZL04015.1|132920_133850_-	copper resistance protein CopD	NA	NA	NA	NA	NA
AZL04016.1|133854_134235_-	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AZL04017.1|134274_135171_-	copper resistance protein B	NA	NA	NA	NA	NA
AZL04018.1|135170_136988_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AZL04019.1|137221_137671_+	copper resistance protein	NA	NA	NA	NA	NA
AZL04020.1|137959_138697_+	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AZL04021.1|138730_138928_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AZL04022.1|138968_141416_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AZL04023.1|141542_141983_-	hypothetical protein	NA	NA	NA	NA	NA
AZL04024.1|142069_145216_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AZL04025.1|145226_146519_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZL04026.1|146632_146995_-	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZL04027.1|147023_148409_-	hypothetical protein	NA	NA	NA	NA	NA
AZL04028.1|148598_149279_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.7	1.3e-30
AZL04029.1|149271_150747_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AZL04030.1|150997_151429_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AZL04031.1|151572_151923_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	3.2e-20
AZL04108.1|152309_153218_-	HNH endonuclease	NA	NA	NA	NA	NA
AZL04032.1|153854_154829_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
AZL04109.1|155761_156574_+	hypothetical protein	NA	NA	NA	NA	NA
AZL04033.1|156570_157350_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
AZL04110.1|157494_158424_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
AZL04034.1|158736_158895_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
AZL04035.1|159009_159978_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.2e-172
AZL04036.1|159997_160678_+	amidase	NA	NA	NA	NA	NA
AZL04111.1|160870_161716_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	26.0	1.9e-10
159951:161006	attR	CGGGAGGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCGCTCCCATATTGACACCGTTGTAAACGCCGGCGCTTTCGATGGTTGTTACGGTGTCCTGTCCGGCCTGGCTGTCGTCAGGGCTTTCAGAAAAGCCGGGATCAAACCTTCCCGCCCGATTACTGTCGGCGCATTCACAAACGAAGAGGGTATCCGTTATCAACCCGATATGATGGGATCGCTCGTCTATGCAGGGGGGATCTCGCTGAAGAAAATCCTGGACACTGTCGGCACTGATGGCACACGTCTGGGTGATGAGCTGCAGCGTATTGGCTATGCGGGAGACCTGGAGCCCGGCTCGATCGTCCCTCATGAATACATTGAACTGCACATCGAACAGGGACCTGTTCTTGAAGCCGAAGGGATCCAGATCGGTGCTGTCGAAAATCTTCAGGGAATTTCCTGGCAGGAAATCACCATCAAAGGCACGGCAAACCATGCAGGCACCACGCCGACACGGCTACCCGTTCTTACGATCCGGCAGTCTAGGAAATGCTTGAAAAACGGATGCGTGTTATCTGTAATTCTGTTTGCGCAATGCACGAAGCAGAATGTGAATTCATTTACACACATGAGTTTTCACCTACAGTCGATCATCCGCGGGAAACTGCATATGCAATTGACGCAGCGGTTCGCGTATTCGGCGAAAAAAATGTGGATTCCACGGTGACGTGTTCATACTCAAATCTCCTGCAATATGGGAGATTTGAGTATGGTTGTACCTTGTGAGCGAACAGCGGGAATTCGCAAATGTTTCACATCTGATCAAGGCATTACTTAAAGGATGCTGTGGTAGCCAACGGGGAGCAGGTCAAAGCAATTACAAATTGGTTTGAATTGCAACATCATGCAAATAAATGTTATGTTATCACATTACTTAAGTGGCATATACAGTGACATGAACAACAATCTTCCTTATCCAATACCTGTGCTTGATGTTAAAAGCGTCAGCATTTCTACGGGCCATTCTGCTCTGGTTAGCGATGTCAGCTTTCGGC	NA	NA	NA	NA
AZL04037.1|161712_162546_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	1.1e-10
