The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034249	Klebsiella pneumoniae strain KP18-29 chromosome, complete genome	5360130	445790	515168	5360130	integrase,tail,portal,protease,capsid,terminase,head,tRNA	uncultured_Caudovirales_phage(61.11%)	74	463398:463415	479393:479410
AZK53860.1|445790_446738_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AZK53861.1|446752_447262_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AZK53862.1|447390_448515_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AZK53863.1|448486_448960_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AZK53864.1|448985_449528_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53865.1|449532_450105_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AZK53866.1|450108_450927_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AZK53867.1|450923_451181_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AZK53868.1|451156_451711_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AZK53869.1|457506_457728_-	hypothetical protein	NA	NA	NA	NA	NA
AZK53870.1|458021_461132_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AZK53871.1|461144_462284_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZK53872.1|462662_463313_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
463398:463415	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AZK53873.1|463588_464815_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AZK53874.1|464907_465849_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53875.1|466030_466315_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AZK53876.1|466325_467105_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	8.1e-40
AZK58335.1|467228_467423_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AZK58334.1|467556_467826_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
AZK53877.1|467818_468007_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53878.1|467999_468314_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53879.1|468310_468679_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AZK53880.1|468675_469041_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53881.1|469040_471176_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AZK53882.1|471518_471854_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53883.1|471902_472415_-	hypothetical protein	NA	NA	NA	NA	NA
AZK53884.1|472678_473845_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AZK53885.1|473896_474457_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AZK53886.1|474458_475700_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AZK53887.1|475696_476032_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AZK53888.1|476028_476328_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AZK53889.1|476327_476771_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AZK53890.1|476897_477089_+|terminase	terminase	terminase	NA	NA	NA	NA
AZK53891.1|477046_477403_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AZK53892.1|477386_479048_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AZK53893.1|479050_479242_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53894.1|479395_479692_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
479393:479410	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AZK53895.1|479716_480682_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AZK53896.1|480839_481067_-	hypothetical protein	NA	NA	NA	NA	NA
AZK53897.1|481039_481921_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AZK58336.1|481932_483384_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
AZK53898.1|483373_483616_-	DUF997 family protein	NA	NA	NA	NA	NA
AZK53899.1|483726_485076_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AZK53900.1|485086_485554_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AZK53901.1|485576_486029_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AZK53902.1|486252_486861_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AZK53903.1|486860_487862_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AZK53904.1|488090_488282_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53905.1|488361_490302_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AZK53906.1|490607_491651_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AZK53907.1|491721_492714_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AZK53908.1|492713_493202_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AZK53909.1|493209_493791_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AZK53910.1|493793_495263_+	ribonuclease G	NA	NA	NA	NA	NA
AZK53911.1|495300_499098_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AZK53912.1|499186_500632_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AZK53913.1|500667_501597_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AZK53914.1|501728_501932_+	protein AaeX	NA	NA	NA	NA	NA
AZK53915.1|501939_502872_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AZK53916.1|502877_504845_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AZK53917.1|504924_505200_+	hypothetical protein	NA	NA	NA	NA	NA
AZK53918.1|505250_505517_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZK53919.1|505615_505879_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZK53920.1|506254_506725_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
AZK53921.1|507139_508078_+	malate dehydrogenase	NA	NA	NA	NA	NA
AZK53922.1|508214_509273_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AZK53923.1|509360_510728_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AZK53924.1|510901_511300_-	DUF1043 family protein	NA	NA	NA	NA	NA
AZK53925.1|511490_512618_+	cell division protein ZapE	NA	NA	NA	NA	NA
AZK53926.1|512883_513312_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AZK53927.1|513327_513720_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AZK53928.1|513829_514033_-	hypothetical protein	NA	NA	NA	NA	NA
AZK53929.1|514031_514670_+	stringent starvation protein A	NA	NA	NA	NA	NA
AZK53930.1|514673_515168_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
CP034249	Klebsiella pneumoniae strain KP18-29 chromosome, complete genome	5360130	1255886	1335013	5360130	lysis,transposase,integrase,tail,portal,capsid,plate,coat,head,tRNA	Salmonella_phage(72.92%)	85	1254180:1254226	1293963:1294009
1254180:1254226	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AZK54624.1|1255886_1256912_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
AZK54625.1|1256914_1257544_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
AZK54626.1|1257666_1257909_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
AZK54627.1|1257941_1258451_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AZK54628.1|1258458_1258659_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
AZK54629.1|1258622_1258961_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AZK54630.1|1259028_1259262_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
AZK54631.1|1259261_1259489_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
AZK54632.1|1259485_1260337_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
AZK54633.1|1260333_1262718_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
AZK54634.1|1262947_1263199_+	hypothetical protein	NA	NA	NA	NA	NA
AZK54635.1|1263198_1264683_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AZK54636.1|1264790_1264979_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
AZK54637.1|1264990_1265224_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
AZK54638.1|1265319_1266003_-	hypothetical protein	NA	NA	NA	NA	NA
AZK54639.1|1265989_1267069_-	hypothetical protein	NA	NA	NA	NA	NA
AZK54640.1|1267068_1268070_-	hypothetical protein	NA	NA	NA	NA	NA
AZK54641.1|1268591_1268861_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
AZK54642.1|1268917_1269961_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
AZK54643.1|1269960_1271724_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
AZK54644.1|1272126_1273318_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
AZK54645.1|1274020_1275073_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
AZK54646.1|1275076_1275730_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
AZK54647.1|1275825_1276290_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
AZK54648.1|1276289_1276493_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	88.1	2.8e-29
AZK58372.1|1276496_1276712_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
AZK54649.1|1276692_1277202_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
AZK54650.1|1277206_1277590_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
AZK54651.1|1277586_1278015_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
AZK54652.1|1277944_1278148_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
AZK54653.1|1278110_1278533_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
AZK54654.1|1278525_1278972_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
AZK54655.1|1278994_1279861_-	hypothetical protein	NA	NA	NA	NA	NA
AZK54656.1|1279955_1280528_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
AZK54657.1|1280524_1280887_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
AZK54658.1|1280873_1281782_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
AZK54659.1|1281774_1282446_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
AZK54660.1|1282447_1284397_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
AZK54661.1|1284406_1285525_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
AZK54662.1|1285576_1286650_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
AZK54663.1|1286798_1287971_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
AZK54664.1|1287980_1288496_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AZK54665.1|1288548_1288848_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
AZK54666.1|1288862_1288982_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AZK54667.1|1288974_1291605_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
AZK54668.1|1291601_1292087_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
AZK54669.1|1292083_1293178_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
AZK54670.1|1293244_1293463_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AZK54671.1|1293490_1293868_-	hypothetical protein	NA	NA	NA	NA	NA
AZK54672.1|1294471_1294954_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1293963:1294009	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AZK54673.1|1295064_1295541_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AZK54674.1|1295530_1295821_+	RnfH family protein	NA	NA	NA	NA	NA
AZK54675.1|1295887_1296229_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AZK54676.1|1296376_1298038_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AZK54677.1|1298124_1299003_-	NAD(+) kinase	NA	NA	NA	NA	NA
AZK54678.1|1299127_1299718_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AZK54679.1|1299837_1301124_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AZK54680.1|1301143_1301935_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AZK54681.1|1302098_1303463_+	signal recognition particle protein	NA	NA	NA	NA	NA
AZK54682.1|1303722_1303971_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AZK58373.1|1303989_1304538_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AZK54683.1|1304569_1305337_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AZK54684.1|1305376_1305724_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZK54685.1|1305843_1306302_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AZK54686.1|1306358_1307729_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AZK54687.1|1307737_1308220_-	OmpA family protein	NA	NA	NA	NA	NA
AZK54688.1|1308233_1309457_-	diguanylate cyclase	NA	NA	NA	NA	NA
AZK54689.1|1309449_1309959_-	YfiR family protein	NA	NA	NA	NA	NA
AZK54690.1|1310301_1311372_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
AZK54691.1|1311381_1312503_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AZK54692.1|1312565_1313438_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AZK54693.1|1313434_1314595_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AZK58374.1|1314695_1314743_-	hypothetical protein	NA	NA	NA	NA	NA
AZK54694.1|1314849_1315185_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AZK54695.1|1315455_1316193_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AZK54696.1|1316324_1317305_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AZK54697.1|1317301_1318033_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AZK54698.1|1318162_1320736_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
AZK54699.1|1326701_1328000_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
AZK54700.1|1328003_1328327_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
AZK58375.1|1328368_1329724_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AZK54701.1|1329844_1332496_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AZK54702.1|1332530_1333229_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AZK54703.1|1333298_1333724_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AZK54704.1|1333927_1335013_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
CP034249	Klebsiella pneumoniae strain KP18-29 chromosome, complete genome	5360130	1743855	1750758	5360130		Planktothrix_phage(33.33%)	6	NA	NA
AZK55061.1|1743855_1744719_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AZK55062.1|1744729_1745503_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AZK58388.1|1745743_1746637_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	4.6e-15
AZK55063.1|1746880_1748242_-	U32 family peptidase	NA	Q6DW11	Phage_TP	95.1	6.1e-208
AZK55064.1|1748560_1749283_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AZK55065.1|1749279_1750758_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 4
CP034249	Klebsiella pneumoniae strain KP18-29 chromosome, complete genome	5360130	2732933	2743820	5360130		Escherichia_phage(87.5%)	9	NA	NA
AZK55949.1|2732933_2736041_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AZK55950.1|2736095_2737361_+	MFS transporter	NA	NA	NA	NA	NA
AZK55951.1|2737391_2738480_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AZK55952.1|2738566_2738827_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AZK55953.1|2739124_2739985_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AZK55954.1|2740005_2740767_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AZK55955.1|2741027_2741930_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
AZK55956.1|2741941_2743207_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
AZK55957.1|2743199_2743820_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
CP034249	Klebsiella pneumoniae strain KP18-29 chromosome, complete genome	5360130	3002343	3069081	5360130	transposase,integrase,tail,holin,terminase	Enterobacteria_phage(20.0%)	84	3002125:3002140	3066387:3066402
3002125:3002140	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
AZK56185.1|3002343_3003015_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
AZK58455.1|3003201_3004029_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
AZK56186.1|3004104_3005370_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
AZK56187.1|3005371_3005791_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
AZK56188.1|3005870_3007355_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AZK56189.1|3007354_3007606_-	hypothetical protein	NA	NA	NA	NA	NA
AZK56190.1|3007780_3009265_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AZK56191.1|3009264_3009516_-	hypothetical protein	NA	NA	NA	NA	NA
AZK56192.1|3010162_3010585_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AZK56193.1|3011177_3011882_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZK56194.1|3012058_3012823_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AZK56195.1|3012910_3013024_+	NTP-binding protein	NA	NA	NA	NA	NA
AZK56196.1|3013329_3013830_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZK56197.1|3013848_3014028_+	hypothetical protein	NA	NA	NA	NA	NA
AZK56198.1|3013957_3014797_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AZK56199.1|3014790_3015138_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AZK58456.1|3015301_3016093_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AZK56200.1|3016238_3017198_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
AZK56201.1|3017088_3017793_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
AZK56202.1|3018041_3019985_+	flagellar biosynthesis protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
AZK56203.1|3020226_3020826_+	hypothetical protein	NA	NA	NA	NA	NA
AZK56204.1|3020859_3021054_-	hypothetical protein	NA	NA	NA	NA	NA
AZK56205.1|3021050_3021782_-	hypothetical protein	NA	NA	NA	NA	NA
AZK56206.1|3021785_3024740_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
AZK56207.1|3024816_3027885_-	kinase	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
AZK56208.1|3027881_3028262_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
AZK56209.1|3028271_3028754_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
AZK56210.1|3028934_3029399_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
AZK56211.1|3029713_3030049_-	hypothetical protein	NA	NA	NA	NA	NA
AZK56212.1|3030132_3033030_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
AZK58457.1|3033291_3033483_-	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
AZK56213.1|3033707_3034064_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
AZK56214.1|3034140_3034347_-	hypothetical protein	NA	NA	NA	NA	NA
AZK56215.1|3034484_3034967_-	hypothetical protein	NA	NA	NA	NA	NA
AZK56216.1|3035020_3036193_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
AZK56217.1|3036216_3036609_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AZK56218.1|3036605_3037157_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
AZK56219.1|3037158_3037542_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
AZK56220.1|3037528_3037762_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
AZK56221.1|3037771_3038026_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
AZK56222.1|3038027_3038423_-	protein singed	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
AZK56223.1|3038744_3039698_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
AZK56224.1|3039708_3040494_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
AZK56225.1|3041024_3042137_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
AZK56226.1|3042120_3043521_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
AZK56227.1|3043520_3044828_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
AZK56228.1|3044805_3045810_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
AZK56229.1|3046358_3046544_-	hypothetical protein	NA	NA	NA	NA	NA
AZK56230.1|3046672_3046918_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
AZK56231.1|3047731_3047926_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
AZK56232.1|3047876_3048152_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
AZK56233.1|3048148_3048493_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
AZK56234.1|3048489_3049029_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
AZK58458.1|3049025_3049325_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
AZK56235.1|3049803_3050850_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
AZK58459.1|3051075_3051765_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
AZK56236.1|3051764_3051905_-	YlcG family protein	NA	NA	NA	NA	NA
AZK56237.1|3051901_3052540_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
AZK56238.1|3052532_3053201_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
AZK56239.1|3053197_3053365_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
AZK56240.1|3053345_3053813_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
AZK56241.1|3054333_3055362_+	hypothetical protein	NA	NA	NA	NA	NA
AZK56242.1|3055569_3055815_-	hypothetical protein	NA	NA	NA	NA	NA
AZK56243.1|3055870_3056173_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZK56244.1|3056169_3057018_-	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
AZK56245.1|3057014_3057875_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
AZK56246.1|3057960_3058182_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AZK56247.1|3058222_3058450_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
AZK58460.1|3058561_3059260_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
AZK56248.1|3059282_3059402_+	hypothetical protein	NA	NA	NA	NA	NA
AZK56249.1|3059547_3060624_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
AZK56250.1|3060705_3060909_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
AZK56251.1|3061337_3061532_+	hypothetical protein	NA	NA	NA	NA	NA
AZK56252.1|3061620_3061905_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
AZK56253.1|3061920_3062766_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
AZK56254.1|3062762_3063050_+	hypothetical protein	NA	NA	NA	NA	NA
AZK56255.1|3063051_3063732_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
AZK56256.1|3063728_3064157_+	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
AZK56257.1|3064153_3064816_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
AZK56258.1|3064812_3065127_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AZK56259.1|3065023_3066211_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
AZK56260.1|3066387_3067278_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3066387:3066402	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
AZK56261.1|3067277_3068270_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AZK56262.1|3068271_3069081_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 6
CP034249	Klebsiella pneumoniae strain KP18-29 chromosome, complete genome	5360130	3445575	3531323	5360130	lysis,integrase,tail,portal,protease,capsid,plate,head,tRNA	Salmonella_phage(50.0%)	86	3501099:3501117	3531398:3531416
AZK56606.1|3445575_3446868_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AZK56607.1|3446958_3448302_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AZK56608.1|3448310_3448922_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AZK56609.1|3449044_3453298_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AZK56610.1|3453433_3453928_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AZK56611.1|3454433_3455429_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
AZK56612.1|3455543_3457310_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AZK56613.1|3457310_3459032_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AZK56614.1|3459076_3459778_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZK56615.1|3460131_3460350_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZK56616.1|3460470_3462750_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AZK56617.1|3462780_3463098_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AZK56618.1|3463423_3463645_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AZK56619.1|3463721_3465662_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AZK56620.1|3465658_3466774_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AZK56621.1|3466920_3468579_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AZK56622.1|3468998_3469694_+	aquaporin Z	NA	NA	NA	NA	NA
AZK56623.1|3469809_3470709_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AZK56624.1|3470852_3472505_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AZK56625.1|3472515_3473484_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AZK56626.1|3473434_3473638_+	hypothetical protein	NA	NA	NA	NA	NA
AZK56627.1|3473695_3474130_-	DoxX family protein	NA	NA	NA	NA	NA
AZK56628.1|3474281_3476000_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AZK56629.1|3476038_3477040_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AZK56630.1|3477050_3478493_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZK56631.1|3478580_3479594_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZK56632.1|3479590_3480421_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AZK56633.1|3480452_3481592_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AZK56634.1|3481644_3481824_+	hypothetical protein	NA	NA	NA	NA	NA
AZK56635.1|3482469_3482985_+	lipoprotein	NA	NA	NA	NA	NA
AZK56636.1|3483211_3483940_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AZK56637.1|3483960_3484692_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZK56638.1|3484698_3485415_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AZK56639.1|3485414_3486083_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AZK56640.1|3486266_3486998_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZK56641.1|3487040_3488513_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AZK56642.1|3488509_3489226_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AZK56643.1|3489304_3490432_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AZK56644.1|3490473_3490962_-	DUF2593 family protein	NA	NA	NA	NA	NA
AZK56645.1|3491019_3491865_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AZK56646.1|3491861_3492815_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AZK58479.1|3492825_3493959_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AZK56647.1|3494122_3495184_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AZK56648.1|3495581_3496061_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AZK56649.1|3496149_3497052_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AZK56650.1|3497873_3498161_-	DUF1418 family protein	NA	NA	NA	NA	NA
AZK56651.1|3498363_3498627_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AZK56652.1|3498633_3499017_-	hypothetical protein	NA	NA	NA	NA	NA
AZK56653.1|3499283_3500969_+	transporter	NA	NA	NA	NA	NA
3501099:3501117	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
AZK56654.1|3501188_3501407_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AZK56655.1|3501498_3502599_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AZK56656.1|3502595_3503081_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AZK56657.1|3503077_3505705_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AZK56658.1|3505697_3505817_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AZK56659.1|3505831_3506131_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
AZK56660.1|3506183_3506699_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AZK56661.1|3506708_3507881_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AZK56662.1|3508019_3509096_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AZK56663.1|3509125_3509329_-	hypothetical protein	NA	NA	NA	NA	NA
AZK56664.1|3509325_3510057_-	hypothetical protein	NA	NA	NA	NA	NA
AZK56665.1|3510060_3513012_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AZK56666.1|3513013_3513613_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AZK56667.1|3513605_3514514_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AZK56668.1|3514500_3514863_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
AZK56669.1|3514859_3515432_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AZK56670.1|3515526_3516219_+	hypothetical protein	NA	NA	NA	NA	NA
AZK56671.1|3516215_3516662_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AZK56672.1|3516654_3517086_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AZK56673.1|3517181_3517610_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AZK56674.1|3517606_3517990_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AZK56675.1|3517994_3518504_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AZK56676.1|3518484_3518700_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
AZK56677.1|3518703_3518907_-|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AZK56678.1|3518906_3519371_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AZK56679.1|3519466_3520117_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AZK56680.1|3520120_3521179_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AZK56681.1|3521195_3522029_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AZK56682.1|3522171_3523938_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AZK56683.1|3523937_3524963_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AZK56684.1|3525024_3526767_-	hypothetical protein	NA	NA	NA	NA	NA
AZK56685.1|3527042_3527720_-	hypothetical protein	NA	NA	NA	NA	NA
AZK56686.1|3527834_3528140_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AZK58480.1|3528078_3528267_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AZK56687.1|3528367_3529852_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AZK56688.1|3529851_3530103_-	hypothetical protein	NA	NA	NA	NA	NA
AZK56689.1|3530270_3531323_+|integrase	site-specific integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3531398:3531416	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 7
CP034249	Klebsiella pneumoniae strain KP18-29 chromosome, complete genome	5360130	3979650	4024925	5360130	lysis,integrase,coat,terminase,head,tRNA	Escherichia_phage(26.42%)	64	3970953:3970999	4021997:4022043
3970953:3970999	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AZK57073.1|3979650_3982128_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
AZK57074.1|3982114_3982510_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
AZK57075.1|3982506_3982977_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
AZK58502.1|3982976_3983396_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
AZK57076.1|3983495_3986942_-	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
AZK57077.1|3987034_3987538_-	hypothetical protein	NA	NA	NA	NA	NA
AZK57078.1|3987665_3988451_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
AZK57079.1|3988516_3989230_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
AZK57080.1|3989219_3989390_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
AZK57081.1|3989489_3989849_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
AZK58503.1|3989865_3990336_-	hypothetical protein	NA	NA	NA	NA	NA
AZK57082.1|3990629_3990884_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
AZK57083.1|3990886_3991642_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
AZK57084.1|3991817_3992495_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
AZK57085.1|3992547_3993300_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	41.7	1.7e-42
AZK57086.1|3993368_3993761_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
AZK57087.1|3993757_3994183_-	HK97 gp10 family phage protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
AZK57088.1|3994185_3994548_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
AZK57089.1|3994547_3994721_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
AZK57090.1|3994720_3995101_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
AZK57091.1|3995103_3995343_-	hypothetical protein	NA	NA	NA	NA	NA
AZK57092.1|3995353_3996448_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	62.8	1.7e-123
AZK57093.1|3996459_3996888_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
AZK57094.1|3996891_3998277_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
AZK57095.1|3998349_3998826_-	hypothetical protein	NA	NA	NA	NA	NA
AZK57096.1|3998867_3999872_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
AZK57097.1|3999846_4001268_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
AZK57098.1|4001280_4002753_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
AZK57099.1|4002752_4003355_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
AZK57100.1|4003725_4004055_+	hypothetical protein	NA	NA	NA	NA	NA
AZK57101.1|4004160_4004625_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
AZK57102.1|4004621_4005152_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
AZK57103.1|4005154_4005403_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AZK57104.1|4006312_4007002_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
AZK57105.1|4006998_4007529_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
AZK57106.1|4007521_4007659_-	YlcG family protein	NA	NA	NA	NA	NA
AZK57107.1|4007655_4008291_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
AZK57108.1|4008283_4008454_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
AZK57109.1|4008453_4008909_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
AZK58504.1|4009161_4009410_-	hypothetical protein	NA	NA	NA	NA	NA
AZK57110.1|4009409_4010057_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
AZK57111.1|4010229_4011072_-	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
AZK57112.1|4011178_4011685_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
AZK57113.1|4011681_4011975_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
AZK57114.1|4011974_4013405_-	helicase DnaB	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
AZK57115.1|4013394_4014294_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
AZK57116.1|4014518_4014740_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AZK57117.1|4014780_4015014_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
AZK57118.1|4015141_4015831_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
AZK57119.1|4016181_4016397_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
AZK57120.1|4016496_4016691_+	hypothetical protein	NA	NA	NA	NA	NA
AZK57121.1|4016779_4017064_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
AZK57122.1|4017079_4017925_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
AZK57123.1|4017921_4018602_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
AZK57124.1|4018598_4018757_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
AZK57125.1|4018753_4019410_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
AZK57126.1|4019406_4020174_+	dcm methylase	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
AZK57127.1|4020170_4020389_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
AZK57128.1|4020390_4020606_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
AZK57129.1|4020607_4020943_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZK58505.1|4020939_4021983_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.2	2.5e-177
AZK57130.1|4022413_4023280_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4021997:4022043	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AZK57131.1|4023281_4023494_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AZK57132.1|4023539_4024925_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 8
CP034249	Klebsiella pneumoniae strain KP18-29 chromosome, complete genome	5360130	4234484	4246138	5360130		Enterobacteria_phage(70.0%)	13	NA	NA
AZK57330.1|4234484_4235588_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
AZK57331.1|4235598_4236852_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AZK57332.1|4237204_4238395_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AZK57333.1|4238382_4239333_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
AZK57334.1|4239332_4239758_+	hypothetical protein	NA	NA	NA	NA	NA
AZK57335.1|4240326_4240893_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
AZK57336.1|4240910_4241156_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
AZK57337.1|4241152_4241890_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
AZK57338.1|4242431_4242698_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AZK57339.1|4242694_4243252_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AZK57340.1|4243248_4243476_+	hypothetical protein	NA	NA	NA	NA	NA
AZK57341.1|4243472_4243793_+	hypothetical protein	NA	NA	NA	NA	NA
AZK57342.1|4243804_4246138_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 9
CP034249	Klebsiella pneumoniae strain KP18-29 chromosome, complete genome	5360130	4719041	4729720	5360130	transposase	Stx2-converting_phage(55.56%)	14	NA	NA
AZK57748.1|4719041_4720580_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
AZK57749.1|4720628_4720976_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AZK57750.1|4720972_4721377_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
AZK57751.1|4721466_4721961_+	hypothetical protein	NA	NA	NA	NA	NA
AZK57752.1|4722057_4722279_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AZK57753.1|4722318_4722459_-	hypothetical protein	NA	NA	NA	NA	NA
AZK58537.1|4722451_4722616_-	hypothetical protein	NA	A0A1B0Z042	Pseudomonas_phage	66.7	6.5e-08
AZK57754.1|4722616_4722988_-	hypothetical protein	NA	NA	NA	NA	NA
AZK57755.1|4723062_4723503_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
AZK57756.1|4723499_4723850_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
AZK57757.1|4723881_4725474_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
AZK57758.1|4725529_4726498_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZK57759.1|4727842_4728247_-	hypothetical protein	NA	Q76S41	Shigella_phage	48.3	1.0e-22
AZK57760.1|4728466_4729720_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	44.8	1.1e-62
