The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034110	Avibacterium paragallinarum strain FARPER-174 chromosome, complete genome	2425949	409705	450500	2425949	holin,terminase,plate,integrase	Haemophilus_phage(35.71%)	56	437972:437996	451219:451243
AZI13528.1|409705_411844_-	hypothetical protein	NA	Q94MY0	Haemophilus_virus	37.1	7.6e-64
AZI13529.1|411848_412427_-	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	68.4	7.0e-73
AZI13530.1|412426_413557_-|plate	baseplate J/gp47 family protein	plate	Q7Y5S4	Haemophilus_phage	66.6	7.7e-140
AZI13531.1|413607_413958_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	66.7	8.6e-42
AZI13532.1|413954_414602_-|plate	baseplate protein	plate	D0UIH7	Aggregatibacter_phage	60.8	7.6e-68
AZI13533.1|414598_415435_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	71.9	2.8e-115
AZI15207.1|416605_416932_-	hemocin immunity protein	NA	NA	NA	NA	NA
AZI15208.1|416979_417252_-	hemocin structural protein	NA	NA	NA	NA	NA
AZI13534.1|417278_417986_-	ABC transporter	NA	NA	NA	NA	NA
AZI13535.1|417988_418585_-	HmcC	NA	NA	NA	NA	NA
AZI13536.1|418547_419396_-	hemin receptor	NA	NA	NA	NA	NA
AZI13537.1|420582_421422_-	RepB family plasmid replication initiator protein	NA	A0A1V0E006	Clostridioides_phage	35.7	2.2e-14
AZI13538.1|421397_421700_-	hypothetical protein	NA	Q7Y5S9	Haemophilus_phage	56.8	6.1e-28
AZI13539.1|421703_422465_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	53.5	3.0e-63
AZI13540.1|422532_422787_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	55.8	1.4e-17
AZI13541.1|422770_423118_+	XRE family transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	55.3	8.1e-24
AZI13542.1|423120_425055_-	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	48.2	4.7e-04
AZI13543.1|425184_425610_-	hypothetical protein	NA	Q776V6	Haemophilus_phage	56.2	3.6e-34
AZI13544.1|425612_426041_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	78.2	7.3e-59
AZI13545.1|426050_427553_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	75.1	1.8e-216
AZI13546.1|427556_428069_-	hypothetical protein	NA	Q7Y5T6	Haemophilus_phage	50.6	1.0e-35
AZI13547.1|428123_428339_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	46.1	3.1e-10
AZI13548.1|428335_428779_-	hypothetical protein	NA	Q7Y5T8	Haemophilus_phage	49.6	3.3e-30
AZI13549.1|428775_429126_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	51.7	2.4e-23
AZI13550.1|429134_430037_-	DUF2184 domain-containing protein	NA	Q7Y5U0	Haemophilus_phage	62.8	3.0e-102
AZI13551.1|430049_430502_-	hypothetical protein	NA	D0UIJ1	Aggregatibacter_phage	52.7	3.6e-32
AZI13552.1|430501_431623_-	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	60.2	7.0e-85
AZI13553.1|431690_431972_-	hypothetical protein	NA	NA	NA	NA	NA
AZI13554.1|431974_433372_-	hypothetical protein	NA	Q7Y5U5	Haemophilus_phage	44.7	1.9e-55
AZI13555.1|433292_434609_-	DUF1073 domain-containing protein	NA	D0UIJ6	Aggregatibacter_phage	52.8	5.1e-119
AZI13556.1|434605_435955_-|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	58.3	4.0e-143
AZI13557.1|435935_436463_-|terminase	terminase small subunit	terminase	E5AGA2	Erwinia_phage	43.2	2.4e-19
AZI13558.1|436473_436728_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	58.0	3.6e-21
AZI15209.1|436891_437254_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AZI13559.1|437213_437621_-	M15 family peptidase	NA	W0LI70	Edwardsiella_phage	64.4	1.5e-45
AZI13560.1|437613_437946_-|holin	phage holin, lambda family	holin	A0A2D1GNJ3	Pseudomonas_phage	36.8	4.1e-09
437972:437996	attL	AAAAAGCCCACCTGTTACAGTGGGC	NA	NA	NA	NA
AZI13561.1|438049_438592_+	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	34.9	2.5e-19
AZI13562.1|438857_439370_-	kinase	NA	NA	NA	NA	NA
AZI13563.1|439546_440305_-	helix-turn-helix domain-containing protein	NA	Q76H56	Enterobacteria_phage	26.1	6.5e-18
AZI13564.1|440424_440625_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	44.6	1.0e-07
AZI13565.1|440647_440941_+	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	79.2	1.6e-36
AZI13566.1|440988_441396_-	hypothetical protein	NA	NA	NA	NA	NA
AZI13567.1|441505_442276_+	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	45.4	1.3e-45
AZI13568.1|442272_443079_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	62.0	3.3e-28
AZI13569.1|443075_443759_+	phage lambda replication protein P	NA	A0A0M3LS65	Mannheimia_phage	42.2	4.6e-39
AZI13570.1|443867_444503_+	DUF1367 family protein	NA	A0A2I7RNU5	Vibrio_phage	29.6	3.8e-19
AZI13571.1|444503_444788_+	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	80.6	2.0e-36
AZI13572.1|445113_445464_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	42.1	6.2e-16
AZI13573.1|445463_445826_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AZI13574.1|446070_447075_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	24.4	3.8e-05
AZI13575.1|447372_447543_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AZI13576.1|447557_447779_+	hypothetical protein	NA	NA	NA	NA	NA
AZI13577.1|448035_448353_+	hypothetical protein	NA	NA	NA	NA	NA
AZI13578.1|448356_448614_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	53.6	2.0e-11
AZI13579.1|448594_449302_+	HNH endonuclease	NA	NA	NA	NA	NA
AZI13580.1|449513_450500_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	39.0	3.6e-61
451219:451243	attR	GCCCACTGTAACAGGTGGGCTTTTT	NA	NA	NA	NA
>prophage 2
CP034110	Avibacterium paragallinarum strain FARPER-174 chromosome, complete genome	2425949	455277	463849	2425949	bacteriocin,integrase	Mannheimia_phage(30.0%)	16	452338:452353	464846:464861
452338:452353	attL	GATCACATCAATAACA	NA	NA	NA	NA
AZI13587.1|455277_455589_+	hypothetical protein	NA	A0A0M3LPX7	Mannheimia_phage	52.5	1.8e-14
AZI13588.1|455518_455785_+	hypothetical protein	NA	NA	NA	NA	NA
AZI13589.1|455774_456722_+	hypothetical protein	NA	NA	NA	NA	NA
AZI13590.1|456731_457007_+	hypothetical protein	NA	NA	NA	NA	NA
AZI13591.1|457148_457373_+	hypothetical protein	NA	NA	NA	NA	NA
AZI13592.1|457369_457870_+	siphovirus Gp157 family protein	NA	A0A0E3U2R8	Fusobacterium_phage	35.5	3.8e-14
AZI13593.1|457880_458768_+	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	55.9	1.3e-57
AZI13594.1|458767_459247_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	52.8	2.1e-38
AZI13595.1|459255_459504_+	hypothetical protein	NA	NA	NA	NA	NA
AZI13596.1|459546_459861_+	hypothetical protein	NA	X2CY11	Brucella_phage	40.2	3.6e-07
AZI13597.1|459883_460066_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	52.6	4.0e-06
AZI13598.1|460375_460585_-	ribbon-helix-helix protein, CopG family	NA	A0A0M3LQV3	Mannheimia_phage	58.1	6.1e-11
AZI13599.1|461099_461762_+|bacteriocin	bacteriocin	bacteriocin	D0UIM5	Aggregatibacter_phage	43.2	6.5e-14
AZI13600.1|462005_462602_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
AZI13601.1|462632_462956_+	DNA-binding protein	NA	Q7Y5X6	Haemophilus_phage	64.5	1.2e-32
AZI13602.1|462829_463849_+|integrase	site-specific integrase	integrase	Q7Y5X7	Haemophilus_phage	88.2	2.3e-175
464846:464861	attR	TGTTATTGATGTGATC	NA	NA	NA	NA
>prophage 3
CP034110	Avibacterium paragallinarum strain FARPER-174 chromosome, complete genome	2425949	1636498	1647657	2425949		Mannheimia_phage(30.0%)	17	NA	NA
AZI14510.1|1636498_1637398_-	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	72.1	5.5e-48
AZI14511.1|1637742_1637961_-	hypothetical protein	NA	NA	NA	NA	NA
AZI14512.1|1637953_1639180_-	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	49.3	5.0e-44
AZI14513.1|1639402_1639681_+	Killer protein	NA	NA	NA	NA	NA
AZI14514.1|1639690_1639984_+	addiction module antidote protein, HigA family	NA	I6ZVM3	Aeromonas_phage	48.7	4.7e-09
AZI14515.1|1640093_1640756_-	hypothetical protein	NA	NA	NA	NA	NA
AZI14516.1|1640745_1641387_-	hypothetical protein	NA	NA	NA	NA	NA
AZI14517.1|1641460_1642057_-	recombinase NinG	NA	H6WRY9	Salmonella_phage	42.4	4.8e-32
AZI15263.1|1642381_1642819_-	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	71.0	8.5e-55
AZI14518.1|1642827_1643421_-	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	56.8	6.4e-53
AZI14519.1|1643417_1644257_-	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	48.5	8.4e-67
AZI14520.1|1644249_1645062_-	hypothetical protein	NA	A0A0P0IKQ2	Acinetobacter_phage	46.7	3.8e-16
AZI14521.1|1645058_1645847_-	phage regulatory protein	NA	A0A2I7R415	Vibrio_phage	35.7	8.2e-32
AZI14522.1|1645960_1646368_+	hypothetical protein	NA	NA	NA	NA	NA
AZI14523.1|1646385_1646826_-	hypothetical protein	NA	NA	NA	NA	NA
AZI14524.1|1646874_1647072_-	hypothetical protein	NA	NA	NA	NA	NA
AZI14525.1|1647177_1647657_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	33.8	3.6e-06
>prophage 4
CP034110	Avibacterium paragallinarum strain FARPER-174 chromosome, complete genome	2425949	1652027	1661838	2425949		Mannheimia_phage(75.0%)	17	NA	NA
AZI15264.1|1652027_1653176_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	77.9	8.9e-19
AZI14534.1|1653269_1653578_+	hypothetical protein	NA	NA	NA	NA	NA
AZI14535.1|1653599_1653875_+	hypothetical protein	NA	NA	NA	NA	NA
AZI15265.1|1654753_1655695_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	48.0	1.2e-45
AZI14536.1|1655705_1656485_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	62.1	9.8e-86
AZI14537.1|1656481_1657114_+	exonuclease	NA	A0A0M3LPU0	Mannheimia_phage	68.6	1.0e-77
AZI14538.1|1657101_1657581_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	53.5	1.4e-39
AZI14539.1|1657667_1657985_+	hypothetical protein	NA	NA	NA	NA	NA
AZI14540.1|1657981_1658377_+	hypothetical protein	NA	NA	NA	NA	NA
AZI14541.1|1658436_1659333_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	49.7	2.9e-73
AZI14542.1|1659329_1659539_+	hypothetical protein	NA	NA	NA	NA	NA
AZI14543.1|1659554_1659752_+	hypothetical protein	NA	NA	NA	NA	NA
AZI14544.1|1659754_1660084_+	hypothetical protein	NA	NA	NA	NA	NA
AZI14545.1|1660199_1660703_+	hypothetical protein	NA	A0A0M3LNU4	Mannheimia_phage	32.5	1.6e-12
AZI14546.1|1660695_1660929_+	hypothetical protein	NA	NA	NA	NA	NA
AZI14547.1|1661004_1661289_+	hypothetical protein	NA	NA	NA	NA	NA
AZI14548.1|1661355_1661838_+	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	72.3	7.7e-65
>prophage 5
CP034110	Avibacterium paragallinarum strain FARPER-174 chromosome, complete genome	2425949	1869399	1877300	2425949		Anomala_cuprea_entomopoxvirus(14.29%)	9	NA	NA
AZI14706.1|1869399_1870047_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	1.9e-10
AZI15278.1|1870719_1870971_-	hypothetical protein	NA	NA	NA	NA	NA
AZI14707.1|1871467_1872094_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A218M2Y8	Acidovorax_phage	34.4	5.7e-12
AZI14708.1|1872093_1872519_-	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	41.3	3.3e-19
AZI14709.1|1872511_1873195_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	48.9	1.1e-53
AZI14710.1|1873369_1873693_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AZI14711.1|1874736_1875846_+	methionine biosynthesis PLP-dependent protein	NA	A0A1V0SL56	Klosneuvirus	23.8	4.0e-16
AZI14712.1|1875863_1876859_+	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	38.4	4.9e-66
AZI14713.1|1876976_1877300_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	49.0	1.9e-19
