The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034230	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 chromosome, complete genome	4869644	1216420	1273123	4869644	lysis,terminase,tRNA,tail,capsid,head	Enterobacteria_phage(32.61%)	68	NA	NA
AZI81907.1|1216420_1217458_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AZI81908.1|1217573_1218263_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AZI81909.1|1218581_1218965_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
AZI81910.1|1219026_1219614_-	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AZI81911.1|1219716_1220616_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZI81912.1|1220633_1221968_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AZI81913.1|1222098_1222836_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
AZI81914.1|1222820_1224443_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AZI81915.1|1224527_1224707_+	hypothetical protein	NA	NA	NA	NA	NA
AZI81916.1|1224706_1224871_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
AZI81917.1|1224867_1225443_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
AZI81918.1|1225474_1226125_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AZI81919.1|1226124_1227081_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AZI81920.1|1227077_1227557_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
AZI85272.1|1227586_1227703_+	transcriptional regulator	NA	NA	NA	NA	NA
AZI81921.1|1228054_1229284_+	DUF4102 domain-containing protein	NA	H6WRW7	Salmonella_phage	94.4	2.9e-233
AZI81922.1|1229261_1229546_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
AZI81923.1|1229586_1229826_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AZI81924.1|1229868_1231026_-	enterohemolysin	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
AZI81925.1|1230988_1233916_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	95.0	0.0e+00
AZI81926.1|1234626_1234833_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	7.4e-17
AZI81927.1|1234940_1236026_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	38.0	1.5e-60
AZI81928.1|1236177_1236645_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.9	3.2e-68
AZI85273.1|1236850_1237225_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.8e-62
AZI81929.1|1237316_1238222_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	96.3	4.4e-170
AZI81930.1|1238218_1238911_+	phage replication protein	NA	G8C7U6	Escherichia_phage	60.2	1.8e-78
AZI81931.1|1238925_1239591_+	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	44.9	2.8e-25
AZI81932.1|1239592_1240063_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.1e-68
AZI81933.1|1240065_1240719_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.0	6.3e-62
AZI81934.1|1240711_1240993_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	3.2e-47
AZI81935.1|1241104_1241296_+	hypothetical protein	NA	G8C7S2	Escherichia_phage	68.9	1.1e-17
AZI81936.1|1241554_1241788_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
AZI81937.1|1241904_1242153_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
AZI81938.1|1242187_1242787_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	81.0	1.7e-93
AZI81939.1|1242783_1242978_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	1.4e-12
AZI81940.1|1242959_1243256_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	3.9e-35
AZI81941.1|1243252_1243807_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	65.3	3.4e-64
AZI81942.1|1243803_1243992_+	hypothetical protein	NA	NA	NA	NA	NA
AZI81943.1|1244073_1244634_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	71.1	1.1e-41
AZI81944.1|1244553_1244742_-	hypothetical protein	NA	NA	NA	NA	NA
AZI81945.1|1244876_1245065_+	hypothetical protein	NA	NA	NA	NA	NA
AZI85274.1|1245218_1245437_+	hypothetical protein	NA	NA	NA	NA	NA
AZI85275.1|1245448_1245916_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
AZI85276.1|1246165_1246468_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZI85277.1|1246445_1246985_+	lysozyme	NA	S5MQK2	Escherichia_phage	74.1	5.7e-77
AZI85278.1|1247302_1247758_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.8	8.0e-56
AZI81946.1|1247951_1248353_-	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AZI81947.1|1248638_1249184_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
AZI81948.1|1249155_1251087_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
AZI81949.1|1251070_1251274_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
AZI81950.1|1252886_1254335_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.0	1.2e-92
AZI81951.1|1254347_1254695_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
AZI81952.1|1254749_1255778_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
AZI81953.1|1255835_1256195_+	DNA packaging protein	NA	NA	NA	NA	NA
AZI81954.1|1256614_1257193_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.7	1.7e-82
AZI81955.1|1258477_1258879_+|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
AZI81956.1|1258886_1259633_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
AZI81957.1|1259683_1260079_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
AZI81958.1|1260075_1260414_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AZI81959.1|1260385_1263481_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
AZI81960.1|1263483_1263813_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
AZI81961.1|1263822_1264521_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
AZI81962.1|1264527_1265265_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
AZI81963.1|1265162_1265810_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
AZI81964.1|1265871_1269234_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
AZI81965.1|1271933_1272518_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.8	1.7e-87
AZI81966.1|1272615_1272816_-	phage virulence factor	NA	NA	NA	NA	NA
AZI81967.1|1273006_1273123_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 2
CP034230	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 chromosome, complete genome	4869644	1917867	1924676	4869644	tail,integrase	Salmonella_phage(33.33%)	11	1912730:1912752	1922445:1922467
1912730:1912752	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
AZI82599.1|1917867_1918749_-|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
AZI82600.1|1919221_1919410_+	hypothetical protein	NA	NA	NA	NA	NA
AZI82601.1|1919474_1919642_+	lytic enzyme	NA	NA	NA	NA	NA
AZI82602.1|1919898_1920432_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
AZI82603.1|1920485_1920716_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
AZI85305.1|1920905_1921400_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
AZI85304.1|1921459_1922314_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
AZI82604.1|1922687_1923041_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
1922445:1922467	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
AZI82605.1|1923057_1923933_-	copper resistance D family protein	NA	NA	NA	NA	NA
AZI82606.1|1923933_1924308_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AZI82607.1|1924445_1924676_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 3
CP034230	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 chromosome, complete genome	4869644	2000125	2079469	4869644	lysis,plate,protease,terminase,holin,tail,capsid,transposase,portal,integrase,head	Salmonella_phage(85.07%)	106	2006663:2006678	2081092:2081107
AZI82681.1|2000125_2000584_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
AZI82682.1|2000764_2001970_-	lysine-N-methylase	NA	NA	NA	NA	NA
AZI82683.1|2002048_2003536_-	flagellin FliC	NA	NA	NA	NA	NA
AZI82684.1|2003792_2005196_+	flagellar hook-associated protein 2	NA	NA	NA	NA	NA
AZI82685.1|2005210_2005618_+	flagella export chaperone FliS	NA	NA	NA	NA	NA
AZI82686.1|2005617_2005986_+	flagellar protein FliT	NA	NA	NA	NA	NA
AZI82687.1|2006057_2007542_+	alpha-amylase	NA	NA	NA	NA	NA
2006663:2006678	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
AZI85307.1|2007581_2008007_-	lipoprotein	NA	NA	NA	NA	NA
AZI82688.1|2008132_2009398_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
AZI82689.1|2009394_2009628_+	SirA-like protein	NA	NA	NA	NA	NA
AZI85308.1|2009892_2010279_+	hypothetical protein	NA	NA	NA	NA	NA
AZI82690.1|2010398_2010713_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AZI82691.1|2010929_2012612_+	flagellar M-ring protein	NA	NA	NA	NA	NA
AZI82692.1|2012604_2013600_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AZI82693.1|2013592_2014300_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AZI82694.1|2014299_2015670_+	flagellum-specific ATP synthase	NA	NA	NA	NA	NA
AZI82695.1|2015691_2016135_+	flagellar protein FliJ	NA	NA	NA	NA	NA
AZI82696.1|2016131_2017349_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
AZI82697.1|2017453_2017921_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AZI82698.1|2017925_2018930_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AZI82699.1|2018926_2019340_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AZI82700.1|2019339_2019717_+	flagellar protein FliO	NA	NA	NA	NA	NA
AZI82701.1|2019716_2020454_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AZI82702.1|2020463_2020733_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AZI82703.1|2020741_2021536_+	flagellar biosynthesis protein FliR	NA	NA	NA	NA	NA
AZI82704.1|2021817_2022441_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AZI82705.1|2022479_2022728_-	protein DsrB	NA	NA	NA	NA	NA
AZI85309.1|2022802_2023030_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AZI82706.1|2023339_2024155_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AZI82707.1|2024133_2025846_-	cellulose synthesis regulatory protein	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
AZI82708.1|2026010_2026256_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AZI82709.1|2026272_2027184_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AZI82710.1|2027359_2028280_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AZI82711.1|2028268_2028739_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
AZI82712.1|2028719_2030150_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AZI82713.1|2030223_2030919_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AZI82714.1|2031010_2031310_-	hypothetical protein	NA	NA	NA	NA	NA
AZI82715.1|2031959_2033156_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
AZI85310.1|2033416_2033605_-	cold-shock protein	NA	NA	NA	NA	NA
AZI82716.1|2033615_2033828_-	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AZI82717.1|2034282_2035551_-	protein UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
AZI82718.1|2035553_2035973_-	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AZI82719.1|2036099_2036261_-	hypothetical protein	NA	NA	NA	NA	NA
AZI82720.1|2036238_2036481_-	hypothetical protein	NA	NA	NA	NA	NA
AZI82721.1|2036562_2036778_+	hypothetical protein	NA	NA	NA	NA	NA
AZI82722.1|2036891_2037113_-	DNA-binding protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
AZI82723.1|2037325_2038333_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
AZI82724.1|2038617_2039187_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
AZI82725.1|2039186_2040749_-|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	100.0	2.6e-287
AZI82726.1|2040735_2041323_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
AZI82727.1|2041325_2041847_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
AZI82728.1|2041881_2042427_-|head	head assembly protein	head	Q8HAB7	Salmonella_phage	100.0	9.2e-99
AZI82729.1|2042398_2042812_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
AZI82730.1|2042816_2043350_-|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
AZI82731.1|2043349_2044408_-|plate	baseplate protein	plate	Q8HAC0	Salmonella_phage	100.0	1.3e-202
AZI82732.1|2044404_2045745_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
AZI82733.1|2045778_2047707_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
AZI82734.1|2047791_2048118_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
AZI82735.1|2048114_2048471_-|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
AZI82736.1|2048470_2049967_-|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
AZI82737.1|2049956_2050121_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
AZI82738.1|2050124_2050685_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
AZI82739.1|2050681_2051194_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
AZI82740.1|2051165_2051570_-|head,tail	head-tail adaptor protein	head,tail	Q8HAC9	Salmonella_phage	100.0	1.4e-72
AZI82741.1|2051566_2051890_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
AZI82742.1|2051892_2052093_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
AZI82743.1|2052143_2053349_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
AZI82744.1|2053363_2054014_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
AZI82745.1|2053991_2055233_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
AZI82746.1|2055232_2055415_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
AZI82747.1|2055426_2057160_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
AZI82748.1|2057156_2057651_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
AZI82749.1|2057776_2058127_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
AZI82750.1|2058187_2058490_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
AZI82751.1|2058709_2059129_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
AZI82752.1|2059341_2059827_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
AZI82753.1|2059823_2060438_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
AZI82754.1|2060440_2060785_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
AZI82755.1|2060946_2061381_+	hypothetical protein	NA	NA	NA	NA	NA
AZI85311.1|2061310_2061568_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
AZI82756.1|2061700_2062324_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
AZI82757.1|2062334_2063324_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	9.2e-190
AZI82758.1|2063331_2064192_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
AZI82759.1|2064208_2064598_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
AZI82760.1|2064594_2065488_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
AZI82761.1|2065487_2065970_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
AZI82762.1|2065971_2066790_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
AZI82763.1|2066786_2067011_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AZI82764.1|2067007_2068165_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
AZI82765.1|2068161_2068716_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
AZI82766.1|2068744_2068969_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AZI82767.1|2068907_2069093_-	amino acid permease	NA	NA	NA	NA	NA
AZI82768.1|2069066_2069762_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
AZI85312.1|2070576_2070948_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
AZI82769.1|2071005_2071833_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
AZI82770.1|2071969_2072509_+	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
AZI82771.1|2072579_2072810_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
AZI82772.1|2072806_2073322_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
AZI82773.1|2073318_2073936_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
AZI82774.1|2073932_2074766_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
AZI82775.1|2074769_2075339_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
AZI82776.1|2075363_2075606_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
AZI82777.1|2075607_2076597_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
AZI82778.1|2076888_2077686_+	protein MtfA	NA	NA	NA	NA	NA
AZI82779.1|2078057_2078348_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
AZI82780.1|2078995_2079469_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2081092:2081107	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 4
CP034230	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 chromosome, complete genome	4869644	2165463	2175969	4869644		Enterobacteria_phage(37.5%)	10	NA	NA
AZI82861.1|2165463_2166777_-	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AZI82862.1|2166803_2167883_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
AZI82863.1|2167887_2168661_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZI82864.1|2168657_2169650_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AZI82865.1|2169655_2170207_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
AZI85319.1|2170207_2171086_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
AZI82866.1|2171133_2172033_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
AZI82867.1|2172032_2173118_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
AZI82868.1|2173494_2174388_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AZI82869.1|2174565_2175969_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 5
CP034230	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 chromosome, complete genome	4869644	2244277	2253448	4869644	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AZI82923.1|2244277_2246311_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
AZI82924.1|2246551_2247010_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AZI82925.1|2247181_2247712_+	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AZI82926.1|2247768_2248236_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AZI82927.1|2248282_2249002_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZI82928.1|2248998_2250684_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
AZI82929.1|2250906_2251638_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AZI82930.1|2251697_2251805_+	protein YohO	NA	NA	NA	NA	NA
AZI82931.1|2251785_2252517_-	ABC transporter permease	NA	NA	NA	NA	NA
AZI82932.1|2252500_2253448_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 6
CP034230	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 chromosome, complete genome	4869644	2325499	2337790	4869644	tail,holin	Salmonella_phage(45.45%)	11	NA	NA
AZI82998.1|2325499_2326003_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
AZI82999.1|2326030_2326321_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
AZI83000.1|2326668_2328498_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
AZI83001.1|2328551_2328995_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
AZI83002.1|2329372_2329900_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
AZI83003.1|2329902_2331144_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
AZI83004.1|2331736_2332066_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
AZI83005.1|2332362_2333694_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
AZI83006.1|2333722_2334091_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
AZI83007.1|2334105_2335095_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	2.4e-190
AZI83008.1|2335423_2337790_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
>prophage 7
CP034230	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 chromosome, complete genome	4869644	2678122	2777635	4869644	lysis,terminase,tRNA,tail,capsid,transposase,integrase,head	Salmonella_phage(24.56%)	104	2706138:2706159	2777899:2777920
AZI83299.1|2678122_2678854_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AZI83300.1|2678972_2679776_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
AZI83301.1|2679920_2680799_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
AZI83302.1|2680980_2682024_+	sulfite reductase subunit alpha	NA	NA	NA	NA	NA
AZI83303.1|2682027_2682846_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
AZI83304.1|2682856_2683870_+	anaerobic sulfite reductase subunit AsrC	NA	NA	NA	NA	NA
AZI83305.1|2683870_2684857_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
AZI85338.1|2684847_2685486_-	DUF1007 family protein	NA	NA	NA	NA	NA
AZI83306.1|2685611_2686889_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
AZI83307.1|2686883_2688023_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
AZI83308.1|2688218_2689472_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
AZI83309.1|2689796_2690987_+	flavohemoprotein	NA	NA	NA	NA	NA
AZI83310.1|2691168_2692713_+	transcriptional regulator CadC	NA	NA	NA	NA	NA
AZI83311.1|2693073_2694405_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
AZI83312.1|2694487_2696632_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
AZI83313.1|2696687_2698148_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
AZI83314.1|2698196_2698535_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AZI83315.1|2698611_2699949_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
AZI83316.1|2699945_2700710_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AZI85339.1|2700711_2702142_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
AZI83317.1|2702790_2706678_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
2706138:2706159	attL	CCAGACCAAGACGCAGGTTGGC	NA	NA	NA	NA
AZI83318.1|2706699_2706933_+	hypothetical protein	NA	NA	NA	NA	NA
AZI83319.1|2706933_2708478_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
AZI83320.1|2708528_2709080_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AZI83321.1|2709104_2709740_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AZI83322.1|2709743_2711105_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AZI83323.1|2711115_2712009_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AZI83324.1|2712124_2712973_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AZI83325.1|2713011_2713929_-	oxidoreductase	NA	NA	NA	NA	NA
AZI83326.1|2713950_2715147_-	MFS transporter	NA	NA	NA	NA	NA
AZI83327.1|2715262_2716189_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
AZI83328.1|2716226_2716487_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
AZI83329.1|2716598_2716979_-	holo-ACP synthase	NA	NA	NA	NA	NA
AZI83330.1|2716978_2717710_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AZI83331.1|2717721_2718450_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AZI83332.1|2718461_2719367_-	GTPase Era	NA	NA	NA	NA	NA
AZI83333.1|2719363_2720044_-	ribonuclease 3	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
AZI83334.1|2720317_2721292_-	S26 family signal peptidase	NA	NA	NA	NA	NA
AZI83335.1|2721308_2723108_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
AZI83336.1|2725482_2725620_+	hypothetical protein	NA	NA	NA	NA	NA
AZI83337.1|2725866_2726412_+|transposase	transposase	transposase	NA	NA	NA	NA
AZI83338.1|2726332_2726497_-|integrase	integrase	integrase	NA	NA	NA	NA
AZI85340.1|2727076_2727142_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
AZI83339.1|2727204_2727417_-	hypothetical protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
AZI83340.1|2727523_2727751_+	phage virulence factor	NA	NA	NA	NA	NA
AZI83341.1|2727847_2728426_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
AZI83342.1|2728415_2729240_-|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
AZI83343.1|2731941_2735304_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
AZI83344.1|2735365_2736013_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
AZI83345.1|2735910_2736648_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
AZI83346.1|2736654_2737353_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
AZI83347.1|2737362_2737692_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
AZI83348.1|2737694_2740790_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
AZI83349.1|2740761_2741100_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AZI83350.1|2741096_2741492_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
AZI83351.1|2741542_2742289_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
AZI83352.1|2742296_2742698_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
AZI83353.1|2742806_2743937_+|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	99.5	3.8e-216
AZI83354.1|2743985_2744564_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
AZI83355.1|2744984_2745344_-	DNA packaging protein	NA	NA	NA	NA	NA
AZI83356.1|2745401_2746430_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
AZI83357.1|2746484_2746832_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
AZI83358.1|2749903_2750107_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
AZI83359.1|2751992_2752538_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
AZI83360.1|2752823_2753225_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AZI85341.1|2753451_2753907_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.8	8.0e-56
AZI85343.1|2754224_2754764_-	lysozyme	NA	S5MQK2	Escherichia_phage	74.1	5.7e-77
AZI85342.1|2754741_2755044_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZI85344.1|2755293_2755761_+	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
AZI85345.1|2755772_2755991_-	hypothetical protein	NA	NA	NA	NA	NA
AZI83361.1|2756144_2756333_-	hypothetical protein	NA	NA	NA	NA	NA
AZI83362.1|2756467_2756656_+	hypothetical protein	NA	NA	NA	NA	NA
AZI83363.1|2756575_2757136_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	71.1	1.1e-41
AZI83364.1|2757217_2757406_-	hypothetical protein	NA	NA	NA	NA	NA
AZI83365.1|2757402_2757957_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	65.3	3.4e-64
AZI83366.1|2757953_2758250_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	3.9e-35
AZI83367.1|2758231_2758426_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	1.4e-12
AZI83368.1|2758422_2759022_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	81.0	1.7e-93
AZI83369.1|2759056_2759305_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
AZI83370.1|2759421_2759655_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
AZI83371.1|2759913_2760105_-	hypothetical protein	NA	G8C7S2	Escherichia_phage	68.9	1.1e-17
AZI83372.1|2760216_2760498_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	3.2e-47
AZI83373.1|2760490_2761144_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.0	6.3e-62
AZI83374.1|2761146_2761617_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.1e-68
AZI83375.1|2761618_2762284_-	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	44.9	2.8e-25
AZI83376.1|2762298_2762991_-	phage replication protein	NA	G8C7U6	Escherichia_phage	60.2	1.8e-78
AZI83377.1|2762987_2763893_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	96.3	4.4e-170
AZI83378.1|2763984_2764359_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.8e-62
AZI83379.1|2764324_2764552_-	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
AZI83380.1|2764565_2765033_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.9	3.2e-68
AZI83381.1|2765184_2766270_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	38.0	1.5e-60
AZI83382.1|2766377_2766584_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	7.4e-17
AZI83383.1|2767294_2770006_+	exonuclease VIII	NA	H6WRX1	Salmonella_phage	39.6	1.2e-125
AZI83384.1|2769998_2770829_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.3e-104
AZI83385.1|2770864_2771185_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.2	1.8e-33
AZI83386.1|2771177_2771510_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	81.8	8.8e-20
AZI83387.1|2771506_2772058_+	Eaa protein	NA	A0A192Y7X3	Salmonella_phage	34.5	2.8e-10
AZI83388.1|2772107_2772344_+	excisionase	NA	NA	NA	NA	NA
AZI83389.1|2772333_2773476_+|integrase	integrase	integrase	O21929	Phage_21	80.3	8.2e-174
AZI83390.1|2773588_2774839_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
AZI83391.1|2775010_2775676_+	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AZI83392.1|2775672_2776002_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AZI83393.1|2776013_2776475_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AZI83394.1|2776528_2777635_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2777899:2777920	attR	GCCAACCTGCGTCTTGGTCTGG	NA	NA	NA	NA
>prophage 8
CP034230	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 chromosome, complete genome	4869644	2923525	3008261	4869644	lysis,protease,terminase,holin,tRNA,tail,portal	Salmonella_phage(45.45%)	94	NA	NA
AZI83544.1|2923525_2924206_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
AZI83545.1|2924826_2925486_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
AZI83546.1|2925572_2925902_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AZI83547.1|2925898_2926180_-	acylphosphatase	NA	NA	NA	NA	NA
AZI83548.1|2926228_2927008_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZI83549.1|2927033_2927582_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AZI83550.1|2927796_2929008_+	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AZI83551.1|2929065_2929383_+	heat-shock protein HspQ	NA	NA	NA	NA	NA
AZI83552.1|2929427_2929844_-	CoA-binding protein	NA	NA	NA	NA	NA
AZI83553.1|2930014_2930677_+	DUF2057 family protein	NA	NA	NA	NA	NA
AZI83554.1|2930771_2931230_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AZI83555.1|2931265_2933320_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
AZI83556.1|2933443_2933890_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AZI83557.1|2933908_2936062_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AZI83558.1|2936048_2936654_-	TfoX family DNA transformation protein	NA	NA	NA	NA	NA
AZI83559.1|2936870_2937380_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AZI83560.1|2937736_2938789_+	porin OmpA	NA	NA	NA	NA	NA
AZI83561.1|2938860_2939313_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
AZI83562.1|2939498_2941259_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AZI83563.1|2941327_2941846_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AZI83564.1|2941945_2942113_-	ribosome modulation factor	NA	NA	NA	NA	NA
AZI83565.1|2942368_2942932_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AZI83566.1|2942928_2944569_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AZI83567.1|2944573_2945827_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
AZI83568.1|2945841_2947749_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
AZI83569.1|2947761_2949870_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AZI83570.1|2949968_2951078_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AZI83571.1|2951074_2951617_-	cell division protein ZapC	NA	NA	NA	NA	NA
AZI83572.1|2951782_2952793_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AZI83573.1|2953000_2955613_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
AZI85350.1|2956039_2956231_+	DinI family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
AZI83574.1|2956501_2957188_+	virulence protein	NA	NA	NA	NA	NA
AZI83575.1|2957172_2957472_+	hypothetical protein	NA	NA	NA	NA	NA
AZI83576.1|2957540_2958167_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AZI83577.1|2958814_2959783_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
AZI83578.1|2960258_2960840_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AZI83579.1|2960839_2963278_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
AZI83580.1|2963331_2963574_-	hypothetical protein	NA	NA	NA	NA	NA
AZI83581.1|2963612_2966963_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
AZI83582.1|2967034_2967739_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
AZI83583.1|2967636_2968374_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
AZI83584.1|2968383_2969079_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
AZI83585.1|2969168_2969702_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AZI83586.1|2969818_2970316_-	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
AZI83587.1|2970414_2970747_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
AZI85351.1|2970743_2973731_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
AZI83588.1|2973810_2974140_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AZI83589.1|2974136_2974535_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AZI83590.1|2974580_2975330_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
AZI83591.1|2975341_2975743_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
AZI83592.1|2975739_2976306_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
AZI83593.1|2976286_2976586_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AZI83594.1|2976578_2976902_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AZI85353.1|2976992_2979074_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
AZI85352.1|2978997_2980515_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
AZI83595.1|2980541_2980748_-	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AZI85354.1|2980744_2982883_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
AZI83596.1|2982839_2983373_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
AZI83597.1|2983580_2984060_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AZI83598.1|2984077_2984530_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AZI85355.1|2984513_2984843_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AZI83599.1|2985118_2985805_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
AZI83600.1|2986165_2986615_+	hypothetical protein	NA	NA	NA	NA	NA
AZI83601.1|2986750_2986876_-	hypothetical protein	NA	NA	NA	NA	NA
AZI83602.1|2987049_2987367_-	hypothetical protein	NA	NA	NA	NA	NA
AZI83603.1|2987433_2988231_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
AZI83604.1|2988220_2988367_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AZI83605.1|2988363_2988975_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
AZI85356.1|2988977_2989184_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AZI83606.1|2989183_2989786_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
AZI83607.1|2989868_2990090_-	hypothetical protein	NA	NA	NA	NA	NA
AZI83608.1|2990201_2990435_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
AZI83609.1|2990726_2991017_-	hypothetical protein	NA	NA	NA	NA	NA
AZI83610.1|2991094_2991406_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
AZI83611.1|2991402_2991750_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
AZI83612.1|2991760_2992510_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.2	1.1e-137
AZI83613.1|2992512_2993496_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
AZI83614.1|2993580_2993955_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AZI83615.1|2993920_2994160_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
AZI85357.1|2994279_2994690_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
AZI83616.1|2994739_2995000_+	hypothetical protein	NA	NA	NA	NA	NA
AZI83617.1|2994992_2995151_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
AZI83618.1|2995172_2995472_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
AZI83619.1|2995598_2998484_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
AZI83620.1|2998446_2999604_+	enterohemolysin	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
AZI83621.1|2999646_2999886_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AZI83622.1|2999926_3000175_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AZI83623.1|3000219_3001512_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.5	2.9e-252
AZI83624.1|3001706_3002909_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AZI83625.1|3002986_3004423_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
AZI83626.1|3004667_3005882_-	PLP-dependent lyase/thiolase	NA	NA	NA	NA	NA
AZI83627.1|3005968_3006202_+	hypothetical protein	NA	NA	NA	NA	NA
AZI83628.1|3006198_3006660_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AZI83629.1|3006860_3008261_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
>prophage 9
CP034230	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 chromosome, complete genome	4869644	3072427	3081159	4869644	protease,transposase	Enterobacteria_phage(14.29%)	9	NA	NA
AZI83679.1|3072427_3073682_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
AZI85359.1|3073697_3073973_-	hypothetical protein	NA	NA	NA	NA	NA
AZI83680.1|3074145_3074604_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
AZI83681.1|3074560_3074743_-	hypothetical protein	NA	NA	NA	NA	NA
AZI83682.1|3074795_3077072_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AZI83683.1|3077102_3077423_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AZI83684.1|3077746_3077968_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AZI83685.1|3078097_3080044_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
AZI83686.1|3080040_3081159_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 10
CP034230	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 chromosome, complete genome	4869644	4449861	4496905	4869644	tail,plate,tRNA	Burkholderia_phage(40.91%)	50	NA	NA
AZI84874.1|4449861_4450860_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AZI84875.1|4450947_4452258_-	conjugal transfer protein	NA	NA	NA	NA	NA
AZI84876.1|4452504_4453020_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
AZI85417.1|4453118_4453328_-	CsbD family protein	NA	NA	NA	NA	NA
AZI84877.1|4453349_4453463_-	hypothetical protein	NA	NA	NA	NA	NA
AZI84878.1|4453459_4454785_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
AZI84879.1|4454963_4455572_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AZI84880.1|4455680_4456049_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AZI84881.1|4456219_4458640_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
AZI84882.1|4458738_4459611_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AZI84883.1|4459624_4460122_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AZI84884.1|4460302_4461220_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AZI84885.1|4461383_4462742_-	maltoporin	NA	NA	NA	NA	NA
AZI84886.1|4462830_4463940_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AZI84887.1|4464301_4465492_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AZI84888.1|4465623_4467168_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AZI84889.1|4467182_4468073_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AZI84890.1|4468238_4468649_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AZI84891.1|4468791_4470888_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AZI84892.1|4470887_4471625_-	hypothetical protein	NA	NA	NA	NA	NA
AZI84893.1|4471621_4472290_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AZI85418.1|4472323_4472566_-	outer membrane protein	NA	NA	NA	NA	NA
AZI84894.1|4473009_4474659_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AZI84895.1|4475003_4476353_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AZI84896.1|4476485_4476833_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
AZI84897.1|4477408_4477696_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
AZI84898.1|4477698_4478304_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	1.2e-59
AZI84899.1|4478316_4478631_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AZI84900.1|4478790_4479246_+	hypothetical protein	NA	NA	NA	NA	NA
AZI84901.1|4479242_4479440_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AZI84902.1|4479429_4480857_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
AZI84903.1|4480856_4481381_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AZI84904.1|4481432_4481750_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZI84905.1|4481709_4481838_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZI84906.1|4481934_4484289_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
AZI84907.1|4484288_4485242_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
AZI84908.1|4485241_4485451_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AZI84909.1|4485438_4486482_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
AZI84910.1|4486491_4487214_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
AZI84911.1|4487541_4487904_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
AZI84912.1|4487900_4488830_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
AZI84913.1|4488829_4490377_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
AZI84914.1|4490540_4490900_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AZI84915.1|4490890_4492006_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
AZI84916.1|4491998_4492631_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
AZI84917.1|4492633_4494379_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
AZI84918.1|4494383_4494989_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AZI84919.1|4494985_4495441_+	hypothetical protein	NA	NA	NA	NA	NA
AZI84920.1|4495689_4495980_+	hypothetical protein	NA	NA	NA	NA	NA
AZI84921.1|4496176_4496905_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
CP034231	Salmonella enterica subsp. enterica serovar Typhimurium strain ATCC 14028 plasmid pATCC14028, complete sequence	95924	85867	95163	95924	transposase	Escherichia_phage(28.57%)	12	NA	NA
AZI85544.1|85867_86284_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
AZI85545.1|86467_86803_+	hypothetical protein	NA	NA	NA	NA	NA
AZI85530.1|86859_87426_+	DUF2913 family protein	NA	NA	NA	NA	NA
AZI85531.1|87457_88399_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
AZI85532.1|88813_90019_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
AZI85533.1|90015_90993_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
AZI85534.1|91074_92349_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
AZI85535.1|92348_92771_-	protein SamA	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
AZI85536.1|93281_93752_+	hypothetical protein	NA	NA	NA	NA	NA
AZI85537.1|93744_94101_+	hypothetical protein	NA	NA	NA	NA	NA
AZI85546.1|94149_94338_+	hypothetical protein	NA	NA	NA	NA	NA
AZI85538.1|94482_95163_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
