The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034159	Chryseobacterium carnis strain G0081 chromosome, complete genome	3230102	334537	344231	3230102		Orpheovirus(16.67%)	9	NA	NA
AZI31916.1|334537_335479_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.2	6.1e-66
AZI34410.1|335658_336024_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	39.7	1.5e-12
AZI31917.1|336430_336952_+	phospholipase	NA	NA	NA	NA	NA
AZI31918.1|337200_337596_+	septal ring lytic transglycosylase RlpA family protein	NA	A0A0F6SJ38	Sinorhizobium_phage	46.0	5.4e-16
AZI31919.1|337898_340277_+	DEAD/DEAH box helicase	NA	I6NQU5	Burkholderia_phage	22.8	5.4e-10
AZI31920.1|340286_340697_+	hypothetical protein	NA	NA	NA	NA	NA
AZI31921.1|340693_341251_+	hypothetical protein	NA	NA	NA	NA	NA
AZI31922.1|341280_342726_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	33.1	4.9e-30
AZI31923.1|342725_344231_+	hypothetical protein	NA	F2Y1N5	Organic_Lake_phycodnavirus	36.5	3.2e-08
>prophage 2
CP034159	Chryseobacterium carnis strain G0081 chromosome, complete genome	3230102	1252268	1380062	3230102	tRNA,integrase,transposase	Leptospira_phage(33.33%)	107	1319974:1320000	1367362:1367381
AZI32710.1|1252268_1253471_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.5	9.0e-46
AZI32711.1|1254102_1255215_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32712.1|1255363_1256596_-	restriction endonuclease	NA	NA	NA	NA	NA
AZI32713.1|1256602_1258636_-	hypothetical protein	NA	K4I1H4	Acidithiobacillus_phage	43.0	6.2e-31
AZI32714.1|1258656_1261797_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.0	2.0e-57
AZI32715.1|1261803_1262799_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AZI32716.1|1262788_1263403_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32717.1|1263734_1264079_-	DUF3024 domain-containing protein	NA	NA	NA	NA	NA
AZI32718.1|1264178_1267355_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32719.1|1267467_1268610_-	DUF91 domain-containing protein	NA	NA	NA	NA	NA
AZI32720.1|1269743_1271303_-	DNA methyltransferase	NA	NA	NA	NA	NA
AZI32721.1|1271699_1272338_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32722.1|1272349_1273498_-	relaxase	NA	NA	NA	NA	NA
AZI32723.1|1273490_1273949_-	special sigma factor	NA	NA	NA	NA	NA
AZI32724.1|1274197_1274647_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32725.1|1275876_1276341_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32726.1|1276551_1277781_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32727.1|1277880_1278156_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32728.1|1278774_1279566_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZI32729.1|1279711_1279930_+	hypothetical protein	NA	NA	NA	NA	NA
AZI32730.1|1279937_1280354_-	EamA family transporter	NA	NA	NA	NA	NA
AZI32731.1|1280564_1281914_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	34.5	1.1e-47
AZI32732.1|1282006_1282489_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZI32733.1|1282614_1283061_-	aldolase	NA	NA	NA	NA	NA
AZI32734.1|1283141_1283471_-	single-stranded DNA-binding protein	NA	A0A0R6PHK0	Moraxella_phage	46.3	1.9e-19
AZI32735.1|1283880_1284339_+	hypothetical protein	NA	NA	NA	NA	NA
AZI32736.1|1284524_1285220_+	hypothetical protein	NA	NA	NA	NA	NA
AZI32737.1|1285279_1285843_+	hypothetical protein	NA	NA	NA	NA	NA
AZI32738.1|1285878_1286394_+	hypothetical protein	NA	NA	NA	NA	NA
AZI32739.1|1286537_1287113_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AZI32740.1|1287352_1288303_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	35.0	8.1e-42
AZI32741.1|1289157_1289427_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
AZI34433.1|1289535_1291083_+|transposase	IS1182 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	33.6	2.9e-65
AZI32742.1|1291292_1291535_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AZI32743.1|1291876_1294144_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
AZI32744.1|1294218_1296459_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32745.1|1296862_1298242_-	RtcB family protein	NA	R9ZZC9	Cellulophaga_phage	56.8	3.4e-150
AZI32746.1|1298377_1299379_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AZI32747.1|1299446_1300805_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZI32748.1|1300967_1301993_+	AAA family ATPase	NA	NA	NA	NA	NA
AZI32749.1|1301989_1304410_-	S8 family peptidase	NA	NA	NA	NA	NA
AZI32750.1|1304631_1306020_+	cytochrome P450	NA	NA	NA	NA	NA
AZI32751.1|1306143_1310160_+	AAA family ATPase	NA	NA	NA	NA	NA
AZI32752.1|1310372_1311083_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32753.1|1311221_1311557_+	type III effector	NA	NA	NA	NA	NA
AZI34434.1|1314031_1314976_-	nitronate monooxygenase	NA	NA	NA	NA	NA
AZI32754.1|1315292_1315634_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32755.1|1316057_1317356_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	1.1e-52
AZI32756.1|1317492_1317831_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AZI32757.1|1317984_1318236_-	FUSC family protein	NA	NA	NA	NA	NA
AZI32758.1|1318264_1318558_-	DUF4292 domain-containing protein	NA	NA	NA	NA	NA
AZI32759.1|1318567_1318969_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32760.1|1319130_1319829_-	hypothetical protein	NA	NA	NA	NA	NA
1319974:1320000	attL	TTGAACTAAACCTCCGGTAGCTTTTCC	NA	NA	NA	NA
AZI32761.1|1320100_1321042_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	30.4	4.1e-30
1319974:1320000	attL	TTGAACTAAACCTCCGGTAGCTTTTCC	NA	NA	NA	NA
AZI32762.1|1321025_1322144_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZI32763.1|1322376_1323174_-	class I SAM-dependent methyltransferase	NA	E3T531	Cafeteria_roenbergensis_virus	28.7	1.6e-06
AZI32764.1|1323516_1324458_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	30.7	2.9e-31
AZI32765.1|1324441_1325548_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZI32766.1|1325792_1326401_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32767.1|1326540_1327584_-|integrase	integrase	integrase	S5W9T9	Leptospira_phage	31.3	5.1e-29
AZI32768.1|1328862_1330770_+	oleate hydratase	NA	NA	NA	NA	NA
AZI32769.1|1330835_1331735_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZI32770.1|1331849_1332848_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZI32771.1|1332929_1333490_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AZI32772.1|1333944_1334238_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AZI32773.1|1334637_1335363_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32774.1|1335656_1336598_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	31.1	7.5e-32
1335531:1335557	attR	TTGAACTAAACCTCCGGTAGCTTTTCC	NA	NA	NA	NA
AZI32775.1|1336581_1337688_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
1335531:1335557	attR	TTGAACTAAACCTCCGGTAGCTTTTCC	NA	NA	NA	NA
AZI32776.1|1337936_1338185_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32777.1|1338696_1339638_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	31.1	2.2e-31
AZI32778.1|1339621_1340728_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZI32779.1|1341635_1342601_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	30.0	4.2e-30
AZI32780.1|1342584_1343703_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZI32781.1|1343958_1344348_+	hypothetical protein	NA	NA	NA	NA	NA
AZI32782.1|1344595_1345561_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	30.0	4.2e-30
AZI32783.1|1345544_1346663_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZI32784.1|1346894_1348499_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
AZI32785.1|1348649_1349198_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZI32786.1|1349365_1350250_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32787.1|1350398_1351004_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32788.1|1351006_1351420_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32789.1|1351557_1353096_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AZI32790.1|1353314_1353866_-	DinB family protein	NA	NA	NA	NA	NA
AZI34435.1|1353922_1354429_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AZI34436.1|1354605_1355316_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32791.1|1355522_1355984_-	DUF3276 family protein	NA	NA	NA	NA	NA
AZI32792.1|1355959_1356532_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32793.1|1356695_1357127_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32794.1|1357312_1358398_+|integrase	integrase	integrase	A0A0K2CP59	Brevibacillus_phage	27.7	7.9e-17
AZI32795.1|1358750_1360124_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AZI32796.1|1360189_1362019_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AZI32797.1|1362156_1363077_-	sugar kinase	NA	NA	NA	NA	NA
AZI32798.1|1363178_1363736_-	gliding motility lipoprotein GldD	NA	NA	NA	NA	NA
AZI32799.1|1363938_1364982_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AZI32800.1|1365029_1365320_+	integration host factor subunit beta	NA	Q2A099	Sodalis_phage	37.8	2.7e-09
AZI32801.1|1365688_1367251_+	ribonuclease E/G	NA	NA	NA	NA	NA
AZI32802.1|1367447_1368326_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZI32803.1|1368368_1368911_+	hypothetical protein	NA	NA	NA	NA	NA
AZI32804.1|1369115_1369583_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZI32805.1|1369741_1371790_-	insulinase family protein	NA	L7RBE7	Acanthamoeba_polyphaga_moumouvirus	23.0	1.1e-08
AZI32806.1|1371796_1373110_-	insulinase family protein	NA	NA	NA	NA	NA
AZI32807.1|1373390_1374455_+	oxidoreductase	NA	NA	NA	NA	NA
AZI32808.1|1374786_1375101_+	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
AZI32809.1|1375372_1376824_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
AZI32810.1|1376960_1377407_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
AZI32811.1|1377749_1378481_-	sterol desaturase family protein	NA	NA	NA	NA	NA
AZI32812.1|1378766_1380062_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.4	1.2e-75
>prophage 3
CP034159	Chryseobacterium carnis strain G0081 chromosome, complete genome	3230102	1402309	1453723	3230102	protease,integrase,transposase	Leptospira_phage(28.57%)	46	1403276:1403335	1436715:1436841
AZI32836.1|1402309_1403275_-|integrase	integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	30.9	3.1e-25
1403276:1403335	attL	AATTTTGTTCGTCCTTAAATCCTCCGGAGATTTTTTTTTGTAGCCATTTTAGAGATTTTA	NA	NA	NA	NA
AZI34437.1|1404546_1405350_+	ion transporter	NA	NA	NA	NA	NA
AZI32837.1|1405339_1405543_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AZI32838.1|1405600_1406458_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AZI32839.1|1406454_1406646_+	hypothetical protein	NA	NA	NA	NA	NA
AZI32840.1|1406697_1408236_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AZI32841.1|1411538_1412222_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AZI32842.1|1412333_1412774_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AZI32843.1|1412852_1413290_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AZI32844.1|1413305_1414256_+	hypothetical protein	NA	NA	NA	NA	NA
AZI32845.1|1414513_1414882_+	hypothetical protein	NA	NA	NA	NA	NA
AZI34438.1|1415194_1415890_+	zinc metallopeptidase	NA	NA	NA	NA	NA
AZI32846.1|1415905_1416874_+	J domain-containing protein	NA	A0A1V0SF83	Hokovirus	28.8	5.6e-22
AZI32847.1|1417048_1418047_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AZI32848.1|1418043_1418403_+	hypothetical protein	NA	NA	NA	NA	NA
AZI32849.1|1418614_1419244_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AZI32850.1|1419262_1420432_+	cation:proton antiporter	NA	NA	NA	NA	NA
AZI32851.1|1420440_1420980_+	hypothetical protein	NA	NA	NA	NA	NA
AZI32852.1|1420980_1421556_+	hypothetical protein	NA	NA	NA	NA	NA
AZI32853.1|1422024_1422318_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AZI34439.1|1422576_1424124_-|transposase	IS1182 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	33.4	1.9e-64
AZI34440.1|1425593_1426307_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AZI32854.1|1426475_1427039_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AZI32855.1|1427782_1428310_+	hypothetical protein	NA	NA	NA	NA	NA
AZI32856.1|1428441_1429254_+	metallophosphoesterase	NA	NA	NA	NA	NA
AZI32857.1|1429499_1430606_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZI32858.1|1430589_1431531_-|integrase	integrase	integrase	S5W9T9	Leptospira_phage	30.7	1.3e-31
AZI34441.1|1431701_1431788_+	hypothetical protein	NA	NA	NA	NA	NA
AZI32859.1|1431862_1433401_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AZI32860.1|1433539_1434412_+	WG repeat-containing protein	NA	NA	NA	NA	NA
AZI32861.1|1435772_1436714_-|integrase	integrase	integrase	S5W9T9	Leptospira_phage	31.6	1.4e-30
AZI32862.1|1436973_1437756_+	hypothetical protein	NA	NA	NA	NA	NA
1436715:1436841	attR	AATTTTGTTCGTCCTTAAATCCTCCGGAGATTTTTTTTTGTAGCCATTTTAGAGATTTTATTTTATGTTATGATCAAACAAAGTTAATAAAACAGCCTCAGGAAAAGCTACCGGAGGTTTAGTTCAA	NA	NA	NA	NA
AZI32863.1|1438004_1438460_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32864.1|1438351_1439086_-	hypothetical protein	NA	NA	NA	NA	NA
AZI32865.1|1439383_1440244_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZI32866.1|1440491_1441598_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZI32867.1|1442877_1443459_+	hypothetical protein	NA	NA	NA	NA	NA
AZI32868.1|1443824_1445027_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	1.4e-46
AZI32869.1|1445119_1446568_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AZI32870.1|1446685_1447633_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZI32871.1|1447863_1448412_+	hypothetical protein	NA	NA	NA	NA	NA
AZI32872.1|1448629_1448875_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AZI32873.1|1448865_1449189_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
AZI32874.1|1449654_1451973_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZI32875.1|1452057_1452276_+	hypothetical protein	NA	NA	NA	NA	NA
AZI32876.1|1452520_1453723_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.5	9.0e-46
