The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
CP034173	Chryseobacterium taklimakanense strain F9257 chromosome, complete genome	2538787	1117449	1159132	2538787	transposase,integrase	Staphylococcus_prophage(22.22%)	35	1116941:1116960	1155811:1155830
1116941:1116960	attL	TGACCTATTCAGTGACCTGT	NA	NA	NA	NA
AZI22505.1|1117449_1118706_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	33.6	2.6e-35
AZI22506.1|1118944_1119211_+|transposase	transposase	transposase	NA	NA	NA	NA
AZI22507.1|1119348_1119594_+	DNA-binding protein	NA	NA	NA	NA	NA
AZI22508.1|1119612_1120122_+	hypothetical protein	NA	NA	NA	NA	NA
AZI23723.1|1121385_1122675_-	HTH domain-containing protein	NA	NA	NA	NA	NA
AZI22509.1|1122837_1123935_+	hypothetical protein	NA	NA	NA	NA	NA
AZI22510.1|1123941_1125477_+	hypothetical protein	NA	NA	NA	NA	NA
AZI22511.1|1125448_1127209_+	hypothetical protein	NA	NA	NA	NA	NA
AZI22512.1|1127196_1128294_+	DNA methyltransferase	NA	A0A2I4R668	Erysipelothrix_phage	30.2	2.5e-34
AZI22513.1|1128332_1128599_+|transposase	transposase	transposase	NA	NA	NA	NA
AZI22514.1|1128625_1128844_+	hypothetical protein	NA	NA	NA	NA	NA
AZI22515.1|1128783_1129491_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.2	2.4e-38
AZI23724.1|1129710_1129953_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZI22516.1|1130540_1131878_+	hypothetical protein	NA	NA	NA	NA	NA
AZI22517.1|1131881_1135073_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
AZI22518.1|1135075_1136425_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
AZI22519.1|1136558_1136870_-	hypothetical protein	NA	NA	NA	NA	NA
AZI22520.1|1136997_1138302_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZI22521.1|1138302_1140495_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	30.1	1.9e-41
AZI22522.1|1140509_1141325_-	GLPGLI family protein	NA	NA	NA	NA	NA
AZI22523.1|1141454_1143002_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	30.7	2.3e-54
AZI22524.1|1143124_1143700_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.6	2.4e-28
AZI22525.1|1143686_1144325_-	hypothetical protein	NA	NA	NA	NA	NA
AZI22526.1|1144321_1145266_-	hypothetical protein	NA	NA	NA	NA	NA
AZI22527.1|1145273_1146281_-	hypothetical protein	NA	A0A1B2LRS3	Wolbachia_phage	29.7	1.0e-18
AZI22528.1|1146291_1146564_-	hypothetical protein	NA	NA	NA	NA	NA
AZI22529.1|1146704_1147040_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZI22530.1|1147047_1147617_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AZI22531.1|1147690_1148410_+	hypothetical protein	NA	NA	NA	NA	NA
AZI22532.1|1148406_1149378_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AZI22533.1|1149398_1150289_+	hypothetical protein	NA	X2KQX9	Campylobacter_phage	31.0	9.7e-05
AZI22534.1|1150307_1152233_+	hypothetical protein	NA	NA	NA	NA	NA
AZI22535.1|1152225_1153542_+	biotin carboxylase	NA	NA	NA	NA	NA
AZI22536.1|1153538_1155677_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AZI22537.1|1157584_1159132_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	33.8	1.4e-59
1155811:1155830	attR	TGACCTATTCAGTGACCTGT	NA	NA	NA	NA
