The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034176	Bacillus velezensis strain MH25 chromosome, complete genome	4118468	642063	651954	4118468		Synechococcus_phage(50.0%)	9	NA	NA
AZI45966.1|642063_643356_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
AZI45967.1|643431_644151_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.7	5.7e-48
AZI45968.1|644150_644405_+	phosphoribosylformylglycinamidine synthase, purS protein	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
AZI45969.1|644401_645085_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AZI45970.1|645068_647297_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.7	4.2e-158
AZI45971.1|647272_648703_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
AZI45972.1|648794_649835_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.4	2.8e-64
AZI45973.1|649831_650419_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.0e-26
AZI45974.1|650415_651954_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.1	2.3e-78
>prophage 2
CP034176	Bacillus velezensis strain MH25 chromosome, complete genome	4118468	849177	911184	4118468	tail,integrase,capsid,protease,portal,head,plate,holin,terminase	Bacillus_phage(50.0%)	71	875140:875160	913261:913281
AZI46146.1|849177_850089_-|protease	serine protease	protease	NA	NA	NA	NA
AZI46147.1|850237_850390_-	small, acid-soluble spore protein K	NA	NA	NA	NA	NA
AZI46148.1|850513_850783_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46149.1|850915_851443_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46150.1|851528_851864_+	SdpI family protein	NA	NA	NA	NA	NA
AZI46151.1|851856_852717_+	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	26.4	2.2e-06
AZI46152.1|852927_853908_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	39.3	1.5e-59
AZI46153.1|853944_856530_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46154.1|856526_857510_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AZI46155.1|857735_858833_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AZI46156.1|858839_859064_-	hypothetical protein	NA	NA	NA	NA	NA
AZI46157.1|859145_859898_+	enoyl-[acyl-carrier-protein] reductase FabL	NA	NA	NA	NA	NA
AZI46158.1|859964_860135_+	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
AZI46159.1|860295_860562_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46160.1|860697_861228_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
AZI46161.1|861310_863053_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	1.3e-48
AZI46162.1|863132_864197_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
AZI46163.1|864406_865696_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AZI46164.1|865853_866327_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
AZI46165.1|866451_866889_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
AZI46166.1|866923_867277_-	hypothetical protein	NA	NA	NA	NA	NA
AZI46167.1|867479_868364_+	hypothetical protein	NA	NA	NA	NA	NA
875140:875160	attL	TTCGACCCCGGCCACCGGTAT	NA	NA	NA	NA
AZI46168.1|875295_876411_-|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	59.5	1.6e-121
AZI46169.1|876643_877732_+	XRE family transcriptional regulator	NA	A0A288WGM1	Bacillus_phage	24.2	8.2e-14
AZI46170.1|878131_878548_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZI49231.1|878731_878920_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZI46171.1|878962_879286_+	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	39.8	2.0e-13
AZI46172.1|879303_879534_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46173.1|879526_880393_+	hypothetical protein	NA	D2XR43	Bacillus_phage	62.4	1.1e-50
AZI49232.1|880376_881210_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	34.8	3.5e-33
AZI46174.1|881525_882074_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	34.9	7.8e-05
AZI46175.1|882182_882323_+	BH0509 family protein	NA	NA	NA	NA	NA
AZI46176.1|882570_882774_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	56.9	9.8e-14
AZI46177.1|882914_883295_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46178.1|883291_883699_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	45.0	2.5e-24
AZI46179.1|883695_883953_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	42.3	9.6e-06
AZI46180.1|884048_884789_+	hypothetical protein	NA	A0A2H4J6H9	uncultured_Caudovirales_phage	69.2	1.1e-91
AZI46181.1|884828_885077_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46182.1|885019_885391_+	hypothetical protein	NA	H6WU17	Pseudomonas_phage	62.8	1.4e-05
AZI46183.1|885387_885660_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	52.2	8.8e-18
AZI46184.1|885656_886067_+	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	38.3	2.1e-15
AZI46185.1|886067_886295_+	hypothetical protein	NA	A0A217EQZ3	Bacillus_phage	63.5	2.0e-23
AZI46186.1|886310_886685_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46187.1|886681_886870_+	hypothetical protein	NA	NA	NA	NA	NA
AZI49233.1|887200_887653_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	57.4	1.5e-38
AZI46188.1|887649_888192_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.0	1.1e-54
AZI46189.1|888677_888890_+	cell division protein FtsK	NA	A0A0K2CPG8	Brevibacillus_phage	54.1	6.7e-05
AZI46190.1|889084_889372_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46191.1|889500_889740_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46192.1|889742_890051_+	HNH endonuclease	NA	R9TNN2	Paenibacillus_phage	58.3	1.5e-29
AZI46193.1|890156_890528_+	hypothetical protein	NA	R9TQ46	Paenibacillus_phage	53.6	9.5e-23
AZI46194.1|890524_892216_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	72.8	8.8e-249
AZI46195.1|892234_893494_+|portal	phage portal protein	portal	A0A1L2BY94	Clostridium_phage	59.8	2.6e-120
AZI46196.1|893384_894119_+|protease	Clp protease ClpP	protease	A0A0A8WFM9	Clostridium_phage	57.9	5.6e-67
AZI46197.1|894141_895395_+|capsid	phage major capsid protein	capsid	R9TQG7	Paenibacillus_phage	48.0	1.7e-84
AZI46198.1|895421_895637_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46199.1|895633_895909_+	DNA-packaging protein	NA	A0A290FZN8	Caldibacillus_phage	45.2	2.9e-16
AZI46200.1|895901_896204_+|head,tail	phage head-tail adapter protein	head,tail	A0A0S2SXM4	Bacillus_phage	38.5	9.8e-10
AZI49234.1|896208_896538_+	hypothetical protein	NA	E3W8G0	Leuconostoc_phage	34.9	6.9e-09
AZI46201.1|896537_896948_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46202.1|896968_897592_+	hypothetical protein	NA	A0A1J0MFV0	Staphylococcus_phage	31.2	1.5e-12
AZI46203.1|897591_897963_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46204.1|898178_902414_+	hypothetical protein	NA	A0A0S2SXL7	Bacillus_phage	31.3	6.8e-64
AZI46205.1|902421_903252_+|tail	phage tail family protein	tail	NA	NA	NA	NA
AZI46206.1|903264_905151_+	autolysin	NA	M5AC19	Bacillus_phage	35.8	3.8e-35
AZI46207.1|905155_907732_+	peptidase G2	NA	D6R401	Bacillus_phage	51.3	6.4e-243
AZI46208.1|907745_908978_+|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	82.7	1.5e-144
AZI46209.1|908974_909358_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	55.8	2.0e-28
AZI46210.1|909359_909515_+	XkdX family protein	NA	A0A1W6JQ64	Staphylococcus_phage	53.5	7.5e-06
AZI46211.1|909550_909973_+|holin	holin	holin	D6R405	Bacillus_phage	89.5	3.8e-60
AZI46212.1|910020_911184_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	50.2	6.6e-70
913261:913281	attR	TTCGACCCCGGCCACCGGTAT	NA	NA	NA	NA
>prophage 3
CP034176	Bacillus velezensis strain MH25 chromosome, complete genome	4118468	1158279	1191856	4118468	tRNA,coat	Planktothrix_phage(16.67%)	37	NA	NA
AZI46460.1|1158279_1159272_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AZI46461.1|1160015_1161650_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZI46462.1|1161756_1162692_+	ABC transporter permease	NA	NA	NA	NA	NA
AZI46463.1|1162695_1163613_+	ABC transporter permease	NA	NA	NA	NA	NA
AZI46464.1|1163625_1164702_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
AZI46465.1|1164694_1165612_+	ATP-binding cassette domain-containing protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
AZI46466.1|1165718_1166906_+	GTP-binding protein	NA	NA	NA	NA	NA
AZI46467.1|1167023_1167602_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZI46468.1|1167780_1168176_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AZI46469.1|1168233_1168890_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	7.6e-31
AZI46470.1|1169165_1169822_+	adaptor protein MecA	NA	NA	NA	NA	NA
AZI46471.1|1169972_1171133_+	competence protein CoiA	NA	NA	NA	NA	NA
AZI49243.1|1171360_1173190_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AZI46472.1|1173680_1174583_-	DsbA family protein	NA	NA	NA	NA	NA
AZI46473.1|1174579_1174978_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
AZI46474.1|1175206_1175893_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	71.2	7.9e-39
AZI46475.1|1175897_1176470_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AZI46476.1|1176594_1176960_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46477.1|1176987_1177623_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AZI46478.1|1177640_1178441_+	NAD kinase	NA	NA	NA	NA	NA
AZI46479.1|1178455_1179349_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.3	1.4e-06
AZI46480.1|1179382_1180132_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.4	9.9e-11
AZI46481.1|1180350_1182195_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AZI49244.1|1182444_1183152_+	thiaminase II	NA	NA	NA	NA	NA
AZI46482.1|1183129_1183747_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
AZI46483.1|1183730_1184840_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
AZI46484.1|1184836_1185040_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AZI46485.1|1185036_1185807_+	thiazole synthase	NA	NA	NA	NA	NA
AZI46486.1|1185803_1186814_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
AZI46487.1|1186836_1187649_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AZI46488.1|1187779_1188556_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AZI46489.1|1188653_1189241_+|coat	spore coat protein	coat	NA	NA	NA	NA
AZI46490.1|1189299_1189743_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZI46491.1|1189891_1190374_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZI46492.1|1190524_1191025_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZI46493.1|1191117_1191432_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZI46494.1|1191469_1191856_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 4
CP034176	Bacillus velezensis strain MH25 chromosome, complete genome	4118468	1204060	1278723	4118468	tail,capsid,tRNA,portal,plate,holin,terminase	Bacillus_phage(34.21%)	84	NA	NA
AZI46510.1|1204060_1204396_-|tRNA	tRNA-Val4	tRNA	NA	NA	NA	NA
AZI46511.1|1204417_1206256_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	59.9	4.2e-127
AZI46512.1|1206776_1207139_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46513.1|1207429_1207816_+	VOC family protein	NA	NA	NA	NA	NA
AZI46514.1|1208163_1209084_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.5	2.7e-58
AZI46515.1|1209205_1209487_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AZI46516.1|1209586_1210999_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AZI46517.1|1211141_1211615_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZI46518.1|1211900_1213013_-	arabinogalactan endo-1,4-beta-galactosidase	NA	NA	NA	NA	NA
AZI46519.1|1213064_1214564_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AZI46520.1|1214565_1215558_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	36.3	5.1e-47
AZI46521.1|1215561_1216731_-	galactokinase	NA	NA	NA	NA	NA
AZI46522.1|1216746_1218444_-	PTS lactose transporter subunit IIBC	NA	NA	NA	NA	NA
AZI46523.1|1218455_1218770_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AZI46524.1|1218833_1220234_-	6-phospho-beta-galactosidase	NA	NA	NA	NA	NA
AZI46525.1|1220486_1221284_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AZI46526.1|1221264_1221948_+	HAD family phosphatase	NA	NA	NA	NA	NA
AZI46527.1|1222143_1222491_-	DUF3147 family protein	NA	NA	NA	NA	NA
AZI46528.1|1222474_1222900_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZI46529.1|1222883_1223123_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46530.1|1223261_1223897_+	methyltransferase	NA	G3MA03	Bacillus_virus	50.4	6.2e-22
AZI46531.1|1223941_1224124_-	hypothetical protein	NA	NA	NA	NA	NA
AZI46532.1|1224794_1225364_-	DUF4309 domain-containing protein	NA	NA	NA	NA	NA
AZI46533.1|1225488_1228446_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
AZI46534.1|1228438_1228981_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AZI46535.1|1229188_1230406_+	cytochrome P450	NA	NA	NA	NA	NA
AZI46536.1|1230405_1231590_+	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	30.2	7.3e-08
AZI46537.1|1231632_1231818_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	75.9	2.6e-21
AZI46538.1|1231993_1232812_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AZI46539.1|1232837_1233599_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AZI46540.1|1233600_1234338_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	32.1	2.7e-16
AZI46541.1|1234364_1235348_-	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
AZI46542.1|1235477_1235975_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AZI46543.1|1236361_1236778_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AZI46544.1|1236817_1237996_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AZI46545.1|1238181_1239579_+	glucuronate isomerase	NA	NA	NA	NA	NA
AZI46546.1|1239602_1240988_+	MFS transporter	NA	NA	NA	NA	NA
AZI46547.1|1241064_1242063_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZI46548.1|1242138_1243584_+	tagaturonate reductase	NA	NA	NA	NA	NA
AZI46549.1|1243580_1245074_+	altronate dehydratase	NA	NA	NA	NA	NA
AZI46550.1|1245107_1245872_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AZI46551.1|1246016_1246484_-	hypothetical protein	NA	NA	NA	NA	NA
AZI46552.1|1246689_1247826_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
AZI46553.1|1248092_1249046_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
AZI46554.1|1249083_1249461_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
AZI46555.1|1249570_1250176_+	hypothetical protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	1.0e-42
AZI46556.1|1250165_1250387_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46557.1|1250294_1250885_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
AZI46558.1|1251033_1251372_-	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
AZI46559.1|1251562_1251742_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46560.1|1251731_1252559_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.0	2.2e-19
AZI46561.1|1252458_1253259_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.3	3.0e-58
AZI46562.1|1253523_1253865_+|portal	phage portal protein	portal	NA	NA	NA	NA
AZI46563.1|1253854_1254058_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	51.5	1.4e-12
AZI46564.1|1254171_1254684_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	3.8e-22
AZI46565.1|1254796_1255594_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	49.8	1.6e-59
AZI46566.1|1255590_1256889_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.2	7.2e-150
AZI49245.1|1256937_1258329_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	3.0e-138
AZI46567.1|1258348_1259194_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.6	9.7e-55
AZI46568.1|1259220_1260156_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
AZI46569.1|1260172_1260556_+	DUF3199 family protein	NA	NA	NA	NA	NA
AZI46570.1|1260552_1260909_+	DUF3599 family protein	NA	NA	NA	NA	NA
AZI46571.1|1260905_1261409_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.1	2.1e-36
AZI46572.1|1261405_1261852_+|portal	phage portal protein	portal	NA	NA	NA	NA
AZI46573.1|1261848_1262058_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46574.1|1262057_1263455_+|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	40.4	9.0e-82
AZI46575.1|1263456_1263900_+|portal	phage portal protein	portal	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
AZI46576.1|1263976_1264423_+|portal	phage portal protein	portal	A0A0K2CNS3	Brevibacillus_phage	35.8	1.0e-10
AZI49246.1|1264464_1264617_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46577.1|1264604_1269893_+|portal	phage portal protein	portal	A0A1L2JY60	Aeribacillus_phage	46.6	2.0e-41
AZI46578.1|1269885_1270545_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
AZI46579.1|1270558_1271536_+|portal	phage portal protein	portal	A0A1L6BY20	Clostridium_phage	30.9	2.9e-34
AZI46580.1|1271535_1271802_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
AZI49248.1|1271905_1272331_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	2.5e-11
AZI49247.1|1272323_1273370_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.1	1.3e-69
AZI46581.1|1273353_1273932_+	DUF2313 domain-containing protein	NA	A0A0A7RTT8	Clostridium_phage	28.9	3.1e-12
AZI46582.1|1273928_1274201_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46583.1|1274203_1275835_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	33.5	1.6e-53
AZI46584.1|1275847_1276219_+	hypothetical protein	NA	NA	NA	NA	NA
AZI46585.1|1276223_1276421_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	63.6	2.5e-14
AZI46586.1|1276477_1277239_+|portal	phage portal protein	portal	NA	NA	NA	NA
AZI46587.1|1277290_1277554_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
AZI46588.1|1277567_1277831_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
AZI46589.1|1277844_1278723_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.2	1.1e-80
>prophage 5
CP034176	Bacillus velezensis strain MH25 chromosome, complete genome	4118468	1833121	1839335	4118468		Bacillus_phage(50.0%)	7	NA	NA
AZI47037.1|1833121_1833514_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
AZI47038.1|1833473_1835576_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
AZI47039.1|1835593_1836583_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
AZI47040.1|1836631_1837252_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	2.1e-46
AZI47041.1|1837301_1838060_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	4.8e-53
AZI47042.1|1838093_1838318_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47043.1|1838366_1839335_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 6
CP034176	Bacillus velezensis strain MH25 chromosome, complete genome	4118468	2101139	2140173	4118468	tail,capsid,integrase,protease,portal,head,holin,terminase	Bacillus_phage(89.47%)	49	2100375:2100389	2140745:2140759
2100375:2100389	attL	TCAGACATGGTTTGA	NA	NA	NA	NA
AZI47227.1|2101139_2102252_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	96.8	2.5e-204
AZI47228.1|2102552_2104205_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	48.0	6.7e-68
AZI47229.1|2104201_2104633_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AZI47230.1|2104791_2105541_+	hypothetical protein	NA	NA	NA	NA	NA
AZI47231.1|2105596_2106499_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	92.7	6.3e-161
AZI47232.1|2106546_2106969_-|holin	holin family protein	holin	D6R405	Bacillus_phage	100.0	4.7e-66
AZI47233.1|2107020_2107209_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	100.0	3.7e-31
AZI47234.1|2107205_2107568_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	90.8	7.1e-55
AZI47235.1|2107564_2108842_-	DUF2479 domain-containing protein	NA	D6R402	Bacillus_phage	82.6	1.6e-154
AZI47236.1|2108858_2111420_-	peptidase G2	NA	D6R401	Bacillus_phage	97.3	0.0e+00
AZI47237.1|2111459_2113163_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	98.8	1.4e-310
AZI47238.1|2113174_2114014_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	93.2	1.4e-151
AZI47239.1|2114013_2117889_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	97.6	0.0e+00
AZI47240.1|2118089_2118428_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	92.0	1.1e-52
AZI47241.1|2118483_2119092_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	91.0	4.4e-102
AZI47242.1|2119092_2119473_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	93.7	1.0e-59
AZI47243.1|2119469_2119853_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	98.4	2.5e-66
AZI47244.1|2119845_2120205_-|head,tail	head-tail adaptor protein	head,tail	Q9ZXF2	Bacillus_phage	96.6	8.0e-59
AZI47245.1|2120137_2120485_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	97.4	1.3e-58
AZI47246.1|2120499_2120955_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	74.6	6.4e-37
AZI47247.1|2120982_2121291_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	93.9	2.4e-43
AZI47248.1|2121305_2122508_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	73.6	4.9e-161
AZI47249.1|2122547_2123174_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	97.6	5.4e-111
AZI47250.1|2123163_2124414_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	98.8	3.1e-243
AZI47251.1|2124419_2124650_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	80.3	1.1e-21
AZI47252.1|2124661_2126371_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	97.2	0.0e+00
AZI47253.1|2126370_2126904_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	80.2	8.2e-68
AZI47254.1|2126990_2127317_-	transglycosylase	NA	Q9T203	Bacillus_phage	94.4	9.2e-54
AZI47255.1|2127285_2127660_-	HNH endonuclease	NA	Q38456	Bacillus_phage	94.4	8.9e-69
AZI47256.1|2127793_2128900_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47257.1|2129041_2130013_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AZI47258.1|2130253_2130466_-	DNA-binding protein	NA	A0A1Z1LZP5	Bacillus_phage	51.4	2.1e-11
AZI49257.1|2130473_2130665_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47259.1|2131005_2131521_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2MVE1	Bacillus_phage	35.8	1.6e-23
AZI47260.1|2131741_2131942_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47261.1|2131962_2132172_-	hypothetical protein	NA	A0A0U4B0C8	Bacillus_phage	43.5	3.4e-09
AZI47262.1|2132161_2133490_-	replicative DNA helicase	NA	W8EEZ1	Geobacillus_phage	56.2	3.9e-135
AZI47263.1|2133491_2133848_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47264.1|2133840_2134632_-	Replication protein O	NA	A0A0S2GLI6	Bacillus_phage	48.2	1.9e-28
AZI49258.1|2134643_2135012_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47265.1|2135173_2136019_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47266.1|2136031_2136679_-	DNA-binding protein	NA	A0A288WFT2	Bacillus_phage	39.7	1.2e-36
AZI47267.1|2136669_2136978_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47268.1|2136964_2137246_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	39.5	2.0e-12
AZI47269.1|2137440_2137713_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47270.1|2137699_2137900_-	helix-turn-helix domain-containing protein	NA	A0A0M3ULF9	Bacillus_phage	63.9	7.4e-14
AZI47271.1|2138172_2138478_+	XRE family transcriptional regulator	NA	Q8W5Y0	Listeria_phage	49.5	5.8e-18
AZI47272.1|2138492_2138957_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	51.6	3.1e-39
AZI47273.1|2139024_2140173_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	32.2	2.4e-32
2140745:2140759	attR	TCAAACCATGTCTGA	NA	NA	NA	NA
>prophage 7
CP034176	Bacillus velezensis strain MH25 chromosome, complete genome	4118468	2174463	2187436	4118468		Bacillus_phage(90.91%)	15	NA	NA
AZI47313.1|2174463_2174889_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI8	Catovirus	35.6	2.7e-13
AZI47314.1|2174922_2175099_-	hypothetical protein	NA	O64196	Bacillus_phage	93.1	6.5e-22
AZI49263.1|2175101_2175296_-	hypothetical protein	NA	O64195	Bacillus_phage	70.0	3.8e-15
AZI47315.1|2175461_2175815_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
AZI47316.1|2176269_2176506_+	hypothetical protein	NA	NA	NA	NA	NA
AZI47317.1|2176631_2177006_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.0	9.0e-29
AZI47318.1|2177239_2177692_-	hypothetical protein	NA	O64117	Bacillus_phage	77.3	4.8e-61
AZI47319.1|2178059_2179196_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	75.9	1.0e-163
AZI47320.1|2179185_2179368_+	hypothetical protein	NA	NA	NA	NA	NA
AZI47321.1|2180405_2180744_-	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	60.2	3.8e-26
AZI47322.1|2181502_2182099_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	82.4	7.5e-86
AZI47323.1|2182100_2183852_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	68.0	6.6e-231
AZI49264.1|2183888_2184323_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AZI47324.1|2184587_2185553_+	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	75.0	5.5e-78
AZI47325.1|2185768_2187436_+	recombinase family protein	NA	O64015	Bacillus_phage	91.2	4.9e-276
>prophage 8
CP034176	Bacillus velezensis strain MH25 chromosome, complete genome	4118468	2221376	2288193	4118468	tail,capsid,integrase,coat,protease,tRNA,portal,head,plate,holin,terminase	Bacillus_phage(39.02%)	78	2239430:2239448	2279123:2279141
AZI47369.1|2221376_2221826_+	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	38.3	1.2e-24
AZI47370.1|2221857_2223549_+	hypothetical protein	NA	NA	NA	NA	NA
AZI47371.1|2223729_2224422_+	hypothetical protein	NA	NA	NA	NA	NA
AZI47372.1|2224516_2226007_-	glycosyltransferase	NA	A0A1V0SGA9	Hokovirus	31.5	9.5e-05
AZI47373.1|2226129_2227290_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	66.7	1.0e-70
AZI47374.1|2227335_2227758_-|holin	holin	holin	D6R405	Bacillus_phage	87.2	4.2e-59
AZI47375.1|2227809_2227995_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	70.5	1.7e-20
AZI47376.1|2227994_2228357_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	58.0	1.7e-29
AZI47377.1|2228353_2230177_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	37.7	1.3e-80
AZI47378.1|2230191_2232756_-	peptidase G2	NA	D6R401	Bacillus_phage	79.8	0.0e+00
AZI47379.1|2232809_2234513_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	57.7	9.3e-182
AZI47380.1|2234527_2235367_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.3	1.5e-92
AZI47381.1|2235360_2239848_-|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	42.0	1.4e-64
2239430:2239448	attL	TTTTTAAAAACAGAAAAAA	NA	NA	NA	NA
AZI47382.1|2240044_2240422_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47383.1|2240483_2241092_-|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	35.5	3.7e-24
AZI47384.1|2241106_2241490_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AZI47385.1|2241486_2241885_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47386.1|2241881_2242199_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JCB1	uncultured_Caudovirales_phage	37.3	3.8e-12
AZI47387.1|2242188_2242491_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	45.2	2.8e-12
AZI47388.1|2242508_2242925_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	50.6	1.7e-12
AZI49266.1|2242947_2244240_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	48.1	3.1e-92
AZI47389.1|2244278_2244905_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	77.7	2.5e-84
AZI47390.1|2244867_2246148_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	62.6	3.6e-154
AZI47391.1|2246336_2248046_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	63.1	1.7e-207
AZI47392.1|2248042_2248558_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	42.3	9.2e-32
AZI47393.1|2248783_2249149_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	54.2	2.3e-29
AZI47394.1|2249443_2249995_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47395.1|2250012_2250945_-	hypothetical protein	NA	A0A1L2JY39	Aeribacillus_phage	27.3	1.3e-15
AZI47396.1|2251081_2251294_-	DNA-binding protein	NA	A0A1Z1LZP5	Bacillus_phage	43.9	2.9e-08
AZI47397.1|2251286_2251469_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47398.1|2251844_2252057_-	DNA-binding protein	NA	A0A1Z1LZP5	Bacillus_phage	52.9	9.6e-12
AZI47399.1|2252064_2252256_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47400.1|2252597_2253113_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.2	3.0e-27
AZI47401.1|2253131_2253317_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47402.1|2253484_2254345_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47403.1|2254576_2254834_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	38.0	1.6e-05
AZI47404.1|2254869_2255073_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	70.3	2.8e-21
AZI47405.1|2255370_2255799_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	65.0	8.7e-44
AZI47406.1|2256034_2256982_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	50.2	2.4e-54
AZI47407.1|2256866_2257568_-	DnaD domain protein	NA	NA	NA	NA	NA
AZI47408.1|2257577_2257769_-	hypothetical protein	NA	NA	NA	NA	NA
AZI49267.1|2257768_2258506_-	hypothetical protein	NA	A0A2P1JU03	Anoxybacillus_phage	42.4	6.3e-42
AZI47409.1|2258525_2259446_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	64.0	4.5e-90
AZI47410.1|2259442_2259631_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47411.1|2259925_2260183_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	39.8	1.1e-09
AZI47412.1|2260179_2260752_-	transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	56.9	4.7e-61
AZI47413.1|2260809_2261538_-	phage regulatory protein	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	68.7	6.1e-90
AZI47414.1|2261534_2261849_-	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	49.3	1.9e-11
AZI47415.1|2261861_2262080_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZI47416.1|2262232_2262610_+	helix-turn-helix domain-containing protein	NA	A0A0A7RTK4	Clostridium_phage	45.3	1.1e-10
AZI47417.1|2262973_2264170_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	43.9	4.2e-80
AZI47418.1|2264213_2265518_-	purine permease	NA	NA	NA	NA	NA
AZI47419.1|2265514_2266099_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AZI47420.1|2266431_2267934_-	carboxypeptidase M32	NA	NA	NA	NA	NA
AZI47421.1|2268045_2269965_-	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	21.8	1.8e-11
AZI47422.1|2270068_2270260_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47423.1|2270425_2270578_+	YpzG family protein	NA	NA	NA	NA	NA
AZI47424.1|2270618_2271785_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
AZI47425.1|2272318_2272618_-	cell division regulator GpsB	NA	NA	NA	NA	NA
AZI47426.1|2272697_2273246_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
AZI47427.1|2273334_2273571_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZI47428.1|2273654_2273750_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47429.1|2273883_2275122_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47430.1|2275141_2277388_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	27.3	9.6e-09
AZI47431.1|2277486_2277993_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AZI47432.1|2278131_2278545_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AZI47433.1|2278574_2279009_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZI47434.1|2279195_2279378_+	hypothetical protein	NA	NA	NA	NA	NA
2279123:2279141	attR	TTTTTAAAAACAGAAAAAA	NA	NA	NA	NA
AZI47435.1|2279416_2279785_-	DUF1798 family protein	NA	NA	NA	NA	NA
AZI47436.1|2279830_2280076_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47437.1|2280281_2280386_+	spore protein	NA	NA	NA	NA	NA
AZI47438.1|2280429_2281392_-	DUF2515 domain-containing protein	NA	NA	NA	NA	NA
AZI47439.1|2281433_2282042_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	34.9	2.0e-22
AZI47440.1|2282080_2284864_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
AZI47441.1|2284941_2285433_-	hypothetical protein	NA	NA	NA	NA	NA
AZI47442.1|2285429_2286089_-	endonuclease III	NA	NA	NA	NA	NA
AZI47443.1|2286107_2286806_-	DnaD domain protein	NA	NA	NA	NA	NA
AZI47444.1|2286900_2288193_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.5	7.9e-56
>prophage 9
CP034176	Bacillus velezensis strain MH25 chromosome, complete genome	4118468	2366419	2372672	4118468		Staphylococcus_phage(66.67%)	10	NA	NA
AZI47525.1|2366419_2367013_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
AZI47526.1|2367002_2367758_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.9e-10
AZI47527.1|2367965_2368055_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
AZI47528.1|2368142_2368664_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AZI47529.1|2368608_2368824_+	hypothetical protein	NA	NA	NA	NA	NA
AZI47530.1|2368729_2369104_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
AZI47531.1|2369220_2369685_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
AZI47532.1|2369717_2370914_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	1.6e-116
AZI47533.1|2370928_2371576_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
AZI47534.1|2371556_2372672_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	1.3e-54
>prophage 10
CP034176	Bacillus velezensis strain MH25 chromosome, complete genome	4118468	3036852	3144675	4118468	tail,capsid,integrase,protease,portal,transposase,holin	Bacillus_phage(43.48%)	121	3076114:3076159	3144814:3144859
AZI48136.1|3036852_3037257_-|holin	holin family protein	holin	NA	NA	NA	NA
AZI48137.1|3037408_3037846_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	2.2e-47
AZI48138.1|3037970_3038120_+	YtzI protein	NA	NA	NA	NA	NA
AZI48139.1|3038116_3038560_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48140.1|3038674_3039148_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AZI48141.1|3039273_3039501_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	66.2	6.9e-24
AZI48142.1|3039497_3040067_-	carbonic anhydrase	NA	NA	NA	NA	NA
AZI48143.1|3040185_3040434_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
AZI48144.1|3040631_3041963_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AZI48145.1|3041985_3043026_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AZI48146.1|3043083_3043242_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
AZI48147.1|3043627_3044743_-	o-succinylbenzoate synthase	NA	Q6A202	Oenococcus_phage	22.2	1.9e-13
AZI48148.1|3044739_3046203_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	34.9	1.0e-75
AZI48149.1|3046290_3047109_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
AZI48150.1|3047167_3047992_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AZI48151.1|3047979_3049716_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
AZI48152.1|3049712_3051128_-	isochorismate synthase	NA	NA	NA	NA	NA
AZI48153.1|3051410_3052130_+	yteA family sporulation protein	NA	NA	NA	NA	NA
AZI48154.1|3052286_3052757_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
AZI48155.1|3060149_3060731_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
AZI48156.1|3060761_3062291_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.5	2.1e-07
AZI48157.1|3062310_3062841_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48158.1|3062987_3063494_+	DinB family protein	NA	NA	NA	NA	NA
AZI48159.1|3063513_3064664_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.7	2.3e-38
AZI48160.1|3064764_3065346_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AZI48161.1|3065417_3066626_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
AZI48162.1|3066643_3068116_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AZI48163.1|3068316_3068871_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZI48164.1|3069030_3069570_+	hypothetical protein	NA	NA	NA	NA	NA
AZI48165.1|3069733_3070402_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
AZI48166.1|3070435_3071281_-	GW domain-containing glycosaminoglycan-binding protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	1.1e-26
AZI48167.1|3071422_3072598_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AZI48168.1|3072815_3073457_+	cupin domain-containing protein	NA	NA	NA	NA	NA
3076114:3076159	attL	GTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGC	NA	NA	NA	NA
AZI48169.1|3076300_3077092_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	30.5	8.9e-18
AZI48170.1|3077251_3077464_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZI48171.1|3077509_3077845_+	YolD-like family protein	NA	O64030	Bacillus_phage	34.7	4.4e-11
AZI48172.1|3077860_3078421_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48173.1|3078513_3078771_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	5.0e-23
AZI49296.1|3078792_3079731_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	62.0	5.6e-96
AZI48174.1|3079812_3080022_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
AZI48175.1|3080025_3080214_-	XkdX family protein	NA	NA	NA	NA	NA
AZI48176.1|3080214_3080484_-	hypothetical protein	NA	NA	NA	NA	NA
AZI49297.1|3080498_3082049_-	DUF2479 domain-containing protein	NA	M4ZRP1	Bacillus_phage	54.5	6.1e-55
AZI48177.1|3082094_3084659_-	peptidase G2	NA	D6R401	Bacillus_phage	73.7	0.0e+00
AZI48178.1|3084673_3086074_-	endopeptidase	NA	A6M966	Geobacillus_virus	31.2	8.6e-40
AZI48179.1|3086085_3087510_-|tail	phage tail protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	44.7	1.6e-62
AZI48180.1|3087516_3089739_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	36.7	1.0e-55
AZI48181.1|3089918_3090680_-	hypothetical protein	NA	A0A1W6JL91	Lactococcus_phage	36.5	9.4e-41
AZI48182.1|3090780_3091389_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	42.2	7.0e-31
AZI49298.1|3091389_3091626_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48183.1|3091721_3092093_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48184.1|3092150_3092705_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
AZI48185.1|3092729_3093119_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48186.1|3093125_3093533_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	54.4	1.0e-30
AZI49299.1|3093529_3093850_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48187.1|3093865_3094252_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.8	2.1e-20
AZI48188.1|3094266_3094485_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48189.1|3094793_3095897_-	hypothetical protein	NA	A0A2I7S650	Vibrio_phage	27.6	7.5e-31
AZI48190.1|3095908_3096580_-|protease	Clp protease ClpB	protease	A0A2H4IZP8	uncultured_Caudovirales_phage	46.0	7.8e-15
AZI48191.1|3096670_3097495_-|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	45.4	2.2e-59
AZI48192.1|3097494_3099126_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	57.6	9.0e-166
AZI48193.1|3099128_3099560_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	50.4	3.8e-31
AZI48194.1|3099576_3101331_-	hypothetical protein	NA	A0A2H4J484	uncultured_Caudovirales_phage	71.6	5.7e-251
AZI48195.1|3101413_3101962_+|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.1	1.2e-37
AZI48196.1|3102159_3102450_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48197.1|3103123_3103390_-	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	55.2	2.1e-19
AZI48198.1|3104794_3105820_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	45.2	8.5e-13
AZI48199.1|3105918_3106143_-	XRE family transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	74.4	9.5e-10
AZI48200.1|3106273_3107071_+	hypothetical protein	NA	O64134	Bacillus_phage	47.3	8.3e-56
AZI48201.1|3107070_3108834_+	right-handed parallel beta-helix repeat-containing protein	NA	F8WPS8	Bacillus_phage	47.7	1.8e-148
AZI48202.1|3109195_3109399_+	hypothetical protein	NA	NA	NA	NA	NA
AZI48203.1|3109504_3109942_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	68.8	9.8e-51
AZI48204.1|3110071_3110251_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	81.4	1.3e-22
AZI48205.1|3110265_3110622_+	hypothetical protein	NA	NA	NA	NA	NA
AZI48206.1|3110713_3111523_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	61.2	1.1e-95
AZI48207.1|3111666_3112467_-	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	53.5	3.8e-69
AZI48208.1|3112554_3113106_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	46.1	2.1e-18
AZI48209.1|3113035_3113425_-	RNA polymerase subunit sigma	NA	A0A0N9RZI0	Paenibacillus_phage	45.0	5.7e-18
AZI48210.1|3113494_3113884_+	hypothetical protein	NA	NA	NA	NA	NA
AZI48211.1|3113856_3114309_-	hypothetical protein	NA	A0A1P8CX13	Bacillus_phage	60.7	5.9e-43
AZI48212.1|3114196_3115033_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8CX13	Bacillus_phage	89.9	2.5e-87
AZI48213.1|3115029_3115602_-	dephospho-CoA kinase	NA	M4HPU2	Bacillus_phage	38.2	1.4e-33
AZI48214.1|3115696_3116527_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	44.3	1.9e-26
AZI48215.1|3116732_3116993_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48216.1|3117007_3117631_-	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	60.8	3.7e-27
AZI49300.1|3117600_3118386_-	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	68.1	5.2e-87
AZI48217.1|3118401_3118623_-	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	94.5	2.4e-34
AZI48218.1|3118623_3119169_-	hypothetical protein	NA	U5Q1E8	Bacillus_phage	45.9	1.1e-27
AZI48219.1|3119104_3119611_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	58.0	1.4e-45
AZI49301.1|3119716_3120682_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	78.0	1.3e-143
AZI48220.1|3120861_3122961_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	80.8	0.0e+00
AZI48221.1|3122950_3123307_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	54.2	4.2e-28
AZI48222.1|3123500_3123686_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48223.1|3123682_3123928_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48224.1|3123932_3124295_-	DUF1523 domain-containing protein	NA	A0A140HLL8	Bacillus_phage	36.0	8.2e-11
AZI48225.1|3124294_3124843_-	hypothetical protein	NA	A0A2H4IZL3	uncultured_Caudovirales_phage	43.5	1.2e-32
AZI48226.1|3124824_3125145_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48227.1|3125144_3126203_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	52.3	3.3e-76
AZI48228.1|3126203_3128453_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	48.4	1.5e-171
AZI48229.1|3130055_3130262_-	hypothetical protein	NA	M5AC00	Bacillus_phage	50.0	1.1e-15
AZI49302.1|3130261_3130696_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48230.1|3130730_3131486_-	single-stranded DNA-binding protein	NA	A0A0N9SJW5	Paenibacillus_phage	50.2	5.1e-55
AZI48231.1|3131723_3132290_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48232.1|3132592_3133264_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48233.1|3133486_3134713_-	hypothetical protein	NA	I7J4K0	Bacillus_phage	30.9	1.2e-42
AZI48234.1|3134826_3135036_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZI48235.1|3135089_3135335_+	XRE family transcriptional regulator	NA	O64102	Bacillus_phage	42.6	1.7e-07
AZI48236.1|3135351_3136347_-	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	46.2	2.3e-71
AZI48237.1|3136481_3137870_-	DNA helicase	NA	A0A0N9SIP5	Paenibacillus_phage	54.2	5.3e-135
AZI48238.1|3137866_3138121_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48239.1|3138117_3138615_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48240.1|3138615_3138927_-	hypothetical protein	NA	F8WPL8	Bacillus_phage	55.0	2.2e-20
AZI48241.1|3138923_3139706_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	54.2	1.0e-74
AZI48242.1|3139725_3139929_-	hypothetical protein	NA	A0A1P8CX62	Bacillus_phage	60.3	5.4e-12
AZI48243.1|3141161_3141512_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48244.1|3141508_3141847_-	hypothetical protein	NA	R4JGJ3	Bacillus_phage	39.5	9.0e-12
AZI48245.1|3141846_3142086_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48246.1|3142082_3142265_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48247.1|3142300_3142624_-	hypothetical protein	NA	A0A0S2MUA3	Bacillus_phage	38.9	7.5e-08
AZI48248.1|3143011_3143431_-	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	58.7	2.7e-34
AZI48249.1|3143616_3144675_-|integrase	integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	26.7	2.2e-16
3144814:3144859	attR	GTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGC	NA	NA	NA	NA
>prophage 11
CP034176	Bacillus velezensis strain MH25 chromosome, complete genome	4118468	3782363	3831612	4118468	protease,coat	Staphylococcus_phage(16.67%)	49	NA	NA
AZI48882.1|3782363_3783023_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AZI48883.1|3783128_3783317_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AZI48884.1|3783354_3783774_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZI48885.1|3784159_3785539_+	amino acid permease	NA	NA	NA	NA	NA
AZI48886.1|3785603_3786104_-	YwgA family protein	NA	NA	NA	NA	NA
AZI48887.1|3786143_3787445_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
AZI48888.1|3787605_3787830_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
AZI48889.1|3788032_3788806_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
AZI49320.1|3789105_3789381_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZI48890.1|3789381_3789936_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
AZI48891.1|3790033_3790954_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.6	1.7e-36
AZI48892.1|3790950_3791904_+	ABC transporter permease	NA	NA	NA	NA	NA
AZI48893.1|3791893_3792730_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48894.1|3792720_3793518_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48895.1|3794458_3794638_-	hypothetical protein	NA	NA	NA	NA	NA
AZI48896.1|3794789_3795653_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
AZI48897.1|3795699_3796599_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
AZI48898.1|3796714_3797692_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AZI48899.1|3797729_3798701_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AZI48900.1|3798962_3799727_+	heme-binding protein	NA	NA	NA	NA	NA
AZI48901.1|3799846_3800626_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZI48902.1|3800642_3801842_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AZI48903.1|3801854_3803036_-	MFS transporter	NA	NA	NA	NA	NA
AZI48904.1|3803032_3804451_-	alanine-anticapsin ligase BacD	NA	NA	NA	NA	NA
AZI48905.1|3804468_3805230_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	1.7e-21
AZI48906.1|3805226_3805937_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AZI48907.1|3805926_3806541_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
AZI48908.1|3806702_3807941_-	MFS transporter	NA	NA	NA	NA	NA
AZI48909.1|3808163_3809366_+	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	3.2e-27
AZI48910.1|3809398_3810817_-	amino acid permease	NA	NA	NA	NA	NA
AZI48911.1|3810841_3812524_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
AZI48912.1|3812595_3814143_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZI48913.1|3814351_3815638_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AZI48914.1|3815871_3816807_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	3.7e-23
AZI48915.1|3816808_3817507_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.4	9.2e-35
AZI48916.1|3818584_3819289_-	ABC transporter permease	NA	NA	NA	NA	NA
AZI48917.1|3819353_3820280_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.9	1.1e-43
AZI49321.1|3820628_3821084_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZI48918.1|3821080_3821929_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	5.4e-37
AZI48919.1|3821949_3822897_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	5.9e-69
AZI48920.1|3822899_3823637_-	glucose-1-phosphate thymidylyltransferase	NA	G3MA50	Bacillus_virus	42.3	6.5e-47
AZI48921.1|3823664_3824669_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZI48922.1|3824670_3825414_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZI48923.1|3825403_3826525_-|coat	spore coat protein	coat	NA	NA	NA	NA
AZI48924.1|3826524_3827388_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZI48925.1|3827388_3828558_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
AZI48926.1|3828580_3830005_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
AZI48927.1|3830009_3830780_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
AZI48928.1|3831060_3831612_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
