The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034179	Novosphingobium tardaugens NBRC 16725 chromosome, complete genome	4358096	813101	923830	4358096	transposase,integrase	Streptococcus_phage(36.84%)	80	815293:815329	840198:840234
AZI35198.1|813101_814262_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
815293:815329	attL	TTACCCCTTGCAGCGCAGGGGCCATCCACAGATGACA	NA	NA	NA	NA
AZI35199.1|815336_817775_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZI35200.1|817814_819188_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
AZI35201.1|819263_819953_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZI35202.1|820838_822006_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZI35203.1|822298_823189_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZI35204.1|823347_824175_+	sterol desaturase family protein	NA	NA	NA	NA	NA
AZI35205.1|824455_825088_-|integrase	integrase	integrase	A0A0A8WE94	Clostridium_phage	30.9	2.4e-10
AZI35206.1|825297_826110_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
AZI38117.1|826966_828496_-	hypothetical protein	NA	NA	NA	NA	NA
AZI35207.1|828552_829836_-	ATP-binding protein	NA	NA	NA	NA	NA
AZI35208.1|829832_833897_-	hypothetical protein	NA	NA	NA	NA	NA
AZI35209.1|833893_835081_-	ATP-binding protein	NA	NA	NA	NA	NA
AZI35210.1|835325_835877_-	transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.3	8.6e-20
AZI35211.1|836134_837796_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	48.9	1.0e-87
AZI35212.1|837792_838221_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	34.7	6.5e-15
AZI35213.1|838217_838649_-	DUF3489 domain-containing protein	NA	NA	NA	NA	NA
AZI35214.1|839028_840153_+	Fic family protein	NA	NA	NA	NA	NA
AZI35215.1|840320_841028_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	31.6	5.5e-19
840198:840234	attR	TTACCCCTTGCAGCGCAGGGGCCATCCACAGATGACA	NA	NA	NA	NA
AZI35216.1|841158_842247_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AZI35217.1|842668_843400_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZI35218.1|846455_848744_+	arylsulfatase	NA	NA	NA	NA	NA
AZI35219.1|848791_851146_+	arylsulfatase	NA	NA	NA	NA	NA
AZI38118.1|851197_852288_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.6	6.9e-53
AZI35220.1|852833_853541_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	30.7	3.8e-20
AZI35221.1|853636_854158_+	hypothetical protein	NA	NA	NA	NA	NA
AZI35222.1|854808_855516_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	31.6	5.5e-19
AZI35223.1|855658_856681_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZI35224.1|856982_857516_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZI35225.1|857803_858541_+	flavodoxin family protein	NA	NA	NA	NA	NA
AZI35226.1|858614_859409_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	3.7e-16
AZI35227.1|859405_860485_+	nitronate monooxygenase	NA	NA	NA	NA	NA
AZI35228.1|860481_861267_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZI35229.1|861283_862054_+	enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
AZI35230.1|862050_862836_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZI35231.1|862845_863694_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AZI35232.1|864253_864457_-	hypothetical protein	NA	NA	NA	NA	NA
AZI35233.1|864536_866690_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZI35234.1|866831_869153_-	arylsulfatase	NA	NA	NA	NA	NA
AZI35235.1|869648_870371_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	32.1	1.1e-19
AZI35236.1|870375_871083_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
AZI35237.1|871007_871895_-	hypothetical protein	NA	NA	NA	NA	NA
AZI35238.1|872311_872875_-	transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	46.5	1.5e-19
AZI35239.1|873132_874794_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	48.7	5.9e-88
AZI35240.1|874790_875219_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	34.7	5.0e-15
AZI35241.1|875215_875647_-	DUF3489 domain-containing protein	NA	NA	NA	NA	NA
AZI35242.1|876016_877399_-	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
AZI35243.1|877607_878129_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	58.1	3.3e-29
AZI35244.1|878629_884236_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
AZI35245.1|884502_884922_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AZI35246.1|884928_885297_-|transposase	transposase	transposase	NA	NA	NA	NA
AZI35247.1|886181_886889_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	31.6	5.5e-19
AZI38119.1|887622_888723_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AZI35248.1|888966_889485_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AZI35249.1|889521_890076_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AZI35250.1|890119_891475_-	phosphotransferase family protein	NA	NA	NA	NA	NA
AZI38120.1|891471_892398_-	hypothetical protein	NA	NA	NA	NA	NA
AZI35251.1|892637_893375_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZI35252.1|893458_894511_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZI35253.1|894507_895416_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AZI35254.1|895447_897811_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZI35255.1|898085_898793_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	31.2	1.4e-19
AZI35256.1|899018_900041_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZI35257.1|900570_901338_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZI35258.1|901582_902665_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZI35259.1|903111_905622_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZI35260.1|906518_907244_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZI35261.1|907300_908326_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.3	6.3e-16
AZI35262.1|908780_909740_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZI35263.1|910690_911719_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZI35264.1|911852_912191_+	hypothetical protein	NA	NA	NA	NA	NA
AZI35265.1|912183_912837_+	Dabb family protein	NA	NA	NA	NA	NA
AZI38121.1|912934_913915_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AZI35266.1|914601_915363_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZI35267.1|915714_918225_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZI35268.1|918337_919648_-	class A beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AZI35269.1|919629_920589_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZI35270.1|921051_921615_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZI35271.1|921822_922740_+	SGNH/GDSL hydrolase family protein	NA	A0A160DD06	Gordonia_phage	26.9	3.9e-09
AZI35272.1|923122_923830_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	31.1	2.1e-18
>prophage 3
CP034179	Novosphingobium tardaugens NBRC 16725 chromosome, complete genome	4358096	3638890	3668122	4358096	transposase	Hokovirus(50.0%)	18	NA	NA
AZI37484.1|3638890_3640147_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AZI37485.1|3641132_3641360_+	hypothetical protein	NA	NA	NA	NA	NA
AZI37486.1|3641484_3642741_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AZI37487.1|3642919_3644176_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AZI37488.1|3644354_3645611_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AZI37489.1|3645789_3647046_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AZI37490.1|3647594_3649976_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.4	3.3e-169
AZI37491.1|3650272_3651286_+	universal stress protein	NA	NA	NA	NA	NA
AZI37492.1|3651289_3659701_+	cellobiose phosphorylase	NA	NA	NA	NA	NA
AZI37493.1|3659812_3660049_+	hypothetical protein	NA	NA	NA	NA	NA
AZI37494.1|3660103_3660430_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
AZI37495.1|3660502_3662059_-	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AZI37496.1|3662063_3662558_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AZI37497.1|3663101_3664925_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SL97	Klosneuvirus	36.1	1.8e-18
AZI37498.1|3664914_3665529_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AZI37499.1|3665591_3666023_+	response regulator	NA	NA	NA	NA	NA
AZI37500.1|3666070_3666481_+	globin	NA	NA	NA	NA	NA
AZI37501.1|3667364_3668122_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
