The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022730	Escherichia coli strain SA186 chromosome, complete genome	4828837	359567	447815	4828837	capsid,transposase,portal,holin,terminase,integrase,plate,tail,tRNA,head	Escherichia_phage(21.74%)	108	405266:405325	447877:448001
AZH85510.1|359567_360290_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	54.4	1.6e-69
AZH85511.1|360394_360916_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZH85512.1|361025_362036_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AZH85513.1|362044_362656_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AZH89615.1|362794_362860_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85514.1|362930_363533_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85515.1|363534_364056_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AZH85516.1|364090_364831_-	transcriptional regulator	NA	NA	NA	NA	NA
AZH85517.1|364859_365312_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AZH85518.1|365304_367077_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AZH85519.1|367386_367953_+	hydrolase	NA	NA	NA	NA	NA
AZH85520.1|367949_368768_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
AZH85521.1|368820_369216_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85522.1|369256_370000_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AZH85523.1|369996_370968_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AZH85524.1|371003_373433_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AZH85525.1|373457_374558_-	cytochrome C	NA	NA	NA	NA	NA
AZH85526.1|374945_375692_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AZH89616.1|375705_376272_-	VOC family protein	NA	NA	NA	NA	NA
AZH85527.1|376487_378221_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
AZH85528.1|378273_378666_-	flagellar protein FlhE	NA	NA	NA	NA	NA
AZH85529.1|378665_380744_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AZH85530.1|380736_381885_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
AZH85531.1|382073_382718_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
AZH85532.1|382728_383118_-	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AZH85533.1|383132_384182_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AZH85534.1|384184_385045_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AZH85535.1|385335_386997_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AZH85536.1|387141_387645_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AZH85537.1|387665_389630_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AZH85538.1|389634_390561_-	motility protein MotB	NA	NA	NA	NA	NA
AZH85539.1|390557_391445_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AZH85540.1|391571_392150_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
AZH85541.1|392152_392503_-	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
AZH85542.1|393282_393711_+	universal stress protein UspC	NA	NA	NA	NA	NA
AZH85543.1|393717_395142_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AZH85544.1|395116_395917_-	trehalose-phosphatase	NA	NA	NA	NA	NA
AZH85545.1|396083_397070_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
AZH85546.1|397084_398599_-	arabinose import ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
AZH85547.1|398668_399658_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZH85548.1|399743_399983_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85549.1|400454_400958_+	non-heme ferritin	NA	NA	NA	NA	NA
AZH85550.1|401035_401287_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85551.1|401401_401488_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85552.1|401751_402075_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85553.1|402246_402744_+	non-heme ferritin	NA	NA	NA	NA	NA
AZH85554.1|402781_403021_-	DUF2492 domain-containing protein	NA	NA	NA	NA	NA
AZH85555.1|403211_404423_+	tyrosine transporter	NA	NA	NA	NA	NA
AZH85556.1|404473_405139_-	YecA family protein	NA	NA	NA	NA	NA
405266:405325	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
AZH85557.1|405610_406030_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
AZH85558.1|406196_407240_-	late control protein	NA	R9TNM7	Vibrio_phage	28.5	2.0e-33
AZH85559.1|407243_407468_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZH89617.1|407629_408019_-	hypothetical protein	NA	E5FFG4	Burkholderia_phage	37.9	1.0e-14
AZH85560.1|408054_409695_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
AZH85561.1|409803_410085_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZH85562.1|410097_410610_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZH85563.1|410627_412130_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
AZH85564.1|412126_412516_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
AZH85565.1|412515_413700_-	hypothetical protein	NA	J9QDX3	Clostridium_phage	35.2	2.5e-16
AZH85566.1|413692_414319_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
AZH85567.1|414321_415242_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
AZH85568.1|415238_415580_-|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
AZH85569.1|415582_416485_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
AZH85570.1|416465_417002_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85571.1|416998_417679_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85572.1|417710_418091_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85573.1|418087_418507_-	DNA-packaging protein	NA	NA	NA	NA	NA
AZH85574.1|418541_419576_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.2	1.2e-104
AZH85575.1|419634_419964_-|head	head protein	head	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
AZH85576.1|419963_421271_-|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
AZH85577.1|421270_422845_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
AZH85578.1|422841_423075_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85579.1|423074_424937_-|terminase	terminase	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
AZH85580.1|424923_425490_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
AZH89618.1|425858_426104_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85581.1|426163_426358_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85582.1|426365_426845_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
AZH85583.1|426844_427117_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
AZH85584.1|427116_427500_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85585.1|427612_428284_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
AZH85586.1|428283_428577_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
AZH85587.1|428573_429170_-	DUF1367 domain-containing protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
AZH85588.1|429247_429427_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85589.1|429578_430220_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85590.1|430463_430697_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85591.1|431095_431584_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
AZH85592.1|431593_432199_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85593.1|432661_433360_-	lysogenic protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
AZH85594.1|434548_435472_+	hypothetical protein	NA	NA	NA	NA	NA
AZH89619.1|435646_436435_-	hypothetical protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
AZH85595.1|436707_436929_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85596.1|437116_437341_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85597.1|437337_437649_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
AZH85598.1|437645_437882_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85599.1|437883_438294_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85600.1|438332_439748_-	helicase DnaB	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
AZH85601.1|439737_440493_-	replication protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
AZH85602.1|440489_440714_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
AZH85603.1|440753_441230_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
AZH85604.1|441288_441519_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
AZH85605.1|441617_442031_+	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
AZH85606.1|443041_443362_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85607.1|443392_445609_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
AZH85608.1|445605_446175_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
AZH85609.1|446174_446357_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85610.1|446406_446631_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	56.3	7.3e-10
AZH85611.1|446566_446830_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
AZH85612.1|446798_447815_+|integrase	integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
447877:448001	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 2
CP022730	Escherichia coli strain SA186 chromosome, complete genome	4828837	497367	575213	4828837	integrase,transposase	Bacillus_phage(33.33%)	60	500363:500378	577916:577931
AZH85673.1|497367_498090_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	54.4	3.1e-70
AZH85674.1|498194_498716_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZH85675.1|498976_499627_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AZH85676.1|499662_499992_+	hypothetical protein	NA	NA	NA	NA	NA
500363:500378	attL	GTTCAGCCGCTCCGGC	NA	NA	NA	NA
AZH89621.1|500479_501277_+	protein MtfA	NA	NA	NA	NA	NA
AZH85677.1|501614_502877_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
AZH85678.1|503070_504375_-	salicylate synthase	NA	NA	NA	NA	NA
AZH85679.1|504402_505683_-	MFS transporter	NA	NA	NA	NA	NA
AZH85680.1|505675_507478_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
AZH85681.1|507464_509267_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	1.1e-31
AZH85682.1|509433_510393_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZH85683.1|510583_516691_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
AZH85684.1|516778_526270_+	polyketide synthase	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
AZH85685.1|526266_527367_+	thiazolinyl imide reductase	NA	NA	NA	NA	NA
AZH85686.1|527363_528167_+	siderophore biosynthesis thioesterase	NA	NA	NA	NA	NA
AZH85687.1|528170_529748_+	2,3-dihydroxybenzoate-AMP ligase	NA	NA	NA	NA	NA
AZH85688.1|529878_531900_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AZH85689.1|532492_533299_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85690.1|533225_533396_+	adhesin	NA	NA	NA	NA	NA
AZH85691.1|533431_534694_+	adhesin	NA	NA	NA	NA	NA
AZH85692.1|534913_535390_+	invasin	NA	NA	NA	NA	NA
AZH85693.1|535517_536570_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85694.1|536884_538201_+	MFS transporter	NA	NA	NA	NA	NA
AZH85695.1|538302_539757_+	AMP nucleosidase	NA	NA	NA	NA	NA
AZH85696.1|540099_540816_+	transcriptional regulator	NA	NA	NA	NA	NA
AZH85697.1|541026_541230_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85698.1|541445_542933_-	FMN/FAD transporter	NA	NA	NA	NA	NA
AZH85699.1|543206_544157_-	transcriptional regulator Cbl	NA	NA	NA	NA	NA
AZH85700.1|544258_545176_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
AZH85701.1|545633_546566_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AZH85702.1|546630_547710_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AZH85703.1|547721_548465_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AZH85704.1|548461_549007_-	adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase	NA	NA	NA	NA	NA
AZH85705.1|549158_549281_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
AZH85706.1|550374_550572_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85707.1|550499_550727_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85708.1|550678_552826_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZH85709.1|553196_553841_-	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
AZH89622.1|553825_555049_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	2.0e-61
AZH85710.1|556096_556750_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
AZH85711.1|556763_557960_+	hypothetical protein	NA	NA	NA	NA	NA
AZH89623.1|557937_558519_+	acetyltransferase	NA	NA	NA	NA	NA
AZH85712.1|558520_559294_+	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
AZH85713.1|560295_561510_+	ribokinase	NA	NA	NA	NA	NA
AZH85714.1|561523_562282_+	cytoplasmic protein	NA	NA	NA	NA	NA
AZH85715.1|562335_563301_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85716.1|563303_564338_+	phosphotriesterase	NA	NA	NA	NA	NA
AZH85717.1|566652_567150_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85718.1|567050_567452_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85719.1|567617_568223_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AZH85720.1|568386_568587_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85721.1|568826_568967_-	hemolysin expression modulating family protein	NA	NA	NA	NA	NA
AZH89624.1|568953_569334_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85722.1|569301_569535_-	hypothetical protein	NA	NA	NA	NA	NA
AZH85723.1|569766_570963_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZH85724.1|571011_571365_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AZH85725.1|571443_572061_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85726.1|572534_572750_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85727.1|573865_574888_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AZH85728.1|575033_575213_+|transposase	transposase	transposase	NA	NA	NA	NA
577916:577931	attR	GCCGGAGCGGCTGAAC	NA	NA	NA	NA
>prophage 3
CP022730	Escherichia coli strain SA186 chromosome, complete genome	4828837	621295	627598	4828837		Enterobacteria_phage(50.0%)	7	NA	NA
AZH85775.1|621295_621838_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
AZH85776.1|621842_622721_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.7e-107
AZH85777.1|622779_623679_-	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
AZH89630.1|623678_624764_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	6.7e-101
AZH85778.1|624835_625099_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85779.1|625135_626029_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
AZH85780.1|626203_627598_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
>prophage 4
CP022730	Escherichia coli strain SA186 chromosome, complete genome	4828837	721571	731016	4828837		Enterobacteria_phage(85.71%)	10	NA	NA
AZH85851.1|721571_722708_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.4	6.7e-160
AZH85852.1|722704_724708_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AZH85853.1|724832_725294_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AZH85854.1|725334_725805_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AZH85855.1|725851_726571_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZH85856.1|726567_728253_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AZH85857.1|728474_729206_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
AZH85858.1|729265_729373_+	hypothetical protein	NA	NA	NA	NA	NA
AZH85859.1|729353_730085_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AZH85860.1|730089_731016_-	ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 5
CP022730	Escherichia coli strain SA186 chromosome, complete genome	4828837	1195426	1285523	4828837	transposase,portal,integrase,lysis,tail,tRNA	Enterobacteria_phage(34.92%)	100	1246594:1246608	1292625:1292639
AZH86269.1|1195426_1196164_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AZH86270.1|1196295_1197630_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AZH89640.1|1197662_1198544_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZH86271.1|1198646_1199234_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AZH86272.1|1199289_1199673_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
AZH86273.1|1199977_1200667_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
AZH86274.1|1200714_1201752_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AZH86275.1|1201741_1201945_-	hypothetical protein	NA	NA	NA	NA	NA
AZH86276.1|1201958_1202378_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AZH89641.1|1202446_1203145_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AZH86277.1|1203176_1205837_+	protein acetyltransferase	NA	NA	NA	NA	NA
AZH86278.1|1205950_1207306_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
AZH86279.1|1207351_1207675_+	hypothetical protein	NA	NA	NA	NA	NA
AZH86280.1|1207671_1208970_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-44
AZH86281.1|1208951_1209065_-	alpha-ketoglutarate permease	NA	NA	NA	NA	NA
AZH86282.1|1214756_1217330_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
AZH86283.1|1217459_1218191_-	laccase domain-containing protein	NA	NA	NA	NA	NA
AZH86284.1|1218187_1219168_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AZH86285.1|1219302_1220040_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AZH86286.1|1220068_1220275_+	hypothetical protein	NA	NA	NA	NA	NA
AZH86287.1|1220309_1220651_+	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AZH86288.1|1220900_1222061_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AZH86289.1|1222103_1223225_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AZH86290.1|1223235_1224306_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
AZH86291.1|1224515_1224881_+	hypothetical protein	NA	NA	NA	NA	NA
AZH86292.1|1225027_1225546_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AZH86293.1|1225535_1226762_+	diguanylate cyclase	NA	NA	NA	NA	NA
AZH86294.1|1226777_1227260_+	hypothetical protein	NA	NA	NA	NA	NA
AZH86295.1|1227336_1227684_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZH86296.1|1227725_1228493_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AZH86297.1|1228523_1229072_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AZH86298.1|1229090_1229339_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AZH86299.1|1229475_1230837_-	signal recognition particle protein	NA	NA	NA	NA	NA
AZH89642.1|1231003_1231795_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AZH89643.1|1231860_1233102_+	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AZH86300.1|1233155_1233749_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AZH86301.1|1233745_1233940_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AZH86302.1|1233871_1234750_+	NAD(+) kinase	NA	NA	NA	NA	NA
AZH86303.1|1234835_1236497_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AZH86304.1|1236645_1236987_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AZH86305.1|1237048_1237339_-	RnfH family protein	NA	NA	NA	NA	NA
AZH86306.1|1237328_1237805_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AZH86307.1|1237936_1238419_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AZH86308.1|1239230_1240439_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
AZH86309.1|1240473_1241907_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
AZH86310.1|1242313_1243087_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	1.6e-35
AZH86311.1|1243156_1243741_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	96.9	6.0e-104
AZH86312.1|1243740_1246701_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.5	5.8e-54
1246594:1246608	attL	GTTCACCACCACCGT	NA	NA	NA	NA
AZH86313.1|1246765_1247365_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	97.5	8.2e-109
AZH86314.1|1247435_1250933_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.1	0.0e+00
AZH86315.1|1250993_1251641_-|tail	phage tail protein	tail	A5LH42	Enterobacteria_phage	96.7	7.3e-111
AZH86316.1|1251538_1252282_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	1.1e-150
AZH86317.1|1252287_1252986_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	8.6e-134
AZH86318.1|1252995_1253325_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AZH86319.1|1253324_1256390_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.1	0.0e+00
AZH86320.1|1256361_1256691_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	1.3e-55
AZH89644.1|1256699_1257086_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
AZH86321.1|1257146_1257890_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
AZH86322.1|1257901_1258303_-|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
AZH86323.1|1258299_1258878_-|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
AZH86324.1|1258889_1259165_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
AZH86325.1|1259157_1259526_-	DUF2190 domain-containing protein	NA	K7PLV6	Enterobacteria_phage	100.0	9.7e-52
AZH86326.1|1259567_1261595_-	peptidase S14	NA	A5LH30	Enterobacteria_phage	99.8	0.0e+00
AZH86327.1|1261539_1263048_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.2	2.3e-288
AZH86328.1|1263047_1263260_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AZH86329.1|1263256_1265359_-	DNA packaging protein	NA	A0A291AWY5	Escherichia_phage	97.3	0.0e+00
AZH86330.1|1265358_1265853_-	DUF1441 domain-containing protein	NA	A0A291AWV8	Escherichia_phage	99.4	2.2e-83
AZH86331.1|1266011_1266212_-	hypothetical protein	NA	K7PJR7	Enterobacteria_phage	97.0	1.2e-32
AZH86332.1|1266528_1266681_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
AZH86333.1|1266668_1267136_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
AZH86334.1|1267132_1267630_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	1.1e-90
AZH86335.1|1267629_1267845_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AZH86336.1|1267912_1268965_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	6.1e-208
AZH86337.1|1269115_1269319_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	3.0e-31
AZH86338.1|1269583_1270510_+	hypothetical protein	NA	NA	NA	NA	NA
AZH86339.1|1270650_1271625_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
AZH89645.1|1271697_1272117_+	hypothetical protein	NA	NA	NA	NA	NA
AZH86340.1|1272129_1272471_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
AZH86341.1|1272488_1273478_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	3.1e-193
AZH86342.1|1273485_1274295_-	DNA-binding protein	NA	A0A291AWU7	Escherichia_phage	99.3	1.5e-150
AZH86343.1|1274314_1274704_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
AZH86344.1|1274700_1275027_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.3e-52
AZH86345.1|1275023_1275677_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	7.3e-127
AZH86346.1|1275676_1276171_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
AZH86347.1|1276167_1276986_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	3.1e-122
AZH89646.1|1276982_1277207_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.3	9.1e-37
AZH86348.1|1277211_1278048_-	ash family protein	NA	Q8SBF3	Shigella_phage	91.7	7.7e-137
AZH86349.1|1278044_1278596_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
AZH86350.1|1278639_1278840_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AZH86351.1|1278930_1279605_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	99.1	1.7e-131
AZH86352.1|1279674_1279881_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	93.5	1.4e-07
AZH86353.1|1280273_1280636_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AZH86354.1|1280701_1281526_+	hypothetical protein	NA	Q8SBF9	Shigella_phage	99.6	4.6e-150
AZH86355.1|1281653_1282190_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
AZH86356.1|1282180_1282543_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	96.7	2.6e-65
AZH86357.1|1282539_1282755_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
AZH86358.1|1282814_1283021_+	excisionase	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
AZH86359.1|1282981_1284157_+|integrase	integrase	integrase	I6PDJ1	Cronobacter_phage	67.4	2.7e-148
AZH86360.1|1284452_1284701_+	hypothetical protein	NA	I6PCV4	Cronobacter_phage	80.5	3.3e-27
AZH86361.1|1284704_1285523_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	79.2	1.3e-117
1292625:1292639	attR	ACGGTGGTGGTGAAC	NA	NA	NA	NA
>prophage 6
CP022730	Escherichia coli strain SA186 chromosome, complete genome	4828837	1354239	1361379	4828837		Escherichia_phage(83.33%)	6	NA	NA
AZH86433.1|1354239_1356801_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
AZH86434.1|1356906_1357563_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
AZH86435.1|1357613_1358381_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
AZH86436.1|1358576_1359485_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
AZH86437.1|1359481_1360744_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
AZH86438.1|1360740_1361379_+	class II aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 7
CP022730	Escherichia coli strain SA186 chromosome, complete genome	4828837	2419098	2432756	4828837	holin,integrase	Morganella_phage(37.5%)	15	2417187:2417199	2432312:2432324
2417187:2417199	attL	ATCAGTCGCCTTA	NA	NA	NA	NA
AZH87419.1|2419098_2420352_+|integrase	integrase	integrase	A0A1W6JPG6	Morganella_phage	78.1	3.9e-193
AZH87420.1|2420370_2421321_+	hypothetical protein	NA	NA	NA	NA	NA
AZH87421.1|2421427_2421631_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AZH87422.1|2421630_2422062_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	2.3e-28
AZH87423.1|2422074_2422908_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
AZH87424.1|2422900_2423083_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AZH87425.1|2423076_2424105_+	ash family protein	NA	Q8W643	Enterobacteria_phage	53.3	1.0e-13
AZH87426.1|2424097_2424292_+	hypothetical protein	NA	NA	NA	NA	NA
AZH87427.1|2424288_2424552_+|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
AZH87428.1|2424548_2424770_+	hypothetical protein	NA	NA	NA	NA	NA
AZH87429.1|2424762_2425365_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	5.3e-23
AZH87430.1|2425377_2428134_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	57.2	4.0e-299
AZH87431.1|2428725_2428905_-	hypothetical protein	NA	NA	NA	NA	NA
AZH87432.1|2429184_2430651_+	acyltransferase	NA	B6SCW4	Bacteriophage	53.5	2.9e-107
AZH87433.1|2430650_2432756_+	injection protein	NA	A0A2I7QQN9	Vibrio_phage	37.1	1.2e-90
2432312:2432324	attR	TAAGGCGACTGAT	NA	NA	NA	NA
>prophage 8
CP022730	Escherichia coli strain SA186 chromosome, complete genome	4828837	3464626	3493161	4828837	bacteriocin,transposase	Erysipelothrix_phage(20.0%)	31	NA	NA
AZH88341.1|3464626_3464911_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH88342.1|3465078_3465318_+	hypothetical protein	NA	NA	NA	NA	NA
AZH88343.1|3465318_3465609_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH88344.1|3465775_3465964_+	HNH endonuclease	NA	NA	NA	NA	NA
AZH88345.1|3466017_3466308_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH88346.1|3466475_3466715_+	hypothetical protein	NA	NA	NA	NA	NA
AZH88347.1|3466715_3467006_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH88348.1|3467461_3468226_+	pyruvate dehydrogenase complex repressor	NA	NA	NA	NA	NA
AZH88349.1|3468222_3468405_-	hypothetical protein	NA	NA	NA	NA	NA
AZH88350.1|3468386_3471050_+	pyruvate dehydrogenase E1 component	NA	NA	NA	NA	NA
AZH88351.1|3471064_3472957_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AZH88352.1|3473164_3474589_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
AZH88353.1|3474659_3476423_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AZH88354.1|3476680_3476797_+	aconitate hydratase	NA	NA	NA	NA	NA
AZH88355.1|3476777_3479375_+	aconitate hydratase B	NA	NA	NA	NA	NA
AZH88356.1|3479549_3479912_+	hypothetical protein	NA	NA	NA	NA	NA
AZH88357.1|3479949_3480744_-	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AZH88358.1|3480759_3481626_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AZH88359.1|3481731_3482079_-	hypothetical protein	NA	NA	NA	NA	NA
AZH88360.1|3482244_3483795_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	3.5e-18
AZH88361.1|3483841_3486232_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AZH88362.1|3486437_3486974_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AZH88363.1|3487014_3487677_-	carbonic anhydrase	NA	NA	NA	NA	NA
AZH88364.1|3487785_3488712_+	multidrug ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
AZH88365.1|3488708_3489479_+	inner membrane transport permease YadH	NA	NA	NA	NA	NA
AZH88366.1|3489583_3490024_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AZH88367.1|3490087_3491317_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AZH88368.1|3491320_3491701_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AZH88369.1|3491650_3491854_+	hypothetical protein	NA	NA	NA	NA	NA
AZH88370.1|3491974_3492895_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	48.8	4.9e-60
AZH88371.1|3492963_3493161_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
CP022730	Escherichia coli strain SA186 chromosome, complete genome	4828837	4264446	4359560	4828837	capsid,plate,portal,protease,holin,terminase,lysis,integrase,head,tail,tRNA	Escherichia_phage(35.09%)	88	4264381:4264396	4341491:4341506
4264381:4264396	attL	GCAAATAAGCTCTTGT	NA	NA	NA	NA
AZH89077.1|4264446_4264767_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AZH89078.1|4264797_4267074_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AZH89079.1|4267758_4267977_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZH89080.1|4268261_4268966_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZH89081.1|4269007_4270729_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
AZH89082.1|4270729_4272496_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AZH89083.1|4272618_4273584_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
AZH89084.1|4274127_4274622_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AZH89085.1|4274756_4278863_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AZH89086.1|4279021_4279633_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AZH89087.1|4279643_4280987_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AZH89088.1|4281077_4282370_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AZH89089.1|4282608_4285053_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
AZH89090.1|4285063_4285681_+	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AZH89091.1|4285682_4286546_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AZH89092.1|4286581_4287208_-	hydrolase	NA	NA	NA	NA	NA
AZH89093.1|4287521_4288670_+	MFS transporter	NA	NA	NA	NA	NA
AZH89094.1|4288766_4289564_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
AZH89095.1|4289595_4290591_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
AZH89096.1|4290684_4290984_-	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
AZH89097.1|4291077_4291449_+	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	100.0	1.6e-65
AZH89098.1|4291432_4291630_+	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	98.5	6.1e-29
AZH89099.1|4291626_4292127_+	replication protein B	NA	S4TTB7	Salmonella_phage	98.8	6.5e-91
AZH89100.1|4292190_4292415_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AZH89101.1|4292414_4292717_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	98.0	5.5e-45
AZH89102.1|4292716_4292941_+	hypothetical protein	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
AZH89103.1|4292937_4293213_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AZH89104.1|4293202_4295485_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.5	0.0e+00
AZH89105.1|4295601_4297434_+	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.3	1.5e-89
AZH89106.1|4297773_4298808_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	2.4e-201
AZH89107.1|4298807_4300580_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AZH89108.1|4300753_4301608_+|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
AZH89109.1|4301666_4302740_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	99.4	5.7e-201
AZH89110.1|4302743_4303487_+|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	97.6	1.9e-126
AZH89111.1|4303586_4304096_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AZH89112.1|4304095_4304299_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AZH89113.1|4304302_4304584_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AZH89114.1|4304583_4305081_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AZH89115.1|4305095_4305521_+	protein lysA	NA	M1SV74	Escherichia_phage	90.1	1.8e-57
AZH89116.1|4305508_4305934_+	protein lysB	NA	M1SNP0	Escherichia_phage	97.9	1.6e-66
AZH89117.1|4305905_4306079_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AZH89118.1|4306041_4306509_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	6.7e-82
AZH89119.1|4306501_4306954_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
AZH89120.1|4307020_4307656_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	4.5e-113
AZH89121.1|4307652_4308000_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AZH89122.1|4308004_4308913_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	100.0	3.4e-162
AZH89123.1|4308905_4309436_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
AZH89124.1|4309446_4312065_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	72.4	2.5e-282
AZH89125.1|4312064_4312643_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	66.0	4.7e-69
AZH89126.1|4313337_4314048_+	RES domain-containing protein	NA	NA	NA	NA	NA
AZH89127.1|4314086_4314731_-	DNA-binding protein	NA	NA	NA	NA	NA
AZH89128.1|4315098_4316289_+|tail	phage tail protein	tail	Q858V1	Yersinia_virus	99.5	1.1e-224
AZH89129.1|4316301_4316820_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
AZH89130.1|4316876_4317152_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AZH89750.1|4317184_4317304_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AZH89131.1|4317296_4319744_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.5	0.0e+00
AZH89132.1|4319758_4320238_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
AZH89133.1|4320237_4321401_+	hypothetical protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
AZH89134.1|4321482_4321701_+	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
AZH89135.1|4322019_4324302_-	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AZH89136.1|4324356_4325214_-	formate transporter FocA	NA	NA	NA	NA	NA
AZH89137.1|4325619_4327380_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AZH89138.1|4327509_4328202_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AZH89139.1|4328400_4329489_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
AZH89140.1|4329559_4330843_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZH89141.1|4331012_4331777_+|protease	metalloprotease	protease	NA	NA	NA	NA
AZH89142.1|4331949_4332633_+	cytidylate kinase	NA	NA	NA	NA	NA
AZH89143.1|4332743_4334417_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AZH89144.1|4334576_4334861_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AZH89145.1|4335066_4337331_+	ComEC family protein	NA	NA	NA	NA	NA
AZH89146.1|4337367_4339116_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
AZH89147.1|4339112_4340099_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AZH89148.1|4340135_4341368_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZH89149.1|4341419_4341602_+	hypothetical protein	NA	NA	NA	NA	NA
4341491:4341506	attR	ACAAGAGCTTATTTGC	NA	NA	NA	NA
AZH89150.1|4341598_4342345_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AZH89151.1|4342498_4343392_+	hypothetical protein	NA	NA	NA	NA	NA
AZH89152.1|4343368_4344148_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AZH89153.1|4344050_4344215_-	hypothetical protein	NA	NA	NA	NA	NA
AZH89154.1|4344283_4345069_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AZH89155.1|4345065_4346388_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AZH89156.1|4346368_4347073_+	condensin subunit E	NA	NA	NA	NA	NA
AZH89157.1|4347072_4351533_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
AZH89158.1|4351793_4353641_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AZH89751.1|4353821_4354370_+	hypothetical protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
AZH89159.1|4354396_4355044_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZH89160.1|4355093_4356284_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AZH89161.1|4356468_4357557_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	54.3	2.8e-99
AZH89162.1|4358159_4359560_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	6.9e-82
>prophage 1
CP022731	Escherichia coli strain SA186 plasmid pSA186_2, complete sequence	198748	11399	62487	198748	transposase,bacteriocin,integrase,tRNA	Enterobacteria_phage(21.43%)	42	6919:6934	44398:44413
6919:6934	attL	ATTCACAGAGGAAATA	NA	NA	NA	NA
AZH89951.1|11399_11507_+|integrase	integrase	integrase	NA	NA	NA	NA
AZH89792.1|11520_12543_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	5.0e-199
AZH89793.1|12539_13322_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.2	2.2e-138
AZH89794.1|15230_16444_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AZH89795.1|17210_18173_-	carbamate kinase	NA	NA	NA	NA	NA
AZH89796.1|18199_19750_-	xanthine permease	NA	NA	NA	NA	NA
AZH89797.1|19862_21281_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AZH89798.1|21280_22828_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AZH89799.1|22787_23636_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AZH89800.1|23721_24327_-	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	26.0	1.7e-05
AZH89801.1|24714_25644_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZH89802.1|26317_26578_-	hypothetical protein	NA	Q716C2	Shigella_phage	42.0	3.2e-09
AZH89803.1|28396_29062_+	hypothetical protein	NA	NA	NA	NA	NA
AZH89804.1|29119_29410_+	hypothetical protein	NA	NA	NA	NA	NA
AZH89805.1|31556_31781_+	hypothetical protein	NA	NA	NA	NA	NA
AZH89806.1|31797_32187_-	cytochrome B562	NA	NA	NA	NA	NA
AZH89807.1|32620_33511_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZH89808.1|33588_34812_-	cytosine permease	NA	NA	NA	NA	NA
AZH89809.1|34834_35224_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	NA	NA	NA	NA
AZH89810.1|35240_36197_-	carbamate kinase	NA	NA	NA	NA	NA
AZH89811.1|36189_37614_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AZH89812.1|37610_39170_-	hypothetical protein	NA	NA	NA	NA	NA
AZH89813.1|39264_40125_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AZH89814.1|40130_40799_-	cysteine hydrolase	NA	NA	NA	NA	NA
AZH89815.1|43312_43432_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AZH89816.1|43477_43666_+	hypothetical protein	NA	NA	NA	NA	NA
AZH89817.1|44184_44418_+	HNH endonuclease	NA	NA	NA	NA	NA
44398:44413	attR	ATTCACAGAGGAAATA	NA	NA	NA	NA
AZH89818.1|44418_44676_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH89819.1|44753_45986_-	MFS transporter	NA	NA	NA	NA	NA
AZH89820.1|45997_46759_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	8.8e-15
AZH89821.1|46758_47796_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AZH89822.1|47795_48794_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZH89823.1|49148_49739_-	resolvase	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	6.2e-24
AZH89824.1|50316_51327_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	1.1e-20
AZH89825.1|51793_52159_-|transposase	transposase	transposase	NA	NA	NA	NA
AZH89826.1|52280_53432_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
AZH89827.1|53388_53757_-	hypothetical protein	NA	Q716C1	Shigella_phage	98.9	1.9e-39
AZH89828.1|54396_58530_+	outer membrane autotransporter barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	41.6	4.3e-297
AZH89829.1|59076_59334_-	resolvase	NA	NA	NA	NA	NA
AZH89830.1|60706_61054_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AZH89952.1|61050_61431_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AZH89831.1|61506_62487_-	flavin-binding monooxygenase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
>prophage 2
CP022731	Escherichia coli strain SA186 plasmid pSA186_2, complete sequence	198748	74745	148431	198748	protease,transposase	Leptospira_phage(11.11%)	58	NA	NA
AZH89845.1|74745_75866_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AZH89846.1|75934_76123_-	hypothetical protein	NA	NA	NA	NA	NA
AZH89847.1|76410_78588_+	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
AZH89848.1|78632_79589_-	Salmochelin siderophore protein IroE	NA	NA	NA	NA	NA
AZH89849.1|79673_80903_-	esterase family protein	NA	NA	NA	NA	NA
AZH89850.1|81006_84666_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	1.2e-45
AZH89851.1|84805_85921_-	glycosyl transferase	NA	NA	NA	NA	NA
AZH89955.1|86119_86383_-	hypothetical protein	NA	NA	NA	NA	NA
AZH89852.1|88368_88551_+	hypothetical protein	NA	NA	NA	NA	NA
AZH89853.1|89065_89359_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AZH89956.1|89527_90502_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
AZH89854.1|90596_90785_+	hypothetical protein	NA	NA	NA	NA	NA
AZH89855.1|91092_92365_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.8e-175
AZH89856.1|92820_94014_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AZH89857.1|94152_94464_+	hypothetical protein	NA	Q9ZXG3	Shigella_phage	59.3	1.3e-17
AZH89858.1|94648_96046_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AZH89859.1|96277_96547_+	hypothetical protein	NA	NA	NA	NA	NA
AZH89860.1|96546_97014_+	hypothetical protein	NA	NA	NA	NA	NA
AZH89861.1|97056_97428_+	hypothetical protein	NA	NA	NA	NA	NA
AZH89862.1|99255_99519_-	hypothetical protein	NA	NA	NA	NA	NA
AZH89863.1|99769_102034_-	DNA helicase UvrD	NA	NA	NA	NA	NA
AZH89957.1|102035_102812_-	hypothetical protein	NA	NA	NA	NA	NA
AZH89864.1|105207_106578_-	RND transporter	NA	NA	NA	NA	NA
AZH89865.1|106581_108522_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
AZH89866.1|108518_109706_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	6.0e-10
AZH89867.1|111420_111837_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	33.6	3.3e-16
AZH89868.1|111986_112250_+	hypothetical protein	NA	NA	NA	NA	NA
AZH89869.1|112616_113006_-	GlcNAc transferase	NA	NA	NA	NA	NA
AZH89870.1|113109_114063_+|protease	outer membrane protease	protease	NA	NA	NA	NA
AZH89871.1|114152_114437_-	hypothetical protein	NA	NA	NA	NA	NA
AZH89872.1|114495_115605_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
AZH89873.1|115667_116576_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
AZH89874.1|116949_117138_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AZH89875.1|117258_117999_+	recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
AZH89876.1|118283_119261_-	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
AZH89877.1|119669_119966_-	hypothetical protein	NA	NA	NA	NA	NA
AZH89878.1|121928_122120_+	prephenate dehydratase	NA	NA	NA	NA	NA
AZH89879.1|122242_123157_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZH89880.1|123156_123984_+	manganese/iron transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
AZH89881.1|123980_124838_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AZH89882.1|124834_125692_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AZH89958.1|126210_126594_+	enolase	NA	W6LP63	Streptococcus_phage	55.4	8.0e-33
AZH89883.1|126590_126863_+	hypothetical protein	NA	NA	NA	NA	NA
AZH89884.1|126934_127315_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
AZH89885.1|127694_128888_-	MFS transporter	NA	NA	NA	NA	NA
AZH89886.1|128960_130748_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
AZH89887.1|130748_131696_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZH89888.1|131695_133438_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
AZH89889.1|133434_134712_+	L-lysine N6-monooxygenase	NA	NA	NA	NA	NA
AZH89890.1|134793_136995_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AZH89891.1|138325_139348_-	DNA helicase UvrD	NA	NA	NA	NA	NA
AZH89892.1|139332_140898_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AZH89893.1|140972_141389_-	PIN domain nuclease	NA	NA	NA	NA	NA
AZH89894.1|141385_141616_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AZH89895.1|141966_145791_+	pcar	NA	NA	NA	NA	NA
AZH89896.1|146035_146461_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	2.0e-48
AZH89897.1|146457_146808_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.1e-40
AZH89898.1|146838_148431_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	5.1e-182
>prophage 1
CP022733	Escherichia coli strain SA186 plasmid pSA186_4, complete sequence	96658	0	95914	96658	lysis,head,holin,plate,tail,protease,terminase,portal,transposase	Escherichia_phage(62.5%)	116	NA	NA
AZH90077.1|116_698_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
AZH90078.1|709_1219_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
AZH90079.1|1335_1491_-	type I toxin-antitoxin system hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
AZH90190.1|1672_1918_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
AZH90080.1|1968_2814_-	Replication protein repL	NA	Q1MVK3	Enterobacteria_phage	97.9	1.6e-150
AZH90081.1|2843_3644_-	DNA-binding protein	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
AZH90082.1|3807_4851_-	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	93.1	1.6e-171
AZH90083.1|4847_5069_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	97.3	8.1e-38
AZH90084.1|5102_5273_-	transcriptional regulator	NA	NA	NA	NA	NA
AZH90085.1|5469_6144_+	hypothetical protein	NA	Q71TC4	Escherichia_phage	94.0	6.8e-19
AZH90086.1|6415_6685_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90087.1|6743_7310_+	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	100.0	6.6e-100
AZH90088.1|7320_7932_+|tail	phage tail protein	tail	A0A077SLH8	Escherichia_phage	100.0	5.8e-110
AZH90089.1|7946_8828_+	morphogenetic protein	NA	Q71TC9	Escherichia_phage	99.7	4.8e-174
AZH90090.1|8909_12302_+	transglycosylase	NA	Q1MVL3	Enterobacteria_phage	98.8	0.0e+00
AZH90091.1|12301_12658_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
AZH90092.1|12654_14088_+	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.2	4.5e-270
AZH90093.1|14087_14924_+|tail	phage tail protein	tail	A0A1B0V7F2	Salmonella_phage	100.0	1.4e-154
AZH90094.1|15002_15437_+|tail	phage tail protein	tail	A0A077SLL3	Escherichia_phage	99.3	7.4e-75
AZH90095.1|15448_17860_+|tail	phage tail protein	tail	A0A1B0V7G4	Salmonella_phage	63.5	3.3e-07
AZH90096.1|17859_18471_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	78.6	3.6e-83
AZH90097.1|18476_18974_-|tail	phage tail protein	tail	K7P7Q7	Enterobacteria_phage	55.5	5.5e-42
AZH90098.1|18984_19395_-|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	70.4	1.9e-48
AZH90099.1|19423_19900_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	61.2	3.4e-49
AZH90100.1|19910_20372_-|tail	phage tail protein	tail	K7P7Q7	Enterobacteria_phage	55.8	6.3e-40
AZH90101.1|20382_20868_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	50.3	1.7e-35
AZH90102.1|20896_21400_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	54.7	3.5e-44
AZH90103.1|21410_21878_-|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	65.8	1.0e-50
AZH90104.1|21888_22320_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	57.6	9.6e-43
AZH90105.1|22391_22964_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.0	4.4e-83
AZH90106.1|23399_23663_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.1e-22
AZH90107.1|23737_24067_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
AZH90108.1|24063_24507_+|lysis	lysis protein	lysis	A0A077SK09	Escherichia_phage	100.0	1.3e-82
AZH90109.1|24493_25096_+	odaE	NA	Q1MVM6	Enterobacteria_phage	99.0	3.5e-99
AZH90110.1|25097_27017_+	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	98.6	0.0e+00
AZH90111.1|27013_27379_+	ddrA	NA	A0A077SK35	Escherichia_phage	100.0	7.9e-46
AZH90112.1|27418_28627_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	100.0	1.8e-224
AZH90113.1|28726_31714_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.3	0.0e+00
AZH90114.1|31703_32012_+	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
AZH90115.1|32043_33138_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	36.7	5.1e-40
AZH90116.1|33130_33919_-	hypothetical protein	NA	A0A077SK34	Escherichia_phage	98.8	8.8e-143
AZH90117.1|34121_34610_-	ssDNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	86.4	2.0e-73
AZH90191.1|34779_35337_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
AZH90118.1|35472_35649_+|holin	antiholin	holin	Q71TR5	Escherichia_phage	96.6	7.2e-29
AZH90119.1|35628_36648_-|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
AZH90120.1|36640_38350_-|portal	phage portal protein	portal	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
AZH90121.1|38426_45194_+	helicase	NA	Q1MVN7	Enterobacteria_phage	98.8	0.0e+00
AZH90122.1|45227_45668_+	peptide-binding protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
AZH90123.1|45664_45913_+	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AZH90124.1|45949_47077_-	GTP pyrophosphokinase	NA	A0A1B0VBT5	Salmonella_phage	74.1	7.6e-156
AZH90125.1|47179_47821_-	maturation control protein	NA	A0A077SK30	Escherichia_phage	96.7	1.2e-110
AZH90126.1|48010_48571_-	recombinase	NA	Q5QBN4	Enterobacteria_phage	98.4	2.5e-99
AZH90127.1|48818_49130_-	lysogeny establishment protein	NA	Q5QBN5	Enterobacteria_phage	100.0	2.1e-47
AZH90128.1|49180_50212_-	recombinase	NA	Q71TG5	Escherichia_phage	99.7	4.9e-194
AZH90129.1|50219_50441_-	creatininase	NA	Q5QBN7	Enterobacteria_phage	97.3	5.5e-34
AZH90130.1|50852_50966_+	peptidase	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
AZH90131.1|50984_51080_+	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AZH90132.1|51045_51255_+	c1 repressor inactivator	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
AZH90133.1|51365_52217_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
AZH90134.1|52241_53726_-|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
AZH90135.1|53725_54919_-|terminase	terminase	terminase	A0A077SL59	Escherichia_phage	99.7	4.7e-180
AZH90136.1|55004_55457_-	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
AZH90137.1|55545_56589_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.7	1.1e-206
AZH90138.1|56616_56796_-	PdcA protein	NA	Q71TH5	Escherichia_phage	100.0	7.1e-24
AZH90139.1|56800_57181_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
AZH90140.1|57180_57402_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AZH90141.1|57474_57864_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
AZH90142.1|57987_58239_-	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	100.0	1.4e-38
AZH90192.1|58412_58622_+	hypothetical protein	NA	A0A222YY00	Escherichia_phage	98.6	1.1e-31
AZH90143.1|58606_58891_-	antitoxin PHD	NA	A0A222YXZ5	Escherichia_phage	100.0	2.4e-05
AZH90144.1|58874_59813_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	97.0	5.9e-170
AZH90145.1|59794_60169_-	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	97.6	1.1e-66
AZH90146.1|60175_60469_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	3.1e-45
AZH90147.1|60647_60881_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	98.7	7.3e-37
AZH90148.1|60957_61218_-	eaa protein	NA	A0A1B0V7L4	Salmonella_phage	98.8	1.9e-41
AZH90149.1|61214_62096_-	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	51.7	4.7e-60
AZH90193.1|62092_62380_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	100.0	9.5e-55
AZH90150.1|63143_63833_-	hypothetical protein	NA	K7P6J7	Enterobacteria_phage	58.2	4.9e-57
AZH90151.1|63829_64069_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	93.7	5.3e-35
AZH90152.1|64061_64265_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	6.8e-31
AZH90153.1|64348_65077_-	hypothetical protein	NA	Q71T76	Escherichia_phage	98.7	1.4e-139
AZH90154.1|65271_65778_-	3'-phosphatase	NA	A0A077SK53	Escherichia_phage	98.8	5.4e-93
AZH90155.1|65850_67113_-	hypothetical protein	NA	A0A077SL55	Escherichia_phage	99.8	2.7e-234
AZH90156.1|67114_67333_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AZH90157.1|67414_68116_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
AZH90158.1|68112_68790_-	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
AZH90159.1|68786_69413_-	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	100.0	2.1e-123
AZH90160.1|69310_69973_-	norphogenetic protein	NA	A0A077SL54	Escherichia_phage	100.0	4.5e-124
AZH90161.1|69914_70070_-	norphogenetic protein	NA	A0A077SK20	Escherichia_phage	100.0	1.2e-19
AZH90162.1|70136_70715_-	norphogenetic protein	NA	A0A077SLK0	Escherichia_phage	100.0	8.8e-108
AZH90163.1|70717_70963_-	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
AZH90164.1|71109_71487_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
AZH90165.1|71496_72714_+|tail	phage tail protein	tail	A0A077SL53	Escherichia_phage	99.8	4.1e-224
AZH90166.1|72717_73446_+|tail	phage tail protein	tail	A0A077SK19	Escherichia_phage	99.6	3.5e-138
AZH90167.1|73432_74218_+|plate	baseplate	plate	Q71T90	Escherichia_phage	99.6	4.6e-144
AZH90168.1|74219_75236_+|tail	phage tail tape measure protein	tail	A0A077SLQ1	Escherichia_phage	99.7	4.5e-192
AZH90169.1|75228_75861_+|plate	baseplate protein	plate	A0A077SK50	Escherichia_phage	99.4	9.0e-90
AZH90170.1|75906_76881_-	hypothetical protein	NA	Q71TK3	Escherichia_phage	98.5	3.2e-187
AZH90171.1|76877_77180_-	hypothetical protein	NA	NA	NA	NA	NA
AZH90172.1|77179_78544_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	99.8	6.2e-253
AZH90173.1|78534_78750_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90174.1|78932_79760_-|protease	serine protease	protease	A0A077SLJ6	Escherichia_phage	100.0	1.6e-131
AZH90175.1|79740_79977_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	50.0	2.1e-07
AZH90176.1|81577_84166_-	multidrug DMT transporter permease	NA	A0A1B0V7P0	Salmonella_phage	87.4	0.0e+00
AZH90177.1|84162_85068_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
AZH90178.1|85060_85345_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
AZH90179.1|85619_85799_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	100.0	3.1e-27
AZH90180.1|85807_86596_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	99.6	7.3e-121
AZH90181.1|86635_87058_+	ppfA	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
AZH90182.1|87235_87628_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
AZH90183.1|87962_88847_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
AZH90184.1|89139_89949_+	helicase	NA	A0A077SK46	Escherichia_phage	98.5	1.9e-156
AZH90185.1|90117_91314_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AZH90186.1|91330_92332_+	chromosome partitioning protein ParB	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AZH90187.1|92557_94264_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
AZH90188.1|94324_95914_+	hypothetical protein	NA	A0A077SLN8	Escherichia_phage	100.0	2.5e-306
>prophage 1
CP022735	Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence	241600	0	1931	241600		Burkholderia_phage(50.0%)	2	NA	NA
AZH90313.1|275_1703_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
AZH90314.1|1763_1931_+	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
>prophage 2
CP022735	Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence	241600	11572	16463	241600		Cafeteria_roenbergensis_virus(50.0%)	3	NA	NA
AZH90328.1|11572_13612_+	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.8	2.5e-24
AZH90329.1|14968_15394_-	hypothetical protein	NA	NA	NA	NA	NA
AZH90330.1|15647_16463_-	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
>prophage 3
CP022735	Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence	241600	23434	32364	241600		Caulobacter_phage(33.33%)	10	NA	NA
AZH90340.1|23434_24010_-	chemical-damaging agent resistance protein C	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
AZH90341.1|24077_24656_-	chemical-damaging agent resistance protein C	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
AZH90342.1|24704_25745_-	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
AZH90343.1|25767_26223_-	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
AZH90344.1|26245_27403_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AZH90345.1|27402_27984_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	4.8e-13
AZH90346.1|28306_29365_+	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AZH90347.1|29374_30517_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
AZH90348.1|30509_31283_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90349.1|31284_32364_+	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	33.8	8.1e-38
>prophage 4
CP022735	Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence	241600	39883	43922	241600	transposase	Staphylococcus_phage(100.0%)	4	NA	NA
AZH90552.1|39883_40858_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
AZH90358.1|40827_41055_-	hypothetical protein	NA	NA	NA	NA	NA
AZH90359.1|41126_42752_-	phosphoethanolamine--lipid A transferase MCR-1	NA	NA	NA	NA	NA
AZH90553.1|42947_43922_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
>prophage 5
CP022735	Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence	241600	46982	48164	241600		Salmonella_phage(100.0%)	1	NA	NA
AZH90362.1|46982_48164_+	recombinase	NA	A0A1B0V7J3	Salmonella_phage	26.5	3.6e-15
>prophage 6
CP022735	Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence	241600	67908	69693	241600		Bacillus_phage(100.0%)	1	NA	NA
AZH90385.1|67908_69693_-	ATP-dependent helicase	NA	S5M596	Bacillus_phage	26.7	3.5e-22
>prophage 7
CP022735	Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence	241600	84377	85415	241600		Enterobacteria_phage(100.0%)	1	NA	NA
AZH90395.1|84377_85415_-	stbA family protein	NA	A0A0A7NPX4	Enterobacteria_phage	35.0	3.6e-43
>prophage 8
CP022735	Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence	241600	88520	89525	241600		Aeromonas_phage(100.0%)	1	NA	NA
AZH90399.1|88520_89525_-	peptide transporter	NA	A0A1I9KFW9	Aeromonas_phage	33.8	2.7e-11
>prophage 9
CP022735	Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence	241600	105872	115616	241600		Salmonella_phage(66.67%)	11	NA	NA
AZH90413.1|105872_106748_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	43.0	2.1e-60
AZH90414.1|107224_108280_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	31.2	1.1e-12
AZH90415.1|108297_108498_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90416.1|108494_109211_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90417.1|109445_110300_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90418.1|110308_111121_-	DNA modification methylase	NA	A0A1C9II58	Salmonella_phage	38.5	3.0e-45
AZH90419.1|111490_112654_+	DNA-binding protein	NA	A0A1P8DTT7	Salmonella_phage	32.1	1.3e-17
AZH90420.1|112901_114593_+	restriction endonuclease subunit M	NA	J9Q747	Salmonella_phage	31.0	2.6e-67
AZH90421.1|114589_114766_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90422.1|114814_115276_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90423.1|115256_115616_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	7.1e-07
>prophage 10
CP022735	Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence	241600	120967	122023	241600		Salmonella_phage(100.0%)	1	NA	NA
AZH90556.1|120967_122023_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	50.6	1.4e-82
>prophage 11
CP022735	Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence	241600	126986	130968	241600		Klebsiella_phage(25.0%)	6	NA	NA
AZH90428.1|126986_127598_-	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	71.1	1.2e-09
AZH90429.1|127618_127882_-	hypothetical protein	NA	M9UXL5	Escherichia_phage	46.5	3.2e-09
AZH90430.1|127975_128737_-	SAM-dependent methyltransferase	NA	A0A2I7RNS1	Vibrio_phage	32.9	1.2e-19
AZH90431.1|128817_129582_-	hypothetical protein	NA	NA	NA	NA	NA
AZH90432.1|129902_130427_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90433.1|130530_130968_+	hypothetical protein	NA	A0A1V0E5M6	Salmonella_phage	48.0	3.6e-21
>prophage 12
CP022735	Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence	241600	135419	139300	241600		Escherichia_phage(50.0%)	6	NA	NA
AZH90439.1|135419_135716_+	toxin-plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	35.1	3.2e-05
AZH90440.1|135724_136906_+	flavin reductase	NA	NA	NA	NA	NA
AZH90441.1|137313_137691_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90442.1|137785_138214_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90443.1|138278_138536_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90444.1|138691_139300_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	39.8	5.4e-23
>prophage 13
CP022735	Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence	241600	147395	147929	241600		Edwardsiella_phage(100.0%)	1	NA	NA
AZH90454.1|147395_147929_+	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	65.2	2.6e-45
>prophage 14
CP022735	Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence	241600	151009	151303	241600		Escherichia_phage(100.0%)	1	NA	NA
AZH90461.1|151009_151303_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	38.6	6.4e-06
>prophage 15
CP022735	Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence	241600	154923	214621	241600	integrase,transposase	Salmonella_phage(17.65%)	65	154116:154131	204518:204533
154116:154131	attL	ATGATCGACTGGAGCG	NA	NA	NA	NA
AZH90469.1|154923_156036_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AZH90470.1|156184_156487_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90471.1|156496_156700_-	hypothetical protein	NA	NA	NA	NA	NA
AZH90472.1|156745_157096_-	hypothetical protein	NA	NA	NA	NA	NA
AZH90473.1|157155_157755_-	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	42.6	1.7e-08
AZH90474.1|157854_158799_-	hypothetical protein	NA	NA	NA	NA	NA
AZH90475.1|159254_159485_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90476.1|159489_159870_-	hypothetical protein	NA	NA	NA	NA	NA
AZH90477.1|159900_161085_+	DNA-binding protein	NA	NA	NA	NA	NA
AZH90478.1|161150_161432_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90557.1|161688_161895_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90479.1|162015_162312_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90480.1|162356_162794_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90481.1|162861_163398_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90482.1|163562_163931_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90483.1|164363_164666_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90484.1|165022_165307_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90485.1|165372_165726_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90558.1|166259_167234_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
AZH90486.1|167817_168999_-	S49 family peptidase	NA	B8QTU8	Erwinia_phage	29.2	3.4e-13
AZH90487.1|169009_169672_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
AZH90488.1|169658_170768_-	hypothetical protein	NA	NA	NA	NA	NA
AZH90489.1|170767_172852_-	hypothetical protein	NA	NA	NA	NA	NA
AZH90490.1|172851_175998_-	helicase	NA	NA	NA	NA	NA
AZH90491.1|176007_176745_-	hypothetical protein	NA	NA	NA	NA	NA
AZH90492.1|176741_177227_-	plasmid transfer protein	NA	NA	NA	NA	NA
AZH90493.1|177985_178786_+	trhR	NA	NA	NA	NA	NA
AZH90494.1|178787_179300_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90495.1|179893_180940_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AZH90496.1|180929_182345_+	conjugal transfer protein	NA	NA	NA	NA	NA
AZH90497.1|182353_186307_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AZH90498.1|186487_187777_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	32.9	5.5e-09
AZH90499.1|187884_188451_-	hypothetical protein	NA	NA	NA	NA	NA
AZH90500.1|188533_189073_-	lytic transglycosylase	NA	NA	NA	NA	NA
AZH90501.1|189220_189970_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AZH90502.1|189994_190387_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90503.1|190420_190843_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90504.1|190902_191514_-	hypothetical protein	NA	NA	NA	NA	NA
AZH90505.1|191620_192430_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90506.1|192475_193735_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.3	2.6e-96
AZH90507.1|193718_194153_-	peptidase	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
AZH90508.1|194346_194964_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90509.1|195113_195470_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90510.1|196654_198232_-	chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
AZH90511.1|198374_198959_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AZH90512.1|198927_199941_-|integrase	integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.1	1.5e-70
AZH90513.1|200087_200570_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AZH90514.1|200790_201057_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AZH90515.1|201199_201964_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AZH90516.1|202154_202511_-	hypothetical protein	NA	NA	NA	NA	NA
AZH90517.1|202456_203041_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZH90518.1|203040_204279_-	MFS transporter	NA	NA	NA	NA	NA
AZH90519.1|204275_205181_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
204518:204533	attR	CGCTCCAGTCGATCAT	NA	NA	NA	NA
AZH90520.1|205302_206007_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH90559.1|206031_206409_+	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	2.4e-53
AZH90521.1|206591_207452_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AZH90560.1|208068_208911_+	putative esterase EstX	NA	NA	NA	NA	NA
AZH90522.1|209006_209615_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AZH90523.1|209672_210464_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AZH90524.1|211052_211757_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
AZH90561.1|211829_212069_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
AZH90525.1|212214_213078_+	short-chain dehydrogenase/reductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
AZH90526.1|213115_213361_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90562.1|213511_213739_+	hypothetical protein	NA	NA	NA	NA	NA
AZH90527.1|213829_214621_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	26.5	7.0e-15
>prophage 16
CP022735	Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence	241600	218242	220998	241600	transposase	Escherichia_phage(66.67%)	3	NA	NA
AZH90531.1|218242_218947_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
AZH90532.1|219097_219913_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AZH90533.1|220074_220998_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
>prophage 17
CP022735	Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence	241600	225956	230810	241600	transposase	Salmonella_phage(50.0%)	3	NA	NA
AZH90538.1|225956_227171_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AZH90539.1|227198_227504_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZH90540.1|230105_230810_+|transposase	IS6 family transposase IS15DII	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
