The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP023820	Escherichia coli strain 7/2 chromosome, complete genome	5099240	970311	1069117	5099240	portal,tRNA,capsid,tail,holin,terminase,protease,head,plate,lysis,integrase	Escherichia_phage(42.37%)	93	979439:979456	1025461:1025478
AZH32943.1|970311_970632_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AZH32944.1|970662_972939_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AZH36828.1|973017_973227_-	hypothetical protein	NA	NA	NA	NA	NA
AZH32945.1|973571_973754_-	hypothetical protein	NA	NA	NA	NA	NA
AZH32946.1|974158_974377_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZH32947.1|974661_975366_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZH32948.1|975407_977129_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.2e-21
AZH32949.1|977129_978896_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
AZH32950.1|979018_979984_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
979439:979456	attL	GCGGAAACCGTCACGGCG	NA	NA	NA	NA
AZH32951.1|980528_981023_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AZH32952.1|981157_985225_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AZH32953.1|985383_985995_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AZH32954.1|986005_987349_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AZH32955.1|987439_988732_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AZH32956.1|988970_991415_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
AZH32957.1|991425_992043_+	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AZH32958.1|992044_992908_+	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AZH32959.1|992943_993570_-	hydrolase	NA	NA	NA	NA	NA
AZH32960.1|993884_995033_+	MFS transporter	NA	NA	NA	NA	NA
AZH32961.1|995242_996673_+	amino acid permease	NA	NA	NA	NA	NA
AZH32962.1|996882_997680_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
AZH32963.1|997711_998707_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
AZH32964.1|998800_999112_-	XRE family transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
AZH32965.1|999216_999573_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
AZH32966.1|999556_999754_+	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	100.0	2.8e-29
AZH32967.1|999750_1000251_+	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
AZH32968.1|1000315_1000540_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AZH32969.1|1000539_1000842_+	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
AZH32970.1|1000841_1001066_+	hypothetical protein	NA	A0A0F7LDI3	Escherichia_phage	98.6	5.0e-35
AZH32971.1|1001062_1001338_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AZH32972.1|1001327_1003616_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
AZH32973.1|1003894_1004188_+	hypothetical protein	NA	NA	NA	NA	NA
AZH32974.1|1004224_1004545_+	XRE family transcriptional regulator	NA	E5E3S9	Burkholderia_phage	38.7	5.9e-13
AZH32975.1|1004510_1005461_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.8	4.6e-37
AZH32976.1|1005569_1006934_-	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.1	6.7e-05
AZH32977.1|1007446_1008481_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	7.1e-201
AZH32978.1|1008480_1010253_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
AZH32979.1|1010426_1011281_+|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
AZH32980.1|1011335_1012409_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	7.4e-201
AZH32981.1|1012412_1013156_+|terminase	terminase	terminase	Q94MK6	Enterobacteria_phage	97.6	1.6e-122
AZH32982.1|1013255_1013765_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	7.3e-90
AZH32983.1|1013764_1013968_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AZH32984.1|1013971_1014253_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AZH32985.1|1014252_1014750_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.2e-92
AZH32986.1|1014764_1015190_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	95.0	4.7e-58
AZH32987.1|1015177_1015603_+	protein lysB	NA	Q858W0	Yersinia_virus	96.5	1.4e-65
AZH32988.1|1015574_1015748_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AZH32989.1|1015710_1016178_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	9.7e-81
AZH32990.1|1016170_1016623_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
AZH32991.1|1016725_1017799_-	hypothetical protein	NA	NA	NA	NA	NA
AZH36829.1|1017885_1018515_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	95.2	1.8e-106
AZH32992.1|1018511_1018859_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AZH32993.1|1018863_1019772_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
AZH32994.1|1019764_1020295_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	98.9	3.9e-102
AZH32995.1|1020305_1022330_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	71.9	6.5e-299
AZH32996.1|1022331_1022859_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	8.3e-89
AZH32997.1|1023149_1024376_+	DUF4263 domain-containing protein	NA	Q858S8	Enterobacteria_phage	99.4	1.1e-181
AZH32998.1|1024662_1025853_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
1025461:1025478	attR	CGCCGTGACGGTTTCCGC	NA	NA	NA	NA
AZH32999.1|1025865_1026384_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AZH33000.1|1026440_1026716_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AZH36830.1|1026748_1026868_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AZH33001.1|1026860_1029308_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.0	0.0e+00
AZH33002.1|1029322_1029802_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	2.5e-84
AZH33003.1|1029801_1030965_+	hypothetical protein	NA	U5N3V4	Enterobacteria_phage	99.2	4.1e-205
AZH33004.1|1030954_1031266_+	transcriptional regulator	NA	M1SNR2	Escherichia_phage	99.0	1.4e-51
AZH33005.1|1031585_1033868_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
AZH33006.1|1033922_1034780_-	formate transporter FocA	NA	NA	NA	NA	NA
AZH33007.1|1035185_1036946_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AZH33008.1|1037075_1037768_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AZH33009.1|1037966_1039055_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
AZH33010.1|1039125_1040409_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZH33011.1|1040578_1041343_+|protease	metalloprotease	protease	NA	NA	NA	NA
AZH33012.1|1041515_1042199_+	(d)CMP kinase	NA	NA	NA	NA	NA
AZH33013.1|1042309_1043983_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AZH33014.1|1044142_1044427_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AZH33015.1|1044633_1046898_+	ComEC family protein	NA	NA	NA	NA	NA
AZH33016.1|1046934_1048683_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
AZH33017.1|1048679_1049666_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AZH33018.1|1049702_1050935_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZH33019.1|1050986_1051169_+	protein YcaR	NA	NA	NA	NA	NA
AZH33020.1|1051165_1051912_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AZH33021.1|1052065_1052959_+	hypothetical protein	NA	NA	NA	NA	NA
AZH33022.1|1052935_1053715_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AZH33023.1|1053617_1053782_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33024.1|1053850_1054636_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AZH33025.1|1054632_1055955_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AZH33026.1|1055935_1056640_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
AZH33027.1|1056639_1061100_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
AZH33028.1|1061360_1063208_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AZH36831.1|1063388_1063937_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
AZH33029.1|1063963_1064611_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZH33030.1|1064661_1065852_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AZH33031.1|1067716_1069117_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
>prophage 2
CP023820	Escherichia coli strain 7/2 chromosome, complete genome	5099240	1240184	1314338	5099240	portal,tRNA,transposase,head,capsid,tail,terminase,holin,lysis,integrase	Escherichia_phage(34.55%)	91	1241363:1241378	1286782:1286797
AZH33206.1|1240184_1240694_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AZH33207.1|1240815_1241778_-	L,D-transpeptidase	NA	NA	NA	NA	NA
1241363:1241378	attL	GTCAGCGTGTCACCAC	NA	NA	NA	NA
AZH33208.1|1241921_1245368_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AZH33209.1|1245495_1246569_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33210.1|1246829_1248029_+	lipoprotein-releasing system protein LolC	NA	NA	NA	NA	NA
AZH33211.1|1248021_1248723_+	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.8	5.4e-35
AZH33212.1|1248722_1249967_+	lipoprotein-releasing system transmembrane subunit LolE	NA	NA	NA	NA	NA
AZH33213.1|1249995_1250907_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AZH33214.1|1250922_1251744_+	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
AZH33215.1|1251880_1252666_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33216.1|1252662_1253124_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33217.1|1253253_1253763_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AZH33218.1|1253668_1253872_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33219.1|1253892_1254939_-	spermidine/putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
AZH33220.1|1254935_1255730_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AZH33221.1|1255896_1257015_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
AZH33222.1|1256983_1257253_-	excisionase	NA	NA	NA	NA	NA
AZH33223.1|1257314_1259771_-	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	2.5e-103
AZH33224.1|1259848_1260052_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AZH33225.1|1260048_1260237_-	cell division inhibitor	NA	NA	NA	NA	NA
AZH33226.1|1260247_1261102_-	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
AZH36841.1|1261632_1262007_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33227.1|1262018_1262171_-	DUF1391 domain-containing protein	NA	NA	NA	NA	NA
AZH33228.1|1262377_1262785_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
AZH33229.1|1262861_1263089_+	transcriptional regulator	NA	NA	NA	NA	NA
AZH33230.1|1263072_1263624_+	hypothetical protein	NA	NA	NA	NA	NA
AZH33231.1|1264424_1265090_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.4e-79
AZH33232.1|1265123_1265894_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
AZH33233.1|1265894_1266302_+	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	63.3	1.6e-39
AZH33234.1|1266298_1266595_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
AZH33235.1|1266591_1267053_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
AZH33236.1|1267030_1267387_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
AZH33237.1|1267482_1267890_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	1.0e-22
AZH33238.1|1267891_1268257_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
AZH33239.1|1268253_1269240_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
AZH33240.1|1269360_1269540_+	hypothetical protein	NA	NA	NA	NA	NA
AZH33241.1|1269798_1269954_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AZH33242.1|1270170_1270422_+	hypothetical protein	NA	NA	NA	NA	NA
AZH33243.1|1270488_1270767_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
AZH33244.1|1270768_1271827_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
AZH33245.1|1271827_1272196_+	hypothetical protein	NA	V5URS4	Shigella_phage	62.8	2.4e-34
AZH33246.1|1272188_1272878_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
AZH33247.1|1272955_1273288_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.4	7.0e-33
AZH33248.1|1273657_1273993_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
AZH33249.1|1274238_1274442_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
AZH33250.1|1274438_1274600_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
AZH33251.1|1274749_1274965_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AZH33252.1|1274969_1275860_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
AZH33253.1|1275896_1276430_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
AZH33254.1|1276553_1276769_+	hypothetical protein	NA	NA	NA	NA	NA
AZH36842.1|1276917_1277385_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
AZH33255.1|1277641_1278022_+	hypothetical protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AZH33256.1|1278144_1278498_-	hypothetical protein	NA	NA	NA	NA	NA
AZH36843.1|1278385_1278706_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33257.1|1278640_1278859_+	DNA-packaging protein	NA	NA	NA	NA	NA
AZH33258.1|1278980_1279490_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AZH33259.1|1279461_1281390_+|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
AZH33260.1|1281373_1281580_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
AZH33261.1|1281576_1283169_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
AZH33262.1|1283158_1284664_+	scaffolding protein	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
AZH33263.1|1284700_1285048_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
AZH33264.1|1285105_1286134_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.9	4.1e-116
AZH33265.1|1286137_1286560_+	hypothetical protein	NA	NA	NA	NA	NA
AZH33266.1|1286552_1286906_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
1286782:1286797	attR	GTGGTGACACGCTGAC	NA	NA	NA	NA
AZH33267.1|1286921_1287497_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.6e-48
AZH33268.1|1287493_1287889_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AZH33269.1|1287896_1288649_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
AZH33270.1|1288662_1289094_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
AZH33271.1|1289120_1289534_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AZH33272.1|1289514_1292076_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
AZH33273.1|1292072_1292402_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AZH33274.1|1292401_1293100_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	3.2e-128
AZH33275.1|1293110_1293854_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
AZH33276.1|1293751_1294432_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	3.7e-113
AZH33277.1|1294775_1298468_+|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
AZH33278.1|1298535_1299135_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
AZH33279.1|1299286_1302313_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
AZH33280.1|1302312_1302897_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
AZH33281.1|1302869_1303007_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AZH36844.1|1302951_1303578_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZH33282.1|1303676_1303943_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
AZH33283.1|1304174_1305038_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AZH33284.1|1305021_1306158_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AZH33285.1|1306136_1306352_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33286.1|1306407_1307634_+	peptidase T	NA	NA	NA	NA	NA
AZH33287.1|1307682_1308804_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AZH33288.1|1308879_1310340_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AZH33289.1|1310339_1311011_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AZH33290.1|1311180_1312551_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AZH36845.1|1312554_1313196_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AZH33291.1|1313231_1314338_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 3
CP023820	Escherichia coli strain 7/2 chromosome, complete genome	5099240	1536217	1588126	5099240	tRNA,coat,tail,terminase,holin,integrase	Escherichia_phage(52.08%)	64	1527113:1527128	1570097:1570112
1527113:1527128	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
AZH33501.1|1536217_1537150_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	2.3e-17
AZH33502.1|1538481_1539465_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AZH33503.1|1539739_1539913_+	hypothetical protein	NA	NA	NA	NA	NA
AZH33504.1|1539942_1541316_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AZH33505.1|1541444_1542380_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AZH33506.1|1542431_1543667_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
AZH33507.1|1543668_1543884_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AZH36861.1|1543983_1544172_-	hypothetical protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
AZH36860.1|1544209_1544359_-	restriction endonuclease	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
AZH33508.1|1544414_1545224_-	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
AZH33509.1|1545216_1547817_-	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
AZH33510.1|1547918_1548194_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
AZH36862.1|1548268_1548439_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AZH33511.1|1548438_1548660_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AZH36863.1|1548875_1549067_+	hypothetical protein	NA	NA	NA	NA	NA
AZH33512.1|1549101_1549590_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
AZH33513.1|1549586_1549742_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AZH33514.1|1549752_1549932_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33515.1|1549919_1550138_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33516.1|1550174_1550594_-	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
AZH33517.1|1550673_1550928_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AZH33518.1|1550924_1551347_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
AZH33519.1|1551424_1552213_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
AZH33520.1|1552219_1552966_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.5	1.1e-110
AZH33521.1|1552937_1553750_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.6e-115
AZH33522.1|1553765_1554188_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	7.4e-64
AZH36864.1|1554607_1554853_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	4.5e-13
AZH33523.1|1554973_1555747_-	DNA-binding protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
AZH33524.1|1556269_1556395_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.2	4.0e-10
AZH36865.1|1556477_1556819_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
AZH33525.1|1557686_1558286_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
AZH33526.1|1558285_1558576_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
AZH33527.1|1558572_1559115_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
AZH33528.1|1559336_1559906_+	hypothetical protein	NA	NA	NA	NA	NA
AZH33529.1|1559874_1560177_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33530.1|1560253_1560595_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
AZH33531.1|1560598_1561075_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	95.6	5.0e-85
AZH33532.1|1561291_1561477_+	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AZH33533.1|1561673_1563131_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AZH33534.1|1563069_1563351_+	hypothetical protein	NA	NA	NA	NA	NA
AZH33535.1|1563268_1564060_+	transcriptional regulator	NA	R4TG31	Halovirus	40.2	2.8e-48
AZH33536.1|1564052_1564985_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
AZH33537.1|1564962_1565172_+	hypothetical protein	NA	NA	NA	NA	NA
AZH33538.1|1565175_1566270_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	4.5e-113
AZH33539.1|1566250_1567552_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
AZH33540.1|1567554_1568961_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
AZH33541.1|1568944_1570057_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
AZH33542.1|1570161_1570926_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	9.0e-84
1570097:1570112	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
AZH33543.1|1571024_1572164_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	75.0	9.7e-159
AZH33544.1|1572206_1572383_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
AZH33545.1|1572386_1572782_+	protein singed	NA	NA	NA	NA	NA
AZH33546.1|1572781_1573165_+	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
AZH33547.1|1573165_1573546_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
AZH33548.1|1573542_1573935_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AZH33549.1|1573961_1574924_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
AZH33550.1|1574984_1575434_+	hypothetical protein	NA	NA	NA	NA	NA
AZH33551.1|1575541_1575742_+	hypothetical protein	NA	NA	NA	NA	NA
AZH33552.1|1575905_1579139_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	7.4e-103
AZH33553.1|1579131_1579470_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
AZH33554.1|1579469_1580168_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
AZH33555.1|1580173_1580917_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	1.0e-145
AZH33556.1|1581515_1584995_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
AZH33557.1|1585062_1585662_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
AZH33558.1|1585726_1588126_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
>prophage 4
CP023820	Escherichia coli strain 7/2 chromosome, complete genome	5099240	1738957	1856812	5099240	portal,capsid,tail,terminase,protease,head,integrase,lysis,transposase	Enterobacteria_phage(38.98%)	125	1798116:1798131	1850814:1850829
AZH33685.1|1738957_1740919_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	27.9	1.6e-23
AZH33686.1|1740991_1741528_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZH33687.1|1741580_1742792_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
AZH33688.1|1742899_1743409_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AZH33689.1|1743535_1744204_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
AZH33690.1|1744506_1745100_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
AZH33691.1|1745096_1746089_-	TDT family transporter	NA	NA	NA	NA	NA
AZH33692.1|1746212_1747193_+	hypothetical protein	NA	NA	NA	NA	NA
AZH33693.1|1747184_1747724_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
AZH33694.1|1747786_1748011_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33695.1|1748026_1748230_+	hypothetical protein	NA	NA	NA	NA	NA
AZH33696.1|1748150_1749806_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AZH33697.1|1750030_1751374_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
AZH33698.1|1751590_1752514_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZH33699.1|1752551_1754192_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
AZH33700.1|1754255_1754444_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33701.1|1754590_1754740_+	type I toxin-antitoxin system hok family toxin	NA	NA	NA	NA	NA
AZH33702.1|1754811_1754985_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	4.4e-07
AZH33703.1|1755229_1755760_-	cytochrome B	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
AZH33704.1|1755948_1756950_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZH33705.1|1756991_1758431_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AZH33706.1|1758627_1759428_-	YdcF family protein	NA	NA	NA	NA	NA
AZH33707.1|1759543_1759921_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33708.1|1760040_1760490_-	hypothetical protein	NA	NA	NA	NA	NA
AZH36871.1|1760476_1760815_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33709.1|1761099_1765002_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
AZH33710.1|1765202_1765808_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AZH36872.1|1765861_1767154_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33711.1|1767167_1768925_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33712.1|1769836_1770442_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
AZH33713.1|1770612_1772919_-	DUF2773 domain-containing protein	NA	NA	NA	NA	NA
AZH33714.1|1772982_1773843_-	oxidoreductase	NA	NA	NA	NA	NA
AZH36873.1|1774050_1776459_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
AZH33715.1|1780532_1780856_-	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
AZH33716.1|1780863_1781049_-	lipoprotein	NA	NA	NA	NA	NA
AZH33717.1|1781045_1783685_-	YdbH family protein	NA	NA	NA	NA	NA
AZH33718.1|1783892_1784882_+	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
AZH33719.1|1784992_1785415_+	heat-inducible protein	NA	NA	NA	NA	NA
AZH33720.1|1785411_1785678_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AZH33721.1|1785951_1789476_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AZH33722.1|1789842_1790976_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
AZH33723.1|1791116_1791551_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AZH33724.1|1792135_1793050_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZH33725.1|1793049_1793877_+	manganese/iron transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
AZH33726.1|1793873_1794731_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AZH33727.1|1794727_1795585_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AZH33728.1|1796057_1796852_+	hypothetical protein	NA	NA	NA	NA	NA
AZH36874.1|1797397_1797691_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33729.1|1797733_1798774_-	peptidase S74	NA	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
1798116:1798131	attL	GCATGACATGCACCAT	NA	NA	NA	NA
AZH33730.1|1798783_1799065_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
AZH33731.1|1799064_1801440_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
AZH33732.1|1801504_1802104_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
AZH33733.1|1802171_1805651_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
AZH33734.1|1805711_1806353_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	1.1e-95
AZH33735.1|1806250_1806994_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
AZH33736.1|1806999_1807698_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
AZH33737.1|1807697_1808027_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AZH33738.1|1808023_1810585_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.9	0.0e+00
AZH33739.1|1810577_1811012_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AZH33740.1|1810993_1811416_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AZH36875.1|1811431_1812172_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
AZH33741.1|1812179_1812575_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AZH33742.1|1812571_1813150_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
AZH33743.1|1813161_1813515_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
AZH33744.1|1813526_1813925_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
AZH33745.1|1813966_1814992_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
AZH33746.1|1815046_1815379_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AZH33747.1|1815388_1816708_-|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
AZH33748.1|1816688_1818290_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
AZH33749.1|1818286_1818493_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AZH33750.1|1818489_1820415_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AZH33751.1|1820389_1820935_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AZH33752.1|1821323_1821557_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AZH33753.1|1821614_1822025_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AZH33754.1|1822950_1823127_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AZH36876.1|1823298_1823454_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33755.1|1823601_1823790_-	cold-shock protein	NA	NA	NA	NA	NA
AZH33756.1|1823800_1824013_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AZH33757.1|1824375_1824873_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AZH33758.1|1824869_1825403_-	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AZH33759.1|1825399_1825711_-	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AZH33760.1|1825715_1825931_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AZH33761.1|1826487_1826997_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AZH33762.1|1826902_1827148_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33763.1|1827396_1827612_-	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AZH33764.1|1827912_1828125_+	cold-shock protein CspF	NA	NA	NA	NA	NA
AZH33765.1|1828546_1829299_-	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AZH33766.1|1829312_1830362_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
AZH33767.1|1830363_1830642_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33768.1|1830708_1830960_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33769.1|1831176_1831332_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AZH33770.1|1831403_1831691_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AZH33771.1|1831690_1831930_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AZH33772.1|1831954_1832260_+	hypothetical protein	NA	NA	NA	NA	NA
AZH33773.1|1832462_1832795_+	protein FlxA	NA	NA	NA	NA	NA
AZH33774.1|1833231_1834545_-|transposase	transposase	transposase	NA	NA	NA	NA
AZH33775.1|1835028_1836057_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
AZH33776.1|1836053_1836668_-	hypothetical protein	NA	NA	NA	NA	NA
AZH36877.1|1836876_1837542_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33777.1|1837744_1838143_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
AZH33778.1|1838183_1839203_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.8e-56
AZH33779.1|1839129_1839651_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33780.1|1839634_1839862_-	transcriptional regulator	NA	NA	NA	NA	NA
AZH33781.1|1839942_1840350_+	transcriptional regulator	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
AZH33782.1|1840518_1840674_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AZH33783.1|1840633_1841251_+	hypothetical protein	NA	NA	NA	NA	NA
AZH33784.1|1841737_1841926_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AZH33785.1|1841922_1842114_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AZH33786.1|1842207_1844679_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
AZH33787.1|1844751_1845003_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AZH33788.1|1844995_1845112_-	copper resistance protein	NA	NA	NA	NA	NA
AZH33789.1|1845073_1845751_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AZH33790.1|1845750_1846098_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AZH33791.1|1846117_1847689_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
AZH33792.1|1847729_1849025_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	5.1e-156
AZH33793.1|1849026_1849155_-	transporter	NA	NA	NA	NA	NA
AZH33794.1|1849212_1850232_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AZH33795.1|1850243_1851458_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
1850814:1850829	attR	ATGGTGCATGTCATGC	NA	NA	NA	NA
AZH33796.1|1851438_1851627_-	hypothetical protein	NA	NA	NA	NA	NA
AZH33797.1|1851663_1851990_-	hypothetical protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
AZH33798.1|1852124_1852466_+	hypothetical protein	NA	NA	NA	NA	NA
AZH33799.1|1852500_1853061_+	spermidine acetyltransferase	NA	NA	NA	NA	NA
AZH36878.1|1853063_1853774_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AZH33800.1|1853881_1854187_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AZH33801.1|1854385_1856812_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
>prophage 5
CP023820	Escherichia coli strain 7/2 chromosome, complete genome	5099240	2342712	2350230	5099240		Escherichia_phage(42.86%)	8	NA	NA
AZH34263.1|2342712_2343261_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
AZH34264.1|2343265_2344144_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
AZH34265.1|2344201_2345101_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
AZH34266.1|2345100_2346186_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
AZH34267.1|2346257_2346521_+	hypothetical protein	NA	NA	NA	NA	NA
AZH34268.1|2346557_2347451_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AZH34269.1|2347682_2348678_-	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
AZH34270.1|2348835_2350230_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
>prophage 6
CP023820	Escherichia coli strain 7/2 chromosome, complete genome	5099240	2397635	2436631	5099240	portal,capsid,holin,tail,terminase,head,plate,lysis,integrase	Escherichia_phage(44.19%)	49	2401924:2401950	2434803:2434829
AZH34305.1|2397635_2399039_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
AZH34306.1|2399035_2399758_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AZH34307.1|2399937_2400270_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AZH34308.1|2400417_2401779_+	U32 family peptidase	NA	Q6DW11	Phage_TP	99.2	1.6e-216
2401924:2401950	attL	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
AZH34309.1|2402051_2402306_-	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AZH34310.1|2402351_2403515_-	hypothetical protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
AZH34311.1|2403514_2403994_-|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
AZH34312.1|2404008_2406456_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
AZH34313.1|2406448_2406568_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AZH34314.1|2406600_2406876_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
AZH34315.1|2406932_2407451_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AZH34316.1|2407463_2408654_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
AZH34317.1|2408983_2409577_-	lysogenic conversion protein	NA	Q858S7	Enterobacteria_phage	99.0	1.0e-106
AZH34318.1|2409798_2410326_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	4.9e-89
AZH34319.1|2410327_2412349_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.2	8.6e-259
AZH34320.1|2412359_2412890_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
AZH34321.1|2412882_2413791_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
AZH34322.1|2413795_2414143_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AZH34323.1|2414139_2414775_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
AZH34324.1|2414858_2415644_+	hypothetical protein	NA	NA	NA	NA	NA
AZH34325.1|2415715_2416168_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
AZH34326.1|2416160_2416628_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
AZH34327.1|2416590_2416764_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
AZH34328.1|2416735_2417161_-	protein lysB	NA	Q858W0	Yersinia_virus	98.6	1.9e-67
AZH34329.1|2417148_2417574_-	protein lysA	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
AZH34330.1|2417588_2418086_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AZH34331.1|2418085_2418367_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AZH34332.1|2418370_2418574_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AZH34333.1|2418573_2419083_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
AZH34334.1|2419182_2419926_-|terminase	terminase	terminase	A0A0F7LDU4	Escherichia_phage	99.2	3.0e-124
AZH34335.1|2419929_2421003_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	2.5e-201
AZH34336.1|2421061_2421916_-|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	8.1e-134
AZH34337.1|2422089_2423862_+	oxidoreductase	NA	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
AZH34338.1|2423861_2424896_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.7e-200
AZH34339.1|2424934_2425159_-	hypothetical protein	NA	M1TAP7	Escherichia_phage	94.3	8.6e-19
AZH34340.1|2425282_2426707_+	ATP-binding protein	NA	NA	NA	NA	NA
AZH34341.1|2426703_2427696_+	hypothetical protein	NA	NA	NA	NA	NA
AZH34342.1|2427646_2428798_-	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.2	1.4e-32
AZH34343.1|2431133_2431409_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	1.5e-44
AZH34344.1|2431405_2431630_-	hypothetical protein	NA	A0A0F7LDG9	Escherichia_phage	98.6	3.8e-35
AZH34345.1|2431629_2431932_-	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
AZH34346.1|2431931_2432156_-	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AZH34347.1|2432219_2432720_-	replication protein B	NA	S4TTB7	Salmonella_phage	98.8	1.9e-90
AZH34348.1|2432897_2433173_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	98.9	2.2e-48
AZH34349.1|2433294_2433594_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
AZH34350.1|2433709_2434723_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
AZH34351.1|2434820_2435012_-	hypothetical protein	NA	NA	NA	NA	NA
2434803:2434829	attR	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
AZH34352.1|2434999_2435317_-	hypothetical protein	NA	NA	NA	NA	NA
AZH34353.1|2435731_2436631_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
>prophage 7
CP023820	Escherichia coli strain 7/2 chromosome, complete genome	5099240	2473450	2481083	5099240		Enterobacteria_phage(100.0%)	7	NA	NA
AZH34381.1|2473450_2474587_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
AZH34382.1|2474583_2476584_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AZH34383.1|2476708_2477170_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AZH34384.1|2477211_2477682_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AZH34385.1|2477728_2478448_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZH34386.1|2478444_2480130_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
AZH34387.1|2480351_2481083_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
>prophage 8
CP023820	Escherichia coli strain 7/2 chromosome, complete genome	5099240	2683643	2768709	5099240	portal,tRNA,transposase,capsid,holin,terminase,head,lysis,integrase	Enterobacteria_phage(54.69%)	106	2727498:2727520	2776448:2776470
AZH34567.1|2683643_2684546_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	44.2	2.4e-67
AZH34568.1|2684742_2685516_-	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
AZH34569.1|2685523_2686240_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
AZH34570.1|2686236_2686923_-	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
AZH34571.1|2687012_2687795_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
AZH34572.1|2688015_2688798_-	lysine/arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZH34573.1|2689063_2689633_-	3-octaprenyl-4-hydroxybenzoate carboxy-lyase	NA	NA	NA	NA	NA
AZH34574.1|2689727_2691245_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
AZH34575.1|2691281_2691770_-	colicin V production protein	NA	NA	NA	NA	NA
AZH34576.1|2692028_2692679_-	cell division protein DedD	NA	NA	NA	NA	NA
AZH34577.1|2692668_2693937_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AZH34578.1|2694006_2694921_-	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AZH34579.1|2695076_2695736_-	hypothetical protein	NA	NA	NA	NA	NA
AZH34580.1|2695818_2696631_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AZH34581.1|2696630_2697644_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZH34582.1|2697709_2698846_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.0e-23
AZH34583.1|2698944_2699940_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AZH34584.1|2699936_2701115_-	arabinose transporter	NA	NA	NA	NA	NA
AZH34585.1|2701390_2702611_-	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
AZH34586.1|2702769_2704776_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AZH34587.1|2704831_2705110_-	hypothetical protein	NA	NA	NA	NA	NA
AZH34588.1|2705143_2705692_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AZH34589.1|2705691_2706501_-	hypothetical protein	NA	NA	NA	NA	NA
AZH34590.1|2706500_2707325_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AZH34591.1|2707328_2708414_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
AZH34592.1|2708448_2709381_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AZH34593.1|2709546_2710098_+	endonuclease SmrB	NA	NA	NA	NA	NA
AZH34594.1|2710167_2711031_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AZH34595.1|2711032_2711578_-	fimbrial protein	NA	NA	NA	NA	NA
AZH34596.1|2711574_2712054_-	fimbrial protein	NA	NA	NA	NA	NA
AZH34597.1|2712050_2712542_-	hypothetical protein	NA	NA	NA	NA	NA
AZH34598.1|2712557_2713307_-	fimbrial protein	NA	NA	NA	NA	NA
AZH34599.1|2713326_2715966_-	outer membrane usher protein	NA	NA	NA	NA	NA
AZH34600.1|2716049_2716616_-	fimbrial protein	NA	NA	NA	NA	NA
AZH34601.1|2717277_2717763_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AZH34602.1|2717965_2720110_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AZH34603.1|2720109_2721420_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AZH34604.1|2721600_2721885_-	hypothetical protein	NA	NA	NA	NA	NA
AZH34605.1|2721969_2722221_-	hypothetical protein	NA	NA	NA	NA	NA
AZH34606.1|2722256_2723597_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AZH34607.1|2723962_2725210_+	hypothetical protein	NA	NA	NA	NA	NA
AZH34608.1|2725388_2726144_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AZH34609.1|2726169_2726340_-	hypothetical protein	NA	NA	NA	NA	NA
AZH34610.1|2726437_2727370_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
2727498:2727520	attL	TTCGATTCCTGCAGGGGACACCA	NA	NA	NA	NA
AZH34611.1|2727681_2728839_+|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	99.2	3.7e-222
AZH34612.1|2728955_2729612_-	hypothetical protein	NA	NA	NA	NA	NA
AZH34613.1|2729612_2730344_+	hypothetical protein	NA	NA	NA	NA	NA
AZH34614.1|2730463_2732863_-|head	phage head protein	head	A5VW57	Enterobacteria_phage	90.6	8.0e-78
AZH34615.1|2733027_2735421_-	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	96.8	0.0e+00
AZH34616.1|2735421_2736753_-	acyltransferase	NA	A0A2D1GLX5	Escherichia_phage	98.2	5.5e-214
AZH34617.1|2736762_2737455_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.7e-111
AZH34618.1|2737457_2737913_-	hypothetical protein	NA	A5VW67	Enterobacteria_phage	97.4	2.8e-85
AZH34619.1|2737912_2738866_-	hypothetical protein	NA	Q716G6	Shigella_phage	84.9	5.4e-94
AZH34620.1|2738865_2740284_-	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	98.7	2.3e-274
AZH34621.1|2740292_2740775_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
AZH34622.1|2740749_2740935_-	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
AZH34623.1|2740977_2742249_-|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	7.3e-240
AZH34624.1|2742260_2743145_-|capsid	phage capsid protein	capsid	Q716H1	Shigella_phage	99.7	8.1e-145
AZH34625.1|2743158_2745285_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.6	0.0e+00
AZH34626.1|2745287_2746700_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	5.8e-278
AZH36906.1|2746696_2747119_-	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	100.0	7.2e-75
AZH34627.1|2747142_2747322_-	hypothetical protein	NA	Q9AZ02	Salmonella_phage	93.2	1.2e-23
AZH34628.1|2747331_2747619_-	hypothetical protein	NA	I1TQD4	Pseudomonas_phage	33.3	1.3e-06
AZH34629.1|2747622_2747865_-	hypothetical protein	NA	A5VW77	Enterobacteria_phage	100.0	3.7e-36
AZH34630.1|2748159_2748447_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	60.0	1.8e-29
AZH34631.1|2748526_2748679_-	hypothetical protein	NA	Q716B2	Shigella_phage	98.0	6.2e-21
AZH34632.1|2748666_2749104_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.9	5.0e-71
AZH34633.1|2749100_2749577_-	lysozyme	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
AZH34634.1|2749560_2749884_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AZH34635.1|2750131_2750359_+	hypothetical protein	NA	NA	NA	NA	NA
AZH34636.1|2750411_2750900_-	antiterminator	NA	M1FPN0	Enterobacteria_phage	98.1	2.9e-88
AZH34637.1|2750896_2751085_-	protein ninH	NA	A5VW84	Enterobacteria_phage	98.4	7.2e-27
AZH34638.1|2751081_2751444_-	hypothetical protein	NA	K7P6I9	Enterobacteria_phage	99.2	4.6e-62
AZH34639.1|2751440_2751731_-	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	96.9	2.1e-49
AZH34640.1|2751730_2752453_-	DNA-binding protein	NA	A5VW87	Enterobacteria_phage	99.2	4.6e-130
AZH34641.1|2752445_2752616_-	protein ninF	NA	K7P6X0	Enterobacteria_phage	100.0	5.5e-26
AZH36907.1|2752612_2752795_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.6e-28
AZH34642.1|2752791_2753250_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.3e-81
AZH34643.1|2753309_2755190_-	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	100.0	0.0e+00
AZH34644.1|2755297_2756158_-	replication protein	NA	A0A088CPU2	Enterobacteria_phage	100.0	3.9e-160
AZH34645.1|2756150_2756297_-	hypothetical protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
AZH34646.1|2756329_2756629_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	98.0	1.4e-48
AZH34647.1|2756767_2756968_-	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	100.0	3.3e-30
AZH34648.1|2757068_2757782_+	LexA family transcriptional repressor	NA	A4KWS8	Enterobacteria_phage	100.0	2.1e-127
AZH34649.1|2758207_2758474_+	hypothetical protein	NA	Q9MCQ3	Enterobacteria_phage	100.0	7.7e-43
AZH34650.1|2758641_2759112_+	hypothetical protein	NA	K7P6H4	Enterobacteria_phage	100.0	2.1e-75
AZH34651.1|2759605_2759989_+	antitermination protein	NA	A4KWV5	Enterobacteria_phage	100.0	3.9e-64
AZH34652.1|2760117_2760318_+	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
AZH34653.1|2760439_2760679_+	hypothetical protein	NA	K7P848	Enterobacteria_phage	96.7	6.5e-25
AZH34654.1|2760663_2760816_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
AZH34655.1|2760900_2761209_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
AZH34656.1|2761205_2762117_+	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	98.7	2.4e-168
AZH34657.1|2762100_2762583_+	hypothetical protein	NA	K7P6T5	Enterobacteria_phage	97.5	6.1e-78
AZH34658.1|2762594_2762909_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
AZH34659.1|2762925_2763207_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
AZH34660.1|2763203_2763371_+	DUF2737 domain-containing protein	NA	Q716F2	Shigella_phage	98.2	5.0e-24
AZH34661.1|2763367_2763622_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	3.2e-38
AZH34662.1|2763608_2764301_+	hypothetical protein	NA	A0A088CC42	Shigella_phage	55.4	1.2e-82
AZH34663.1|2764272_2764512_+	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	96.0	8.8e-38
AZH34664.1|2764508_2765300_+	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	51.8	1.0e-58
AZH34665.1|2765292_2765577_+	RNA-binding protein	NA	A0A2D1GLL3	Escherichia_phage	94.7	9.4e-47
AZH34666.1|2765648_2765816_+	hypothetical protein	NA	K7P728	Enterobacteria_phage	92.7	9.2e-26
AZH34667.1|2765873_2766074_+	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AZH34668.1|2766326_2767613_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	37.3	1.1e-65
AZH36908.1|2767614_2768361_+	hypothetical protein	NA	NA	NA	NA	NA
AZH34669.1|2768517_2768709_+	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
2776448:2776470	attR	TTCGATTCCTGCAGGGGACACCA	NA	NA	NA	NA
>prophage 9
CP023820	Escherichia coli strain 7/2 chromosome, complete genome	5099240	3143155	3150295	5099240		Escherichia_phage(83.33%)	6	NA	NA
AZH34996.1|3143155_3145717_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
AZH34997.1|3145822_3146479_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
AZH34998.1|3146529_3147297_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AZH34999.1|3147492_3148401_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
AZH35000.1|3148397_3149660_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AZH35001.1|3149656_3150295_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 10
CP023820	Escherichia coli strain 7/2 chromosome, complete genome	5099240	4887727	4939811	5099240	tRNA,protease,holin,integrase,transposase	uncultured_Caudovirales_phage(14.29%)	50	4905478:4905493	4931494:4931509
AZH36595.1|4887727_4889080_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AZH36596.1|4889263_4889650_+	cytochrome b562	NA	NA	NA	NA	NA
AZH36597.1|4889841_4890084_+	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	50.0	1.4e-14
AZH36598.1|4890073_4890364_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	63.8	3.8e-27
AZH36599.1|4890364_4890829_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	K4F9T1	Cronobacter_phage	57.1	8.5e-53
AZH36600.1|4891013_4893152_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
AZH36601.1|4893545_4895201_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AZH36602.1|4895250_4896672_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AZH36603.1|4896790_4897738_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
AZH36604.1|4898116_4900813_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	3.4e-45
AZH36605.1|4901018_4901405_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AZH36606.1|4901477_4901939_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AZH36607.1|4901951_4902887_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
AZH36608.1|4902890_4903025_-	pyrBI operon leader peptide	NA	NA	NA	NA	NA
AZH36609.1|4903154_4903337_+	hypothetical protein	NA	NA	NA	NA	NA
AZH36610.1|4903305_4903701_-	hypothetical protein	NA	NA	NA	NA	NA
AZH36611.1|4903831_4904545_-	oxidoreductase	NA	NA	NA	NA	NA
AZH36612.1|4904615_4905209_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZH36613.1|4905353_4905806_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
4905478:4905493	attL	ATCGTCTGTTTTATCT	NA	NA	NA	NA
AZH36614.1|4905928_4907524_+	DNA-binding protein	NA	NA	NA	NA	NA
AZH36615.1|4907579_4908584_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AZH36616.1|4908745_4909162_+	regulator of ribonuclease activity B	NA	NA	NA	NA	NA
AZH36617.1|4909207_4909711_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZH36618.1|4909903_4911100_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
AZH36619.1|4911155_4914011_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
AZH36620.1|4914010_4914454_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AZH36621.1|4914807_4916319_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AZH36622.1|4916585_4917686_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AZH36623.1|4917685_4918768_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AZH36624.1|4918928_4920431_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.9	1.4e-83
AZH36625.1|4920508_4921507_-	transcriptional regulator	NA	NA	NA	NA	NA
AZH36626.1|4921573_4922893_-	gluconate permease	NA	NA	NA	NA	NA
AZH36627.1|4922955_4923720_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AZH36628.1|4923743_4924775_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
AZH36629.1|4924991_4925555_+	thermosensitive gluconokinase	NA	NA	NA	NA	NA
AZH36630.1|4925558_4926578_-	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
AZH36631.1|4926895_4927090_+	hypothetical protein	NA	NA	NA	NA	NA
AZH36985.1|4927118_4928309_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.1	9.4e-72
AZH36632.1|4929820_4930051_-	hypothetical protein	NA	NA	NA	NA	NA
AZH36633.1|4930066_4930261_+	hypothetical protein	NA	NA	NA	NA	NA
AZH36634.1|4930964_4931108_+	hypothetical protein	NA	NA	NA	NA	NA
AZH36635.1|4931135_4932464_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
4931494:4931509	attR	ATCGTCTGTTTTATCT	NA	NA	NA	NA
AZH36636.1|4933090_4934308_+	MFS transporter	NA	NA	NA	NA	NA
AZH36986.1|4934319_4935438_+	oxidoreductase	NA	NA	NA	NA	NA
AZH36637.1|4935480_4935606_+	hypothetical protein	NA	NA	NA	NA	NA
AZH36638.1|4935658_4936054_-	hypothetical protein	NA	NA	NA	NA	NA
AZH36639.1|4936229_4937396_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
AZH36640.1|4937331_4937745_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AZH36641.1|4937704_4937863_-|holin	choline transporter	holin	NA	NA	NA	NA
AZH36642.1|4937807_4939811_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
>prophage 1
CP023821	Escherichia coli strain 7/2 plasmid p7_2.1, complete sequence	113737	1445	7593	113737	transposase	Stx2-converting_phage(33.33%)	9	NA	NA
AZH36997.1|1445_3059_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	2.3e-182
AZH36998.1|3089_3440_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AZH36999.1|3436_3862_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AZH37000.1|3962_4172_-	transcriptional regulator	NA	NA	NA	NA	NA
AZH37001.1|4217_4754_-	endonuclease	NA	A0A0R6PHV6	Moraxella_phage	37.1	3.8e-20
AZH37002.1|4923_5136_-	hypothetical protein	NA	NA	NA	NA	NA
AZH37003.1|5264_5825_-	fertility inhibition protein	NA	NA	NA	NA	NA
AZH37004.1|5927_6788_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.8	6.7e-11
AZH37005.1|6846_7593_-	protein TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	2.4e-09
>prophage 2
CP023821	Escherichia coli strain 7/2 plasmid p7_2.1, complete sequence	113737	55654	92712	113737	integrase,transposase	Escherichia_phage(31.25%)	36	61016:61036	79682:79702
AZH37062.1|55654_56875_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AZH37063.1|56893_57412_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
AZH37064.1|57546_57795_+	DinI family protein	NA	Q2A098	Sodalis_phage	48.0	1.2e-13
AZH37065.1|57791_58229_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	47.6	1.1e-25
AZH37066.1|59351_60524_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
AZH37067.1|60520_61321_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
61016:61036	attL	GATGAAATAGGCTATCTGCCG	NA	NA	NA	NA
AZH37068.1|61385_61634_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	60.3	5.0e-20
AZH37069.1|61638_62067_-	plasmid stability protein	NA	NA	NA	NA	NA
AZH37070.1|62035_63007_-	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
AZH37071.1|63235_63880_+	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
AZH37072.1|63873_64149_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AZH37073.1|64286_65096_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
AZH37074.1|65096_65402_-	toxin CcdB	NA	NA	NA	NA	NA
AZH37075.1|65403_65622_-	antitoxin CcdA	NA	NA	NA	NA	NA
AZH37076.1|66259_66487_+	hypothetical protein	NA	NA	NA	NA	NA
AZH37127.1|67725_67956_-	hypothetical protein	NA	NA	NA	NA	NA
AZH37077.1|67942_68584_+	hypothetical protein	NA	NA	NA	NA	NA
AZH37078.1|68640_68847_+	hypothetical protein	NA	NA	NA	NA	NA
AZH37079.1|68960_69449_+	hypothetical protein	NA	NA	NA	NA	NA
AZH37080.1|69758_70736_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.5	6.1e-101
AZH37081.1|70978_71719_-	recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
AZH37082.1|71839_72028_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AZH37083.1|72394_73564_+	hypothetical protein	NA	NA	NA	NA	NA
AZH37084.1|74410_74683_-	transcriptional regulator	NA	NA	NA	NA	NA
AZH37085.1|75925_77896_+	ligand-gated channel	NA	NA	NA	NA	NA
AZH37086.1|77902_78694_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
AZH37087.1|79432_80215_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
79682:79702	attR	CGGCAGATAGCCTATTTCATC	NA	NA	NA	NA
AZH37088.1|80211_81234_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
AZH37089.1|82313_82661_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AZH37090.1|82657_83062_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
AZH37091.1|83563_85087_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
AZH37092.1|85380_85752_+	hypothetical protein	NA	NA	NA	NA	NA
AZH37093.1|87337_88612_-	TieB	NA	NA	NA	NA	NA
AZH37094.1|88581_90843_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZH37095.1|91011_91788_-	energy transducer TonB	NA	NA	NA	NA	NA
AZH37096.1|92007_92712_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
