The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP023826	Escherichia coli strain 4/4 chromosome, complete genome	5129468	133757	162292	5129468	bacteriocin,transposase	Erysipelothrix_phage(20.0%)	31	NA	NA
AZH37365.1|133757_134042_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH37366.1|134209_134449_+	hypothetical protein	NA	NA	NA	NA	NA
AZH37367.1|134449_134740_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH37368.1|134906_135095_+	HNH endonuclease	NA	NA	NA	NA	NA
AZH37369.1|135148_135439_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH37370.1|135606_135846_+	hypothetical protein	NA	NA	NA	NA	NA
AZH37371.1|135846_136137_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH37372.1|136592_137357_+	pyruvate dehydrogenase complex repressor	NA	NA	NA	NA	NA
AZH37373.1|137353_137536_-	hypothetical protein	NA	NA	NA	NA	NA
AZH37374.1|137517_140181_+	pyruvate dehydrogenase E1 component	NA	NA	NA	NA	NA
AZH37375.1|140195_142088_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AZH37376.1|142295_143720_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
AZH37377.1|143790_145554_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AZH37378.1|145811_145928_+	aconitate hydratase	NA	NA	NA	NA	NA
AZH37379.1|145908_148506_+	aconitate hydratase B	NA	NA	NA	NA	NA
AZH37380.1|148680_149043_+	UPF0231 family protein	NA	NA	NA	NA	NA
AZH37381.1|149080_149875_-	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AZH37382.1|149890_150757_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AZH37383.1|150862_151210_-	hypothetical protein	NA	NA	NA	NA	NA
AZH37384.1|151375_152926_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	3.5e-18
AZH37385.1|152972_155363_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AZH37386.1|155568_156105_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AZH37387.1|156145_156808_-	carbonic anhydrase	NA	NA	NA	NA	NA
AZH37388.1|156916_157843_+	multidrug ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
AZH37389.1|157839_158610_+	inner membrane transport permease YadH	NA	NA	NA	NA	NA
AZH37390.1|158714_159155_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AZH37391.1|159218_160448_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AZH37392.1|160451_160832_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AZH37393.1|160781_160985_+	hypothetical protein	NA	NA	NA	NA	NA
AZH37394.1|161105_162026_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	48.8	4.9e-60
AZH37395.1|162094_162292_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP023826	Escherichia coli strain 4/4 chromosome, complete genome	5129468	932141	1042859	5129468	tail,terminase,holin,integrase,protease,tRNA,portal,capsid,head,plate	Enterobacteria_phage(43.16%)	133	1027531:1027546	1046852:1046867
AZH38099.1|932141_932462_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AZH38100.1|932492_934769_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AZH38101.1|935453_935672_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZH38102.1|935956_936661_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZH38103.1|936702_938424_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
AZH38104.1|938424_940191_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AZH38105.1|940313_941279_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
AZH38106.1|941822_942317_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AZH38107.1|942451_946558_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AZH38108.1|946716_947328_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AZH38109.1|947338_948682_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AZH38110.1|948772_950065_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AZH38111.1|950370_950511_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AZH38112.1|950702_950963_-	hypothetical protein	NA	NA	NA	NA	NA
AZH38113.1|951003_952113_-	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
AZH38114.1|952270_953455_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
AZH38115.1|953454_953967_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AZH38116.1|954022_954397_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
AZH38117.1|954324_954561_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AZH38118.1|954547_957355_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
AZH38119.1|957361_957856_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	2.1e-86
AZH38120.1|957884_958484_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
AZH38121.1|958702_959260_+|tail	phage tail protein	tail	A0A0A7NPY7	Enterobacteria_phage	88.5	5.0e-84
AZH38122.1|959262_959796_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
AZH38123.1|959824_960352_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
AZH38124.1|960353_962576_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	65.0	3.8e-183
AZH38125.1|962578_963109_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
AZH38126.1|963101_963998_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
AZH38127.1|964001_964352_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
AZH38128.1|964348_964930_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
AZH38129.1|964926_965562_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
AZH38130.1|965554_966022_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
AZH38131.1|966045_967923_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
AZH38132.1|968061_968457_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
AZH38133.1|968453_968846_-	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
AZH38134.1|968842_969166_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
AZH38135.1|969168_969369_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AZH38136.1|969368_969863_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
AZH38137.1|969964_970765_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
AZH38138.1|970810_971863_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
AZH38139.1|971886_972723_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
AZH38140.1|972877_974629_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
AZH38141.1|974628_975675_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
AZH38142.1|975689_976214_-	hypothetical protein	NA	NA	NA	NA	NA
AZH38143.1|976937_977435_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
AZH38144.1|977474_978317_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38145.1|978400_978715_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
AZH38146.1|978719_979679_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
AZH42084.1|979755_982440_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
AZH38147.1|982584_982950_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
AZH38148.1|983022_983253_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	97.4	9.1e-32
AZH38149.1|983309_983525_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38150.1|983575_983875_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
AZH38151.1|983871_984138_-	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
AZH38152.1|984134_984338_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
AZH38153.1|984361_984772_-	hypothetical protein	NA	NA	NA	NA	NA
AZH38154.1|984975_985218_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AZH38155.1|985229_985508_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
AZH38156.1|985518_985869_-	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
AZH38157.1|986006_986198_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38158.1|986204_986627_-	hypothetical protein	NA	NA	NA	NA	NA
AZH38159.1|986631_987153_-	transcriptional regulator	NA	NA	NA	NA	NA
AZH42085.1|987257_987599_+	XRE family transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
AZH38160.1|987668_988661_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
AZH38161.1|988960_991405_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AZH38162.1|991415_992033_+	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AZH38163.1|992034_992898_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AZH38164.1|992933_993560_-	hydrolase	NA	NA	NA	NA	NA
AZH38165.1|993873_995022_+	MFS transporter	NA	NA	NA	NA	NA
AZH38166.1|995118_995859_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
AZH38167.1|996050_998333_-	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AZH38168.1|998387_999245_-	formate transporter FocA	NA	NA	NA	NA	NA
AZH38169.1|999650_1001411_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AZH38170.1|1001540_1002233_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AZH38171.1|1002431_1003520_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
AZH38172.1|1003590_1004874_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZH38173.1|1005129_1005702_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
AZH38174.1|1005761_1006286_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
AZH38175.1|1006285_1006900_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
AZH38176.1|1006906_1007368_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
AZH38177.1|1007378_1008626_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
AZH38178.1|1008628_1009207_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
AZH38179.1|1009199_1010303_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
AZH38180.1|1010293_1010641_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
AZH38181.1|1010695_1011292_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
AZH38182.1|1011288_1012443_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
AZH38183.1|1012430_1012646_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
AZH38184.1|1012642_1013527_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.9	6.8e-51
AZH38185.1|1013526_1016478_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
AZH38186.1|1016553_1016712_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZH38187.1|1016635_1016971_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZH38188.1|1017068_1017350_-	hypothetical protein	NA	NA	NA	NA	NA
AZH38189.1|1017352_1017874_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
AZH38190.1|1017873_1019301_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
AZH38191.1|1019290_1019545_-	hypothetical protein	NA	NA	NA	NA	NA
AZH38192.1|1019541_1020006_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AZH38193.1|1020005_1020452_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AZH38194.1|1020453_1020792_-	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
AZH38195.1|1020801_1021755_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
AZH38196.1|1021769_1022885_-	peptidase	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
AZH38197.1|1023099_1023558_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
AZH38198.1|1023560_1024382_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
AZH38199.1|1024362_1025859_-	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	58.8	1.7e-166
AZH38200.1|1025858_1027454_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.5e-185
AZH38201.1|1027450_1027996_-	DUF3486 domain-containing protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
1027531:1027546	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
AZH38202.1|1027995_1028307_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AZH38203.1|1028306_1028633_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
AZH38204.1|1028629_1029280_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
AZH38205.1|1029263_1030004_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
AZH38206.1|1030006_1030357_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
AZH38207.1|1030487_1031216_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38208.1|1031191_1031596_-	hypothetical protein	NA	NA	NA	NA	NA
AZH38209.1|1031594_1031810_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38210.1|1032000_1032765_+	restriction endonuclease subunit M	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
AZH38211.1|1032881_1033238_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZH38212.1|1033331_1033520_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
AZH38213.1|1033572_1033881_+	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
AZH38214.1|1033891_1034812_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
AZH38215.1|1034811_1035129_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38216.1|1035144_1036914_+|integrase	integrase	integrase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
AZH38217.1|1036924_1038091_+	hypothetical protein	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
AZH38218.1|1038093_1038363_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38219.1|1038390_1038921_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
AZH38220.1|1038931_1039153_-	hypothetical protein	NA	NA	NA	NA	NA
AZH38221.1|1039209_1039482_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38222.1|1039491_1039788_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38223.1|1039802_1040018_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38224.1|1040014_1040698_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
AZH38225.1|1040694_1040925_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38226.1|1040914_1041121_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38227.1|1041122_1041572_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
AZH38228.1|1041543_1041933_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
AZH38229.1|1042076_1042859_+|protease	metalloprotease	protease	NA	NA	NA	NA
1046852:1046867	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 3
CP023826	Escherichia coli strain 4/4 chromosome, complete genome	5129468	1253259	1298968	5129468	tail,terminase,holin,integrase,tRNA,portal,capsid,head	Enterobacteria_phage(56.0%)	60	1251577:1251591	1280171:1280185
1251577:1251591	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
AZH38428.1|1253259_1254366_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AZH38429.1|1254419_1254881_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AZH38430.1|1254890_1255544_-	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AZH38431.1|1255715_1256966_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	100.0	3.8e-23
AZH38432.1|1257079_1258222_-|integrase	integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
AZH38433.1|1258211_1258448_-	excisionase	NA	NA	NA	NA	NA
AZH38434.1|1258587_1258827_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
AZH38435.1|1258810_1259137_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
AZH38436.1|1259136_1259358_-	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
AZH38437.1|1259456_1259738_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
AZH38438.1|1259748_1259940_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
AZH38439.1|1259912_1260095_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
AZH38440.1|1260091_1260772_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
AZH38441.1|1260768_1261554_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AZH38442.1|1261559_1261856_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
AZH38443.1|1261931_1262138_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AZH38444.1|1262733_1263489_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AZH38445.1|1263527_1263758_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AZH38446.1|1263827_1264367_+	regulator	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
AZH38447.1|1264363_1265383_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
AZH38448.1|1265379_1266081_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
AZH38449.1|1266330_1270596_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AZH38450.1|1270632_1271676_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZH38451.1|1272025_1272127_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38452.1|1272123_1272579_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
AZH38453.1|1272578_1272749_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AZH38454.1|1272741_1273032_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
AZH38455.1|1273028_1273391_+	hypothetical protein	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
AZH38456.1|1273387_1273528_+	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
AZH38457.1|1273524_1274214_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
AZH38458.1|1274523_1274841_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.1	3.3e-40
AZH38459.1|1274827_1275304_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
AZH38460.1|1275520_1275703_+	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
AZH38461.1|1275793_1276087_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
AZH38462.1|1276513_1276894_+	hypothetical protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AZH38463.1|1277016_1277370_-	hypothetical protein	NA	NA	NA	NA	NA
AZH42098.1|1277257_1277578_-	hypothetical protein	NA	NA	NA	NA	NA
AZH38464.1|1277512_1277707_+	DNA-packaging protein	NA	NA	NA	NA	NA
AZH38465.1|1277846_1278392_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
AZH38466.1|1278366_1280292_+|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
1280171:1280185	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
AZH38467.1|1280288_1280495_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AZH38468.1|1280491_1282093_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
AZH38469.1|1282073_1283393_+|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
AZH38470.1|1283402_1283735_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AZH38471.1|1283790_1284816_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
AZH38472.1|1284857_1285256_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
AZH38473.1|1285267_1285621_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
AZH38474.1|1285632_1286211_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
AZH38475.1|1286207_1286603_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
AZH42099.1|1286610_1287351_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
AZH38476.1|1287366_1287789_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
AZH38477.1|1287770_1288205_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AZH38478.1|1288197_1290759_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
AZH38479.1|1290755_1291085_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
AZH38480.1|1291084_1291783_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
AZH38481.1|1291787_1292531_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
AZH38482.1|1292428_1293070_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	2.9e-96
AZH38483.1|1293130_1296613_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
AZH38484.1|1296671_1298693_+|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
AZH38485.1|1298689_1298968_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
>prophage 4
CP023826	Escherichia coli strain 4/4 chromosome, complete genome	5129468	1438959	1508674	5129468	lysis,tail,transposase,terminase,holin,integrase,protease,portal,capsid,head	Enterobacteria_phage(27.12%)	86	1435133:1435147	1441043:1441057
1435133:1435147	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
AZH38622.1|1438959_1440090_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
AZH38623.1|1440067_1440316_-	excisionase	NA	NA	NA	NA	NA
AZH38624.1|1440380_1442852_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
1441043:1441057	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
AZH38625.1|1442944_1443136_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AZH38626.1|1443132_1443321_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AZH38627.1|1443643_1443838_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38628.1|1443886_1444105_-	hypothetical protein	NA	NA	NA	NA	NA
AZH38629.1|1444134_1444305_-	hypothetical protein	NA	NA	NA	NA	NA
AZH42109.1|1444264_1444420_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AZH38630.1|1444692_1445409_-	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
AZH38631.1|1445458_1445674_+	transcriptional regulator	NA	NA	NA	NA	NA
AZH38632.1|1445670_1446096_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AZH42110.1|1446118_1447081_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
AZH38633.1|1447087_1447834_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
AZH38634.1|1447855_1448626_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
AZH38635.1|1448641_1449067_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
AZH38636.1|1449241_1449907_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38637.1|1450087_1450300_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
AZH38638.1|1450341_1450521_-	hypothetical protein	NA	NA	NA	NA	NA
AZH38639.1|1450467_1450740_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
AZH38640.1|1450741_1451797_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
AZH38641.1|1451797_1452178_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
AZH38642.1|1452174_1452996_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
AZH38643.1|1453222_1453420_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
AZH38644.1|1453571_1454621_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
AZH38645.1|1455060_1455387_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38646.1|1455422_1455554_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
AZH38647.1|1455834_1456170_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
AZH38648.1|1456430_1458284_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
AZH38649.1|1458434_1458650_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AZH38650.1|1458654_1458999_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
AZH38651.1|1458964_1459237_-	hypothetical protein	NA	NA	NA	NA	NA
AZH38652.1|1459342_1459876_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
AZH38653.1|1459953_1460166_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	60.5	2.7e-06
AZH42111.1|1460430_1460517_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38654.1|1460518_1461013_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	87.7	1.7e-72
AZH38655.1|1461009_1461225_+	hypothetical protein	NA	NA	NA	NA	NA
AZH42112.1|1461221_1461386_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	77.8	3.3e-12
AZH38656.1|1461423_1461624_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
AZH38657.1|1461665_1462031_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
AZH38658.1|1462321_1462885_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
AZH38659.1|1462881_1464543_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
AZH38660.1|1464606_1466544_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
AZH42113.1|1466588_1466810_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AZH38661.1|1466755_1469341_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
AZH38662.1|1469337_1469664_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
AZH38663.1|1469673_1470024_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AZH38664.1|1470020_1470467_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AZH38665.1|1470463_1470808_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AZH38666.1|1470874_1471591_+|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
AZH38667.1|1471605_1471980_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	3.9e-64
AZH38668.1|1472003_1472285_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AZH38669.1|1472332_1475575_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
AZH38670.1|1475567_1475909_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
AZH38671.1|1475908_1476607_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
AZH38672.1|1476617_1477361_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
AZH38673.1|1477258_1477939_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.8	3.8e-110
AZH38674.1|1478281_1481755_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
AZH38675.1|1481822_1482281_+	hypothetical protein	NA	Q9EV15	Enterobacteria_phage	89.0	9.5e-65
AZH38676.1|1482395_1483937_+|transposase	IS21 family transposase ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AZH38677.1|1483951_1484698_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AZH38678.1|1485159_1488066_+|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	45.9	1.1e-118
AZH38679.1|1488081_1488609_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
AZH38680.1|1488639_1489173_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
AZH38681.1|1489174_1489960_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	77.8	1.3e-109
AZH42114.1|1490187_1490370_+	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
AZH38682.1|1490486_1490624_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AZH42115.1|1490568_1491195_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZH38683.1|1491293_1491563_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
AZH38684.1|1491974_1492532_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
AZH38685.1|1492528_1492804_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
AZH38686.1|1493179_1493986_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AZH38687.1|1493985_1495179_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AZH38688.1|1495190_1496549_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
AZH38689.1|1496552_1498148_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AZH38690.1|1498147_1499710_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AZH42116.1|1499801_1499846_-	trp operon leader peptide	NA	NA	NA	NA	NA
AZH38691.1|1499983_1500865_+	phosphatase	NA	NA	NA	NA	NA
AZH38692.1|1500861_1501482_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AZH38693.1|1501509_1503405_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AZH38694.1|1503617_1504493_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AZH42117.1|1504698_1505685_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38695.1|1505694_1506003_+	hypothetical protein	NA	NA	NA	NA	NA
AZH38696.1|1506059_1506650_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AZH38697.1|1506646_1507405_-	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
AZH38698.1|1507624_1508674_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
CP023826	Escherichia coli strain 4/4 chromosome, complete genome	5129468	1985284	2074307	5129468	transposase,tail,terminase,holin,integrase,tRNA,portal,capsid,head,plate	Escherichia_phage(22.22%)	107	2031757:2031816	2074369:2074493
AZH39151.1|1985284_1986007_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	54.4	1.6e-69
AZH39152.1|1986111_1986633_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZH39153.1|1986742_1987753_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AZH39154.1|1987761_1988373_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AZH42135.1|1988511_1988577_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39155.1|1988647_1989250_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39156.1|1989251_1989773_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AZH39157.1|1989807_1990548_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZH39158.1|1990576_1991029_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AZH39159.1|1991021_1992794_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AZH39160.1|1993103_1993670_+	hydrolase	NA	NA	NA	NA	NA
AZH39161.1|1993666_1994485_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
AZH39162.1|1994537_1994933_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39163.1|1994973_1995717_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AZH39164.1|1995713_1996685_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AZH39165.1|1996720_1999150_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AZH39166.1|1999174_2000275_-	cytochrome C	NA	NA	NA	NA	NA
AZH39167.1|2000662_2001409_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AZH42136.1|2001422_2001989_-	VOC family protein	NA	NA	NA	NA	NA
AZH39168.1|2002204_2003938_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
AZH39169.1|2003990_2004383_-	flagellar protein FlhE	NA	NA	NA	NA	NA
AZH39170.1|2004382_2006461_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AZH39171.1|2006453_2007602_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
AZH39172.1|2007790_2008435_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
AZH39173.1|2008445_2008835_-	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AZH39174.1|2008849_2009899_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AZH39175.1|2009901_2010762_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AZH39176.1|2011052_2012714_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AZH39177.1|2012858_2013362_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AZH39178.1|2013382_2015347_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AZH39179.1|2015351_2016278_-	motility protein MotB	NA	NA	NA	NA	NA
AZH39180.1|2016274_2017162_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AZH39181.1|2017288_2017867_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
AZH39182.1|2017869_2018220_-	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
AZH39183.1|2018999_2019428_+	universal stress protein UspC	NA	NA	NA	NA	NA
AZH39184.1|2019434_2020859_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AZH39185.1|2020833_2021634_-	trehalose-phosphatase	NA	NA	NA	NA	NA
AZH39186.1|2021800_2022787_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
AZH39187.1|2022801_2024316_-	arabinose import ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
AZH39188.1|2024385_2025375_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZH39189.1|2025460_2025700_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39190.1|2026945_2027449_+	non-heme ferritin	NA	NA	NA	NA	NA
AZH39191.1|2027526_2027778_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AZH39192.1|2027889_2028036_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39193.1|2028242_2028566_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39194.1|2028737_2029235_+	non-heme ferritin	NA	NA	NA	NA	NA
AZH39195.1|2029272_2029512_-	DUF2492 domain-containing protein	NA	NA	NA	NA	NA
AZH39196.1|2029702_2030914_+	tyrosine transporter	NA	NA	NA	NA	NA
AZH39197.1|2030964_2031630_-	YecA family protein	NA	NA	NA	NA	NA
2031757:2031816	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
AZH39198.1|2032101_2032521_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
AZH39199.1|2033735_2033960_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZH42137.1|2034121_2034511_-	hypothetical protein	NA	E5FFG4	Burkholderia_phage	37.9	1.0e-14
AZH39200.1|2034546_2036187_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
AZH39201.1|2036295_2036577_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZH39202.1|2036589_2037102_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZH39203.1|2037119_2038622_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
AZH39204.1|2038618_2039008_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
AZH39205.1|2039007_2040192_-	hypothetical protein	NA	J9QDX3	Clostridium_phage	35.2	2.5e-16
AZH39206.1|2040184_2040811_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
AZH39207.1|2040813_2041734_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
AZH39208.1|2041730_2042072_-|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
AZH39209.1|2042074_2042977_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
AZH39210.1|2042957_2043494_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39211.1|2043490_2044171_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39212.1|2044202_2044583_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39213.1|2044579_2044999_-	DNA-packaging protein	NA	NA	NA	NA	NA
AZH39214.1|2045033_2046068_-|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
AZH39215.1|2046126_2046456_-|head	head protein	head	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
AZH39216.1|2046455_2047763_-|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
AZH39217.1|2047762_2049337_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
AZH39218.1|2049333_2049567_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39219.1|2049566_2051429_-|terminase	terminase	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
AZH39220.1|2051415_2051982_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
AZH42138.1|2052350_2052596_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39221.1|2052655_2052850_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39222.1|2052857_2053337_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
AZH39223.1|2053336_2053609_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
AZH39224.1|2053608_2053992_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39225.1|2054104_2054776_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
AZH39226.1|2054775_2055069_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
AZH39227.1|2055065_2055662_-	DUF1367 domain-containing protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
AZH39228.1|2055739_2055919_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39229.1|2056070_2056712_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39230.1|2056955_2057189_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39231.1|2057587_2058076_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
AZH39232.1|2058085_2058691_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39233.1|2059153_2059852_-	lysogenic protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
AZH39234.1|2061040_2061964_+	hypothetical protein	NA	NA	NA	NA	NA
AZH42139.1|2062138_2062927_-	hypothetical protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
AZH39235.1|2063199_2063421_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39236.1|2063608_2063833_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39237.1|2063829_2064141_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
AZH39238.1|2064137_2064374_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39239.1|2064375_2064786_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39240.1|2064824_2066240_-	helicase DnaB	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
AZH39241.1|2066229_2066985_-	replication protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
AZH39242.1|2066981_2067206_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
AZH39243.1|2067245_2067722_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
AZH39244.1|2067780_2068011_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
AZH39245.1|2068109_2068523_+	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
AZH39246.1|2069533_2069854_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39247.1|2069884_2072101_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
AZH39248.1|2072097_2072667_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
AZH39249.1|2072666_2072849_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39250.1|2072898_2073123_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	56.3	7.3e-10
AZH39251.1|2073058_2073322_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
AZH39252.1|2073290_2074307_+|integrase	integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
2074369:2074493	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 6
CP023826	Escherichia coli strain 4/4 chromosome, complete genome	5129468	2092527	2170545	5129468	transposase,tail,terminase,holin,integrase,protease,portal,capsid,head	Escherichia_phage(38.18%)	104	2149629:2149643	2171234:2171248
AZH39273.1|2092527_2093076_+|transposase	transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	1.4e-33
AZH39274.1|2093232_2094030_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZH39275.1|2094039_2094591_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AZH39276.1|2094759_2095092_-	multidrug SMR transporter	NA	NA	NA	NA	NA
AZH39277.1|2095191_2095404_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39278.1|2095435_2095750_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AZH39279.1|2095964_2097623_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
AZH39280.1|2097615_2098611_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AZH39281.1|2098603_2099290_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AZH39282.1|2099289_2100663_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
AZH39283.1|2100681_2101125_+	flagellar protein FliJ	NA	NA	NA	NA	NA
AZH39284.1|2101121_2102249_+	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
AZH39285.1|2102353_2102818_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AZH39286.1|2102822_2103827_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AZH39287.1|2103823_2104237_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AZH39288.1|2104239_2104605_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
AZH39289.1|2104604_2105342_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AZH39290.1|2105351_2105621_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AZH39291.1|2105629_2106415_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
AZH39292.1|2106704_2107328_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
AZH39293.1|2107371_2107614_-	DsrB protein	NA	NA	NA	NA	NA
AZH39294.1|2107546_2107735_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39295.1|2107722_2107950_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AZH39296.1|2108245_2109061_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AZH39297.1|2109057_2110752_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
AZH39298.1|2110672_2110861_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39299.1|2110922_2111105_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AZH39300.1|2111183_2112101_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39301.1|2112273_2113194_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AZH39302.1|2113182_2113653_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
AZH39303.1|2113633_2115052_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
AZH39304.1|2115118_2115814_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
AZH39305.1|2115853_2116219_-	permease	NA	NA	NA	NA	NA
AZH39306.1|2116311_2116515_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39307.1|2116784_2117900_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	47.4	2.9e-91
AZH39308.1|2118492_2119344_+	Molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
AZH39309.1|2119451_2120810_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AZH42140.1|2120809_2121481_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AZH39310.1|2121613_2122027_+	5-hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AZH39311.1|2122135_2123140_+	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AZH39312.1|2123140_2123776_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AZH39313.1|2123859_2124582_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	54.4	3.1e-70
AZH39314.1|2124686_2125208_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZH39315.1|2125468_2126119_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AZH39316.1|2126154_2126484_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39317.1|2127199_2127487_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39318.1|2127496_2127775_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	1.0e-21
AZH39319.1|2127771_2129835_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	62.7	3.7e-148
AZH39320.1|2129986_2130586_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.0	7.5e-102
AZH39321.1|2130653_2134352_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	74.7	0.0e+00
AZH39322.1|2134412_2135060_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.1	2.7e-113
AZH39323.1|2134957_2135701_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.7e-149
AZH39324.1|2135705_2136404_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	8.1e-132
AZH39325.1|2136403_2136760_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	3.7e-40
AZH39326.1|2136737_2139965_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.6	0.0e+00
AZH42141.1|2140011_2140272_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.7e-39
AZH39327.1|2140313_2140700_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
AZH39328.1|2140699_2141404_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	93.6	1.7e-113
AZH39329.1|2141463_2141808_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
AZH39330.1|2141804_2142254_-	hypothetical protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
AZH39331.1|2142250_2142589_-|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
AZH39332.1|2142597_2142915_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	1.8e-22
AZH39333.1|2142991_2144209_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
AZH39334.1|2144223_2144823_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
AZH39335.1|2144815_2146042_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.1	1.1e-203
AZH39336.1|2146189_2147947_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
AZH39337.1|2147946_2148429_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
AZH39338.1|2148576_2148927_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	4.3e-65
AZH39339.1|2149065_2149605_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39340.1|2149610_2149877_-	hypothetical protein	NA	NA	NA	NA	NA
2149629:2149643	attL	CGCCTTATTATGCTC	NA	NA	NA	NA
AZH39341.1|2150094_2150280_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
AZH39342.1|2150496_2151030_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
AZH39343.1|2151093_2151444_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
AZH39344.1|2151448_2151664_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
AZH39345.1|2152459_2153149_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	9.6e-61
AZH39346.1|2153145_2153511_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	3.2e-39
AZH39347.1|2153511_2154567_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	7.5e-89
AZH39348.1|2154568_2154847_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
AZH39349.1|2155143_2155536_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39350.1|2155679_2155892_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
AZH42142.1|2156125_2156359_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
AZH39351.1|2156466_2156634_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
AZH39352.1|2156644_2156908_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
AZH39353.1|2156909_2157350_-	hypothetical protein	NA	A0A2I6PID2	Escherichia_phage	50.3	2.0e-19
AZH39354.1|2157351_2157711_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	74.5	1.6e-38
AZH39355.1|2157876_2158059_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	6.9e-27
AZH39356.1|2158152_2158509_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
AZH39357.1|2158510_2159047_-	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	97.9	6.3e-52
AZH39358.1|2159039_2159339_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	97.0	5.6e-50
AZH39359.1|2159335_2159758_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	4.7e-66
AZH39360.1|2159798_2160869_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
AZH39361.1|2160940_2161366_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AZH39362.1|2161362_2161590_-	cell division protein	NA	NA	NA	NA	NA
AZH39363.1|2161686_2162334_+	helix-turn-helix domain-containing protein	NA	A0A1P8DTH0	Proteus_phage	25.9	8.9e-08
AZH42143.1|2162611_2162767_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
AZH39364.1|2162726_2162897_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39365.1|2162926_2163145_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39366.1|2163713_2163902_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AZH39367.1|2163898_2164090_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AZH39368.1|2164183_2166625_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.8	9.2e-114
AZH39369.1|2166683_2166887_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AZH39370.1|2166886_2167912_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
AZH42144.1|2168147_2168945_+	protein MtfA	NA	NA	NA	NA	NA
AZH39371.1|2169282_2170545_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
2171234:2171248	attR	CGCCTTATTATGCTC	NA	NA	NA	NA
>prophage 7
CP023826	Escherichia coli strain 4/4 chromosome, complete genome	5129468	2237434	2271243	5129468	transposase	Escherichia_phage(18.18%)	39	NA	NA
AZH39417.1|2237434_2238631_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZH39418.1|2238679_2239033_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AZH39419.1|2239111_2239729_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39420.1|2240202_2240418_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39421.1|2240754_2241450_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	88.4	2.3e-118
AZH39422.1|2241446_2242469_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AZH39423.1|2242614_2242794_+|transposase	transposase	transposase	NA	NA	NA	NA
AZH42148.1|2243019_2243397_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39424.1|2243353_2243584_+	hypothetical protein	NA	NA	NA	NA	NA
AZH42149.1|2243993_2245139_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39425.1|2245669_2245927_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39426.1|2245980_2246748_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
AZH39427.1|2246744_2247803_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AZH39428.1|2247821_2248811_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZH39429.1|2248821_2250987_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AZH39430.1|2251415_2251850_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39431.1|2252067_2254452_+	dGTPase	NA	NA	NA	NA	NA
AZH39432.1|2254448_2255354_+	chemotaxis protein	NA	NA	NA	NA	NA
AZH39433.1|2255350_2256421_+	phospholipase	NA	NA	NA	NA	NA
AZH39434.1|2256556_2256970_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39435.1|2257084_2258626_+|transposase	IS21 family transposase ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AZH39436.1|2258640_2259387_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AZH39437.1|2259835_2260246_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39438.1|2260466_2261285_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
AZH39439.1|2261284_2261530_+	antirestriction protein	NA	NA	NA	NA	NA
AZH39440.1|2261623_2262097_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
AZH42150.1|2262142_2262589_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39441.1|2262651_2262873_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AZH39442.1|2262891_2263536_+	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
AZH39443.1|2263551_2263920_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AZH39444.1|2264008_2264383_+	toxin	NA	NA	NA	NA	NA
AZH42151.1|2264382_2264574_+	hypothetical protein	NA	NA	NA	NA	NA
AZH42152.1|2265188_2265371_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
AZH39445.1|2265471_2265801_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39446.1|2265972_2267031_-	FUSC family protein	NA	NA	NA	NA	NA
AZH39447.1|2267228_2267702_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
AZH39448.1|2267820_2268987_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
AZH39449.1|2269195_2270623_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AZH39450.1|2270733_2271243_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.8e-11
>prophage 8
CP023826	Escherichia coli strain 4/4 chromosome, complete genome	5129468	2294339	2300642	5129468		Enterobacteria_phage(66.67%)	6	NA	NA
AZH39474.1|2294339_2294882_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
AZH39475.1|2294886_2295765_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
AZH39476.1|2295822_2296722_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
AZH42154.1|2296721_2297807_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
AZH39477.1|2298179_2299073_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
AZH39478.1|2299247_2300642_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 9
CP023826	Escherichia coli strain 4/4 chromosome, complete genome	5129468	2394818	2404263	5129468		Enterobacteria_phage(85.71%)	10	NA	NA
AZH39548.1|2394818_2395955_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
AZH39549.1|2395951_2397955_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AZH39550.1|2398079_2398541_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AZH39551.1|2398581_2399052_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AZH39552.1|2399098_2399818_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZH39553.1|2399814_2401500_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AZH39554.1|2401721_2402453_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
AZH39555.1|2402512_2402620_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39556.1|2402600_2403332_-	ABC transporter permease	NA	NA	NA	NA	NA
AZH39557.1|2403336_2404263_-	ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 10
CP023826	Escherichia coli strain 4/4 chromosome, complete genome	5129468	2758561	2825097	5129468	tail,terminase,holin,integrase,tRNA,protease	Escherichia_phage(47.27%)	76	2781891:2781907	2821983:2821999
AZH39878.1|2758561_2760577_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
AZH39879.1|2760591_2761455_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
AZH39880.1|2761622_2762336_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
AZH39881.1|2762548_2763583_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AZH39882.1|2763599_2764478_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AZH39883.1|2764623_2765196_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
AZH39884.1|2765195_2765666_+	peroxiredoxin	NA	NA	NA	NA	NA
AZH39885.1|2765763_2766825_-	AI-2E family transporter	NA	NA	NA	NA	NA
AZH39886.1|2767037_2768501_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AZH39887.1|2768521_2768881_+	oxidoreductase	NA	NA	NA	NA	NA
AZH39888.1|2769018_2769765_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
AZH39889.1|2769814_2771104_-	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
AZH39890.1|2771189_2771816_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AZH39891.1|2771936_2772122_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39892.1|2772140_2773178_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.8e-71
AZH39893.1|2773177_2773816_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
AZH39894.1|2773987_2776054_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AZH39895.1|2776058_2777600_+	exopolyphosphatase	NA	NA	NA	NA	NA
AZH39896.1|2777638_2779882_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AZH39897.1|2780063_2780216_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	90.0	7.1e-17
AZH39898.1|2780233_2780425_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AZH39899.1|2780486_2780624_+	succinate dehydrogenase	NA	NA	NA	NA	NA
AZH39900.1|2780726_2781245_+	hypothetical protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
AZH39901.1|2781260_2781800_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
2781891:2781907	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
AZH39902.1|2781994_2782492_-	DUF2514 domain-containing protein	NA	A0A193GYU6	Enterobacter_phage	69.6	1.3e-51
AZH39903.1|2782488_2783118_-	endolysin	NA	G9L6E8	Escherichia_phage	97.6	3.4e-113
AZH39904.1|2783107_2783416_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	98.0	6.4e-49
AZH39905.1|2783402_2783807_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	91.8	1.6e-60
AZH39906.1|2783903_2785925_-|tail	phage tail protein	tail	G9L6E4	Escherichia_phage	56.1	1.8e-59
AZH39907.1|2786120_2786378_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	98.8	3.7e-42
AZH39908.1|2786693_2787404_+	BRO-like protein	NA	G9L6E2	Escherichia_phage	79.8	3.4e-101
AZH39909.1|2787517_2787727_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39910.1|2787786_2788002_+	hypothetical protein	NA	NA	NA	NA	NA
AZH39911.1|2787949_2788465_+	DUF2335 domain-containing protein	NA	S5WJ01	Leptospira_phage	28.8	1.9e-08
AZH39912.1|2788563_2789124_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39913.1|2789126_2791676_-	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	45.5	3.1e-205
AZH39914.1|2791675_2793373_-	hypothetical protein	NA	NA	NA	NA	NA
AZH39915.1|2793374_2795996_-	Lytic transglycosylase, catalytic	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	39.1	6.4e-73
AZH39916.1|2795995_2796541_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
AZH39917.1|2796540_2797005_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
AZH39918.1|2797004_2799476_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.9	0.0e+00
AZH39919.1|2799475_2800081_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	4.7e-112
AZH39920.1|2800080_2800404_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
AZH39921.1|2800454_2800790_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	96.4	1.6e-53
AZH39922.1|2800800_2801238_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	95.9	2.9e-71
AZH39923.1|2801289_2802276_-	hypothetical protein	NA	A0A0F6TJQ9	Escherichia_coli_O157_typing_phage	100.0	1.5e-187
AZH39924.1|2802290_2802986_-	peptidase	NA	G9L6C4	Escherichia_phage	97.8	3.7e-92
AZH39925.1|2802988_2803285_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
AZH39926.1|2803281_2804961_-|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.3	1.8e-302
AZH39927.1|2804975_2805182_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
AZH39928.1|2805888_2806260_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	99.2	1.1e-63
AZH39929.1|2806350_2807826_-|terminase	terminase	terminase	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.2	2.9e-296
AZH39930.1|2807822_2808497_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
AZH39931.1|2808537_2808876_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	8.3e-58
AZH39932.1|2808868_2809237_-	protein ninX	NA	G9L6B5	Escherichia_phage	71.3	4.4e-44
AZH39933.1|2809236_2810256_-	DUF551 domain-containing protein	NA	A0A1B0V865	Salmonella_phage	61.3	2.1e-88
AZH39934.1|2810266_2810464_-	hypothetical protein	NA	A0A1I9SEY0	Klebsiella_phage	86.2	1.1e-30
AZH39935.1|2810465_2811206_-	hypothetical protein	NA	A5VWB3	Enterobacteria_phage	90.1	1.3e-42
AZH39936.1|2811202_2811841_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	95.8	7.9e-126
AZH39937.1|2811837_2812491_-	eae-like domain protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	58.4	1.2e-57
AZH39938.1|2812552_2812900_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	98.3	3.1e-60
AZH39939.1|2813017_2813800_-	replication protein	NA	G9L6A9	Escherichia_phage	90.4	1.9e-137
AZH39940.1|2813774_2814608_-	primosomal protein	NA	Q286X4	Escherichia_phage	93.7	3.3e-100
AZH39941.1|2814623_2814824_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
AZH39942.1|2814974_2815205_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
AZH39943.1|2815359_2815944_+	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.5	2.7e-104
AZH39944.1|2816252_2816552_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	6.4e-46
AZH39945.1|2816548_2817370_+	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	98.5	4.0e-162
AZH39946.1|2817366_2818248_+	recombinase RecT	NA	G9L6A2	Escherichia_phage	99.0	6.8e-160
AZH39947.1|2818297_2818546_+	transcriptional regulator	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AZH42161.1|2818703_2818955_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
AZH39948.1|2818947_2819598_+	adenine methylase	NA	G9L699	Escherichia_phage	97.2	3.1e-125
AZH39949.1|2819851_2820508_+	phage antirepressor Ant	NA	A0A0P0ZDY7	Stx2-converting_phage	80.3	3.7e-54
AZH39950.1|2820541_2821792_-|integrase	integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	8.0e-239
AZH39951.1|2821984_2823562_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
2821983:2821999	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
AZH39952.1|2823630_2825097_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
>prophage 11
CP023826	Escherichia coli strain 4/4 chromosome, complete genome	5129468	2957627	2964453	5129468		Enterobacteria_phage(100.0%)	9	NA	NA
AZH40059.1|2957627_2958200_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	1.4e-94
AZH40060.1|2958273_2958774_-	transactivation protein	NA	NA	NA	NA	NA
AZH40061.1|2958770_2959505_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	6.1e-130
AZH40062.1|2960058_2960325_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AZH40063.1|2960321_2960921_+	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	80.3	6.6e-50
AZH40064.1|2960913_2961201_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AZH40065.1|2961193_2961649_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
AZH40066.1|2961784_2962105_+	hypothetical protein	NA	NA	NA	NA	NA
AZH40067.1|2962119_2964453_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
>prophage 12
CP023826	Escherichia coli strain 4/4 chromosome, complete genome	5129468	3053340	3062106	5129468	integrase	Escherichia_phage(71.43%)	7	3052289:3052302	3068262:3068275
3052289:3052302	attL	TTTCTATATCGCCT	NA	NA	NA	NA
AZH40159.1|3053340_3054801_-|integrase	integrase	integrase	A0A0R6PHM8	Moraxella_phage	24.4	1.0e-19
AZH40160.1|3054960_3057528_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.2e-31
AZH40161.1|3057633_3058290_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
AZH40162.1|3058340_3059108_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
AZH40163.1|3059303_3060212_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
AZH40164.1|3060208_3061471_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
AZH40165.1|3061467_3062106_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
3068262:3068275	attR	AGGCGATATAGAAA	NA	NA	NA	NA
>prophage 13
CP023826	Escherichia coli strain 4/4 chromosome, complete genome	5129468	4442762	4502810	5129468	lysis,tail,terminase,holin,integrase,tRNA,portal,capsid,head,plate	Escherichia_phage(43.9%)	71	4471835:4471881	4503675:4503721
AZH41419.1|4442762_4443200_+|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AZH41420.1|4443196_4444186_+	acetyltransferase	NA	NA	NA	NA	NA
AZH41421.1|4444249_4445158_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZH41422.1|4445386_4445698_+	toxin HigB-2	NA	NA	NA	NA	NA
AZH41423.1|4445698_4445989_+	transcriptional regulator	NA	NA	NA	NA	NA
AZH41424.1|4446073_4446286_+	hypothetical protein	NA	NA	NA	NA	NA
AZH41425.1|4446347_4446626_+	hypothetical protein	NA	NA	NA	NA	NA
AZH42217.1|4447028_4447241_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AZH42218.1|4447425_4447875_-	hypothetical protein	NA	NA	NA	NA	NA
AZH41426.1|4448190_4449039_-	hypothetical protein	NA	NA	NA	NA	NA
AZH41427.1|4449352_4449571_+	hypothetical protein	NA	NA	NA	NA	NA
AZH41428.1|4449752_4450682_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
AZH41429.1|4450678_4451314_-	formate dehydrogenase cytochrome b556(fdo) subunit	NA	NA	NA	NA	NA
AZH41430.1|4451310_4452213_-	formate dehydrogenase-O iron-sulfur subunit	NA	NA	NA	NA	NA
AZH41431.1|4452225_4455276_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
AZH41432.1|4455279_4455534_+	hypothetical protein	NA	NA	NA	NA	NA
AZH41433.1|4455469_4456303_+	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AZH41434.1|4457298_4458693_+	porin	NA	NA	NA	NA	NA
AZH41435.1|4458733_4459048_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
AZH41436.1|4459057_4459882_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
AZH41437.1|4460148_4461408_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
AZH41438.1|4461404_4462874_-	rhamnulokinase	NA	NA	NA	NA	NA
AZH41439.1|4463161_4463998_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
AZH41440.1|4463981_4464920_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
AZH41441.1|4464916_4465951_-	rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
AZH41442.1|4466235_4466856_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	5.4e-63
AZH41443.1|4467030_4467138_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AZH41444.1|4467115_4468099_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AZH41445.1|4468247_4468922_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AZH41446.1|4469092_4470466_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
AZH41447.1|4470462_4471161_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AZH42219.1|4471310_4471811_+	periplasmic protein CpxP	NA	NA	NA	NA	NA
4471835:4471881	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
AZH41448.1|4471996_4472977_-|integrase	integrase	integrase	S4TP66	Salmonella_phage	98.2	1.7e-183
AZH41449.1|4473046_4473340_-	XRE family transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	100.0	4.0e-48
AZH41450.1|4473475_4473748_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	100.0	5.3e-47
AZH41451.1|4473917_4474418_+	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AZH41452.1|4474481_4474706_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AZH41453.1|4474705_4475008_+	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	98.0	3.8e-46
AZH41454.1|4475007_4475232_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AZH41455.1|4475228_4475504_+	hypothetical protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
AZH41456.1|4475493_4477761_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.5	0.0e+00
AZH41457.1|4477844_4479167_+	hypothetical protein	NA	NA	NA	NA	NA
AZH41458.1|4479496_4480531_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
AZH41459.1|4480530_4482303_-	oxidoreductase	NA	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
AZH41460.1|4482476_4483331_+|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
AZH41461.1|4483389_4484463_+|capsid	phage major capsid protein, P2 family	capsid	Q778Z0	Enterobacteria_phage	99.7	1.9e-201
AZH41462.1|4484466_4485210_+|terminase	terminase	terminase	A0A0F7LBP7	Escherichia_phage	98.4	7.8e-125
AZH41463.1|4485309_4485819_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AZH41464.1|4485818_4486022_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AZH41465.1|4486025_4486307_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
AZH41466.1|4486306_4486804_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
AZH41467.1|4486818_4487244_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	92.9	7.5e-56
AZH41468.1|4487231_4487657_+	protein lysB	NA	U5N3W5	Enterobacteria_phage	94.3	4.0e-65
AZH41469.1|4487628_4487802_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
AZH41470.1|4487764_4488232_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
AZH41471.1|4488224_4488677_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
AZH41472.1|4488743_4489379_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.7e-112
AZH41473.1|4489375_4489723_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
AZH41474.1|4489727_4490636_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	4.4e-162
AZH41475.1|4490628_4491159_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
AZH41476.1|4491169_4493788_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	72.9	2.9e-283
AZH41477.1|4493787_4494366_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	65.4	6.8e-68
AZH41478.1|4494694_4495774_+	hypothetical protein	NA	NA	NA	NA	NA
AZH41479.1|4496208_4497399_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
AZH41480.1|4497411_4497930_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AZH41481.1|4497986_4498262_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AZH42220.1|4498294_4498414_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AZH41482.1|4498406_4500854_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.3	0.0e+00
AZH41483.1|4500868_4501348_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
AZH41484.1|4501347_4502511_+	hypothetical protein	NA	Q858U5	Yersinia_virus	99.5	1.4e-205
AZH41485.1|4502510_4502810_+	transcriptional regulator	NA	Q858U4	Yersinia_virus	99.0	3.8e-54
4503675:4503721	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
>prophage 14
CP023826	Escherichia coli strain 4/4 chromosome, complete genome	5129468	4951292	5006835	5129468	holin,transposase	Stx2-converting_phage(28.57%)	60	NA	NA
AZH41885.1|4951292_4952906_+|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AZH41886.1|4953176_4954190_-	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
AZH41887.1|4954201_4955518_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AZH41888.1|4955545_4956466_-	ribokinase	NA	NA	NA	NA	NA
AZH41889.1|4956771_4957554_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AZH41890.1|4957555_4957654_-	acetolactate synthase	NA	NA	NA	NA	NA
AZH42233.1|4957781_4957982_-	hypothetical protein	NA	NA	NA	NA	NA
AZH41891.1|4958169_4958367_+	hypothetical protein	NA	NA	NA	NA	NA
AZH41892.1|4958380_4958584_+	hypothetical protein	NA	NA	NA	NA	NA
AZH41893.1|4958758_4958887_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZH41894.1|4958905_4959010_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZH41895.1|4959067_4959724_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZH41896.1|4959971_4961249_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AZH41897.1|4961208_4961367_-|holin	choline transporter	holin	NA	NA	NA	NA
AZH41898.1|4961311_4963315_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
AZH41899.1|4963463_4964620_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
AZH41900.1|4965397_4965811_+	hypothetical protein	NA	NA	NA	NA	NA
AZH41901.1|4966367_4967135_-	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AZH41902.1|4967135_4968092_-	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AZH41903.1|4968088_4969087_-	Fe3+ dicitrate ABC transporter permease	NA	NA	NA	NA	NA
AZH41904.1|4969083_4969986_-	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AZH41905.1|4970030_4972355_-	fe(3+) dicitrate transporter fecA	NA	NA	NA	NA	NA
AZH41906.1|4972441_4973395_-	protein FecR	NA	NA	NA	NA	NA
AZH41907.1|4973391_4973913_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AZH41908.1|4975459_4976833_+	esterase-like activity of phytase	NA	NA	NA	NA	NA
AZH41909.1|4977071_4978457_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
AZH41910.1|4978506_4978854_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AZH42234.1|4978850_4979231_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AZH41911.1|4979349_4979586_-	hypothetical protein	NA	NA	NA	NA	NA
AZH41912.1|4979585_4980107_-	hypothetical protein	NA	NA	NA	NA	NA
AZH41913.1|4980007_4980415_-	hypothetical protein	NA	NA	NA	NA	NA
AZH41914.1|4980668_4981274_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AZH41915.1|4981437_4981635_+	hypothetical protein	NA	NA	NA	NA	NA
AZH41916.1|4981747_4981948_-	hypothetical protein	NA	NA	NA	NA	NA
AZH41917.1|4981967_4982117_-	hemolysin activation protein	NA	NA	NA	NA	NA
AZH41918.1|4983177_4983795_+	hypothetical protein	NA	NA	NA	NA	NA
AZH42235.1|4983700_4983898_-	hypothetical protein	NA	NA	NA	NA	NA
AZH41919.1|4983966_4984164_+	hypothetical protein	NA	NA	NA	NA	NA
AZH41920.1|4984647_4984863_-	hypothetical protein	NA	NA	NA	NA	NA
AZH41921.1|4984995_4985913_+	hypothetical protein	NA	NA	NA	NA	NA
AZH41922.1|4985997_4986870_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
AZH41923.1|4987242_4990089_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
AZH41924.1|4990123_4990318_+	hypothetical protein	NA	NA	NA	NA	NA
AZH41925.1|4990317_4990452_+	cytoplasmic protein	NA	NA	NA	NA	NA
AZH41926.1|4990472_4991291_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
AZH41927.1|4991632_4992106_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
AZH42236.1|4992151_4992598_+	hypothetical protein	NA	NA	NA	NA	NA
AZH41928.1|4992660_4992882_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AZH41929.1|4993044_4993413_+	antitoxin	NA	NA	NA	NA	NA
AZH41930.1|4993502_4993880_+	toxin	NA	NA	NA	NA	NA
AZH41931.1|4993876_4994365_+	hypothetical protein	NA	NA	NA	NA	NA
AZH41932.1|4994381_4994558_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AZH41933.1|4996128_4997769_+	Alw26I/Eco31I/Esp3I family type II restriction adenine-specific DNA-methyltransferase	NA	NA	NA	NA	NA
AZH41934.1|4997761_4998952_+	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	31.0	7.3e-16
AZH41935.1|4998964_5000704_-	Alw26I/Eco31I/Esp3I family type II restriction endonuclease	NA	NA	NA	NA	NA
AZH41936.1|5000813_5002100_-	restriction endonuclease	NA	NA	NA	NA	NA
AZH41937.1|5002092_5004168_-	restriction endonuclease	NA	K4I1H4	Acidithiobacillus_phage	33.8	7.7e-37
AZH41938.1|5004588_5004771_-	hypothetical protein	NA	NA	NA	NA	NA
AZH41939.1|5005271_5005526_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZH41940.1|5005688_5006835_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
>prophage 1
CP023827	Escherichia coli strain 4/4 plasmid p4_4.1, complete sequence	125877	48356	108112	125877	transposase	Escherichia_phage(42.86%)	58	NA	NA
AZH42302.1|48356_49373_-|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
AZH42380.1|49580_50984_+	S-methylmethionine permease	NA	NA	NA	NA	NA
AZH42303.1|50970_51903_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AZH42304.1|55245_56223_+	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
AZH42305.1|56507_57248_-	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
AZH42306.1|57368_57557_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AZH42307.1|57923_59093_+	hypothetical protein	NA	NA	NA	NA	NA
AZH42308.1|59939_60212_-	transcriptional regulator	NA	NA	NA	NA	NA
AZH42309.1|61454_63425_+	ligand-gated channel	NA	NA	NA	NA	NA
AZH42310.1|63431_64223_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
AZH42311.1|64961_65744_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
AZH42312.1|65740_66763_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
AZH42313.1|67842_68190_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AZH42314.1|68186_68591_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
AZH42315.1|69092_70616_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
AZH42316.1|70909_71281_+	hypothetical protein	NA	NA	NA	NA	NA
AZH42317.1|72866_74141_-	TieB	NA	NA	NA	NA	NA
AZH42318.1|74110_76372_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZH42319.1|76540_77317_-	energy transducer TonB	NA	NA	NA	NA	NA
AZH42320.1|77324_78242_-	iron-regulated protein	NA	NA	NA	NA	NA
AZH42321.1|79067_79322_+	hypothetical protein	NA	NA	NA	NA	NA
AZH42322.1|79655_79838_+	hypothetical protein	NA	NA	NA	NA	NA
AZH42323.1|80237_80420_-	hypothetical protein	NA	NA	NA	NA	NA
AZH42324.1|80423_80633_+	hypothetical protein	NA	NA	NA	NA	NA
AZH42325.1|80650_80986_-	colicin transporter	NA	NA	NA	NA	NA
AZH42326.1|80963_81182_-	hypothetical protein	NA	NA	NA	NA	NA
AZH42327.1|81114_81462_+	hypothetical protein	NA	NA	NA	NA	NA
AZH42328.1|81481_81991_-	hypothetical protein	NA	NA	NA	NA	NA
AZH42329.1|81987_82248_-	hypothetical protein	NA	NA	NA	NA	NA
AZH42330.1|83081_83453_-	hypothetical protein	NA	NA	NA	NA	NA
AZH42331.1|85154_85640_-	hypothetical protein	NA	NA	NA	NA	NA
AZH42332.1|85664_86219_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AZH42333.1|86136_86832_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
AZH42334.1|86836_87997_-	ABC transporter permease	NA	NA	NA	NA	NA
AZH42335.1|87956_89240_-	ABC transporter permease	NA	NA	NA	NA	NA
AZH42336.1|89242_90622_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
AZH42337.1|90725_91253_-	iron transporter	NA	NA	NA	NA	NA
AZH42338.1|91293_93240_-	iron permease	NA	NA	NA	NA	NA
AZH42381.1|93182_93368_-	hypothetical protein	NA	NA	NA	NA	NA
AZH42339.1|93526_94342_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit C	NA	NA	NA	NA	NA
AZH42340.1|94524_95031_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
AZH42341.1|95020_95248_-	scsC protein	NA	NA	NA	NA	NA
AZH42342.1|96621_97326_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZH42382.1|98291_98765_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
AZH42343.1|98895_99684_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AZH42344.1|99889_100237_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AZH42345.1|100230_101070_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AZH42346.1|100999_101179_-	hypothetical protein	NA	NA	NA	NA	NA
AZH42347.1|101197_101401_+	hypothetical protein	NA	NA	NA	NA	NA
AZH42348.1|101556_102762_+	chromate transporter	NA	NA	NA	NA	NA
AZH42349.1|102772_103078_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZH42350.1|103093_103276_-	resolvase	NA	NA	NA	NA	NA
AZH42383.1|103304_104069_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AZH42351.1|104259_104616_-	hypothetical protein	NA	NA	NA	NA	NA
AZH42352.1|104561_105146_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZH42353.1|105145_106384_-	MFS transporter	NA	NA	NA	NA	NA
AZH42354.1|106380_107286_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AZH42355.1|107407_108112_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
